ID: 1119880006

View in Genome Browser
Species Human (GRCh38)
Location 14:78092436-78092458
Sequence GAGAGATGAGGGTGGATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119880006_1119880012 -5 Left 1119880006 14:78092436-78092458 CCAGAGATCCACCCTCATCTCTC No data
Right 1119880012 14:78092454-78092476 CTCTCTGAAGGCCAGTGGTCTGG No data
1119880006_1119880017 12 Left 1119880006 14:78092436-78092458 CCAGAGATCCACCCTCATCTCTC No data
Right 1119880017 14:78092471-78092493 GTCTGGGGACCACCTCACCAGGG No data
1119880006_1119880013 -4 Left 1119880006 14:78092436-78092458 CCAGAGATCCACCCTCATCTCTC No data
Right 1119880013 14:78092455-78092477 TCTCTGAAGGCCAGTGGTCTGGG No data
1119880006_1119880020 22 Left 1119880006 14:78092436-78092458 CCAGAGATCCACCCTCATCTCTC No data
Right 1119880020 14:78092481-78092503 CACCTCACCAGGGCCACCTTGGG No data
1119880006_1119880021 23 Left 1119880006 14:78092436-78092458 CCAGAGATCCACCCTCATCTCTC No data
Right 1119880021 14:78092482-78092504 ACCTCACCAGGGCCACCTTGGGG No data
1119880006_1119880016 11 Left 1119880006 14:78092436-78092458 CCAGAGATCCACCCTCATCTCTC No data
Right 1119880016 14:78092470-78092492 GGTCTGGGGACCACCTCACCAGG No data
1119880006_1119880014 -3 Left 1119880006 14:78092436-78092458 CCAGAGATCCACCCTCATCTCTC No data
Right 1119880014 14:78092456-78092478 CTCTGAAGGCCAGTGGTCTGGGG No data
1119880006_1119880019 21 Left 1119880006 14:78092436-78092458 CCAGAGATCCACCCTCATCTCTC No data
Right 1119880019 14:78092480-78092502 CCACCTCACCAGGGCCACCTTGG No data
1119880006_1119880011 -10 Left 1119880006 14:78092436-78092458 CCAGAGATCCACCCTCATCTCTC No data
Right 1119880011 14:78092449-78092471 CTCATCTCTCTGAAGGCCAGTGG No data
1119880006_1119880023 24 Left 1119880006 14:78092436-78092458 CCAGAGATCCACCCTCATCTCTC No data
Right 1119880023 14:78092483-78092505 CCTCACCAGGGCCACCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119880006 Original CRISPR GAGAGATGAGGGTGGATCTC TGG (reversed) Intergenic
No off target data available for this crispr