ID: 1119880016

View in Genome Browser
Species Human (GRCh38)
Location 14:78092470-78092492
Sequence GGTCTGGGGACCACCTCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119880009_1119880016 0 Left 1119880009 14:78092447-78092469 CCCTCATCTCTCTGAAGGCCAGT No data
Right 1119880016 14:78092470-78092492 GGTCTGGGGACCACCTCACCAGG No data
1119880006_1119880016 11 Left 1119880006 14:78092436-78092458 CCAGAGATCCACCCTCATCTCTC No data
Right 1119880016 14:78092470-78092492 GGTCTGGGGACCACCTCACCAGG No data
1119880010_1119880016 -1 Left 1119880010 14:78092448-78092470 CCTCATCTCTCTGAAGGCCAGTG No data
Right 1119880016 14:78092470-78092492 GGTCTGGGGACCACCTCACCAGG No data
1119880008_1119880016 3 Left 1119880008 14:78092444-78092466 CCACCCTCATCTCTCTGAAGGCC No data
Right 1119880016 14:78092470-78092492 GGTCTGGGGACCACCTCACCAGG No data
1119880004_1119880016 13 Left 1119880004 14:78092434-78092456 CCCCAGAGATCCACCCTCATCTC No data
Right 1119880016 14:78092470-78092492 GGTCTGGGGACCACCTCACCAGG No data
1119880005_1119880016 12 Left 1119880005 14:78092435-78092457 CCCAGAGATCCACCCTCATCTCT No data
Right 1119880016 14:78092470-78092492 GGTCTGGGGACCACCTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119880016 Original CRISPR GGTCTGGGGACCACCTCACC AGG Intergenic
No off target data available for this crispr