ID: 1119880003

View in Genome Browser
Species Human (GRCh38)
Location 14:78092414-78092436
Sequence GGGCAAGCCTGAAGTCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119880003_1119880011 12 Left 1119880003 14:78092414-78092436 CCAGTTTGACTTCAGGCTTGCCC No data
Right 1119880011 14:78092449-78092471 CTCATCTCTCTGAAGGCCAGTGG No data
1119880003_1119880007 5 Left 1119880003 14:78092414-78092436 CCAGTTTGACTTCAGGCTTGCCC No data
Right 1119880007 14:78092442-78092464 ATCCACCCTCATCTCTCTGAAGG No data
1119880003_1119880012 17 Left 1119880003 14:78092414-78092436 CCAGTTTGACTTCAGGCTTGCCC No data
Right 1119880012 14:78092454-78092476 CTCTCTGAAGGCCAGTGGTCTGG No data
1119880003_1119880013 18 Left 1119880003 14:78092414-78092436 CCAGTTTGACTTCAGGCTTGCCC No data
Right 1119880013 14:78092455-78092477 TCTCTGAAGGCCAGTGGTCTGGG No data
1119880003_1119880014 19 Left 1119880003 14:78092414-78092436 CCAGTTTGACTTCAGGCTTGCCC No data
Right 1119880014 14:78092456-78092478 CTCTGAAGGCCAGTGGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119880003 Original CRISPR GGGCAAGCCTGAAGTCAAAC TGG (reversed) Intergenic