ID: 1119880010

View in Genome Browser
Species Human (GRCh38)
Location 14:78092448-78092470
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119880010_1119880023 12 Left 1119880010 14:78092448-78092470 CCTCATCTCTCTGAAGGCCAGTG No data
Right 1119880023 14:78092483-78092505 CCTCACCAGGGCCACCTTGGGGG No data
1119880010_1119880017 0 Left 1119880010 14:78092448-78092470 CCTCATCTCTCTGAAGGCCAGTG No data
Right 1119880017 14:78092471-78092493 GTCTGGGGACCACCTCACCAGGG No data
1119880010_1119880019 9 Left 1119880010 14:78092448-78092470 CCTCATCTCTCTGAAGGCCAGTG No data
Right 1119880019 14:78092480-78092502 CCACCTCACCAGGGCCACCTTGG No data
1119880010_1119880020 10 Left 1119880010 14:78092448-78092470 CCTCATCTCTCTGAAGGCCAGTG No data
Right 1119880020 14:78092481-78092503 CACCTCACCAGGGCCACCTTGGG No data
1119880010_1119880016 -1 Left 1119880010 14:78092448-78092470 CCTCATCTCTCTGAAGGCCAGTG No data
Right 1119880016 14:78092470-78092492 GGTCTGGGGACCACCTCACCAGG No data
1119880010_1119880021 11 Left 1119880010 14:78092448-78092470 CCTCATCTCTCTGAAGGCCAGTG No data
Right 1119880021 14:78092482-78092504 ACCTCACCAGGGCCACCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119880010 Original CRISPR CACTGGCCTTCAGAGAGATG AGG (reversed) Intergenic
No off target data available for this crispr