ID: 1119880002

View in Genome Browser
Species Human (GRCh38)
Location 14:78092410-78092432
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119880002_1119880014 23 Left 1119880002 14:78092410-78092432 CCTGCCAGTTTGACTTCAGGCTT No data
Right 1119880014 14:78092456-78092478 CTCTGAAGGCCAGTGGTCTGGGG No data
1119880002_1119880007 9 Left 1119880002 14:78092410-78092432 CCTGCCAGTTTGACTTCAGGCTT No data
Right 1119880007 14:78092442-78092464 ATCCACCCTCATCTCTCTGAAGG No data
1119880002_1119880013 22 Left 1119880002 14:78092410-78092432 CCTGCCAGTTTGACTTCAGGCTT No data
Right 1119880013 14:78092455-78092477 TCTCTGAAGGCCAGTGGTCTGGG No data
1119880002_1119880011 16 Left 1119880002 14:78092410-78092432 CCTGCCAGTTTGACTTCAGGCTT No data
Right 1119880011 14:78092449-78092471 CTCATCTCTCTGAAGGCCAGTGG No data
1119880002_1119880012 21 Left 1119880002 14:78092410-78092432 CCTGCCAGTTTGACTTCAGGCTT No data
Right 1119880012 14:78092454-78092476 CTCTCTGAAGGCCAGTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119880002 Original CRISPR AAGCCTGAAGTCAAACTGGC AGG (reversed) Intergenic