ID: 1119880015

View in Genome Browser
Species Human (GRCh38)
Location 14:78092465-78092487
Sequence TGAGGTGGTCCCCAGACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119880015_1119880020 -7 Left 1119880015 14:78092465-78092487 CCAGTGGTCTGGGGACCACCTCA No data
Right 1119880020 14:78092481-78092503 CACCTCACCAGGGCCACCTTGGG No data
1119880015_1119880021 -6 Left 1119880015 14:78092465-78092487 CCAGTGGTCTGGGGACCACCTCA No data
Right 1119880021 14:78092482-78092504 ACCTCACCAGGGCCACCTTGGGG No data
1119880015_1119880023 -5 Left 1119880015 14:78092465-78092487 CCAGTGGTCTGGGGACCACCTCA No data
Right 1119880023 14:78092483-78092505 CCTCACCAGGGCCACCTTGGGGG No data
1119880015_1119880019 -8 Left 1119880015 14:78092465-78092487 CCAGTGGTCTGGGGACCACCTCA No data
Right 1119880019 14:78092480-78092502 CCACCTCACCAGGGCCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119880015 Original CRISPR TGAGGTGGTCCCCAGACCAC TGG (reversed) Intergenic