ID: 1119886013

View in Genome Browser
Species Human (GRCh38)
Location 14:78142944-78142966
Sequence GGTGGTGATAAGACTCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119886004_1119886013 21 Left 1119886004 14:78142900-78142922 CCCCCAGTCTTCATTTCTCAGAA No data
Right 1119886013 14:78142944-78142966 GGTGGTGATAAGACTCAGTCTGG No data
1119886007_1119886013 18 Left 1119886007 14:78142903-78142925 CCAGTCTTCATTTCTCAGAAGAA No data
Right 1119886013 14:78142944-78142966 GGTGGTGATAAGACTCAGTCTGG No data
1119886005_1119886013 20 Left 1119886005 14:78142901-78142923 CCCCAGTCTTCATTTCTCAGAAG No data
Right 1119886013 14:78142944-78142966 GGTGGTGATAAGACTCAGTCTGG No data
1119886006_1119886013 19 Left 1119886006 14:78142902-78142924 CCCAGTCTTCATTTCTCAGAAGA No data
Right 1119886013 14:78142944-78142966 GGTGGTGATAAGACTCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119886013 Original CRISPR GGTGGTGATAAGACTCAGTC TGG Intergenic