ID: 1119880008

View in Genome Browser
Species Human (GRCh38)
Location 14:78092444-78092466
Sequence GGCCTTCAGAGAGATGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119880008_1119880020 14 Left 1119880008 14:78092444-78092466 CCACCCTCATCTCTCTGAAGGCC No data
Right 1119880020 14:78092481-78092503 CACCTCACCAGGGCCACCTTGGG No data
1119880008_1119880023 16 Left 1119880008 14:78092444-78092466 CCACCCTCATCTCTCTGAAGGCC No data
Right 1119880023 14:78092483-78092505 CCTCACCAGGGCCACCTTGGGGG No data
1119880008_1119880017 4 Left 1119880008 14:78092444-78092466 CCACCCTCATCTCTCTGAAGGCC No data
Right 1119880017 14:78092471-78092493 GTCTGGGGACCACCTCACCAGGG No data
1119880008_1119880021 15 Left 1119880008 14:78092444-78092466 CCACCCTCATCTCTCTGAAGGCC No data
Right 1119880021 14:78092482-78092504 ACCTCACCAGGGCCACCTTGGGG No data
1119880008_1119880019 13 Left 1119880008 14:78092444-78092466 CCACCCTCATCTCTCTGAAGGCC No data
Right 1119880019 14:78092480-78092502 CCACCTCACCAGGGCCACCTTGG No data
1119880008_1119880016 3 Left 1119880008 14:78092444-78092466 CCACCCTCATCTCTCTGAAGGCC No data
Right 1119880016 14:78092470-78092492 GGTCTGGGGACCACCTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119880008 Original CRISPR GGCCTTCAGAGAGATGAGGG TGG (reversed) Intergenic