ID: 1119880007

View in Genome Browser
Species Human (GRCh38)
Location 14:78092442-78092464
Sequence ATCCACCCTCATCTCTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119879999_1119880007 17 Left 1119879999 14:78092402-78092424 CCATCCAGCCTGCCAGTTTGACT No data
Right 1119880007 14:78092442-78092464 ATCCACCCTCATCTCTCTGAAGG No data
1119879997_1119880007 30 Left 1119879997 14:78092389-78092411 CCCTGATGGCTCTCCATCCAGCC No data
Right 1119880007 14:78092442-78092464 ATCCACCCTCATCTCTCTGAAGG No data
1119879998_1119880007 29 Left 1119879998 14:78092390-78092412 CCTGATGGCTCTCCATCCAGCCT No data
Right 1119880007 14:78092442-78092464 ATCCACCCTCATCTCTCTGAAGG No data
1119880000_1119880007 13 Left 1119880000 14:78092406-78092428 CCAGCCTGCCAGTTTGACTTCAG No data
Right 1119880007 14:78092442-78092464 ATCCACCCTCATCTCTCTGAAGG No data
1119880003_1119880007 5 Left 1119880003 14:78092414-78092436 CCAGTTTGACTTCAGGCTTGCCC No data
Right 1119880007 14:78092442-78092464 ATCCACCCTCATCTCTCTGAAGG No data
1119880002_1119880007 9 Left 1119880002 14:78092410-78092432 CCTGCCAGTTTGACTTCAGGCTT No data
Right 1119880007 14:78092442-78092464 ATCCACCCTCATCTCTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119880007 Original CRISPR ATCCACCCTCATCTCTCTGA AGG Intergenic