ID: 1119880009

View in Genome Browser
Species Human (GRCh38)
Location 14:78092447-78092469
Sequence ACTGGCCTTCAGAGAGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119880009_1119880023 13 Left 1119880009 14:78092447-78092469 CCCTCATCTCTCTGAAGGCCAGT No data
Right 1119880023 14:78092483-78092505 CCTCACCAGGGCCACCTTGGGGG No data
1119880009_1119880021 12 Left 1119880009 14:78092447-78092469 CCCTCATCTCTCTGAAGGCCAGT No data
Right 1119880021 14:78092482-78092504 ACCTCACCAGGGCCACCTTGGGG No data
1119880009_1119880020 11 Left 1119880009 14:78092447-78092469 CCCTCATCTCTCTGAAGGCCAGT No data
Right 1119880020 14:78092481-78092503 CACCTCACCAGGGCCACCTTGGG No data
1119880009_1119880016 0 Left 1119880009 14:78092447-78092469 CCCTCATCTCTCTGAAGGCCAGT No data
Right 1119880016 14:78092470-78092492 GGTCTGGGGACCACCTCACCAGG No data
1119880009_1119880019 10 Left 1119880009 14:78092447-78092469 CCCTCATCTCTCTGAAGGCCAGT No data
Right 1119880019 14:78092480-78092502 CCACCTCACCAGGGCCACCTTGG No data
1119880009_1119880017 1 Left 1119880009 14:78092447-78092469 CCCTCATCTCTCTGAAGGCCAGT No data
Right 1119880017 14:78092471-78092493 GTCTGGGGACCACCTCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119880009 Original CRISPR ACTGGCCTTCAGAGAGATGA GGG (reversed) Intergenic