ID: 1119880013

View in Genome Browser
Species Human (GRCh38)
Location 14:78092455-78092477
Sequence TCTCTGAAGGCCAGTGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119880005_1119880013 -3 Left 1119880005 14:78092435-78092457 CCCAGAGATCCACCCTCATCTCT No data
Right 1119880013 14:78092455-78092477 TCTCTGAAGGCCAGTGGTCTGGG No data
1119879999_1119880013 30 Left 1119879999 14:78092402-78092424 CCATCCAGCCTGCCAGTTTGACT No data
Right 1119880013 14:78092455-78092477 TCTCTGAAGGCCAGTGGTCTGGG No data
1119880002_1119880013 22 Left 1119880002 14:78092410-78092432 CCTGCCAGTTTGACTTCAGGCTT No data
Right 1119880013 14:78092455-78092477 TCTCTGAAGGCCAGTGGTCTGGG No data
1119880004_1119880013 -2 Left 1119880004 14:78092434-78092456 CCCCAGAGATCCACCCTCATCTC No data
Right 1119880013 14:78092455-78092477 TCTCTGAAGGCCAGTGGTCTGGG No data
1119880003_1119880013 18 Left 1119880003 14:78092414-78092436 CCAGTTTGACTTCAGGCTTGCCC No data
Right 1119880013 14:78092455-78092477 TCTCTGAAGGCCAGTGGTCTGGG No data
1119880000_1119880013 26 Left 1119880000 14:78092406-78092428 CCAGCCTGCCAGTTTGACTTCAG No data
Right 1119880013 14:78092455-78092477 TCTCTGAAGGCCAGTGGTCTGGG No data
1119880006_1119880013 -4 Left 1119880006 14:78092436-78092458 CCAGAGATCCACCCTCATCTCTC No data
Right 1119880013 14:78092455-78092477 TCTCTGAAGGCCAGTGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119880013 Original CRISPR TCTCTGAAGGCCAGTGGTCT GGG Intergenic
No off target data available for this crispr