ID: 1119887139

View in Genome Browser
Species Human (GRCh38)
Location 14:78152583-78152605
Sequence TGCCCACACCAACACCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119887139_1119887147 1 Left 1119887139 14:78152583-78152605 CCACTTTGGTGTTGGTGTGGGCA No data
Right 1119887147 14:78152607-78152629 GGAGGCTGATGAAGGGGGAGTGG No data
1119887139_1119887143 -7 Left 1119887139 14:78152583-78152605 CCACTTTGGTGTTGGTGTGGGCA No data
Right 1119887143 14:78152599-78152621 GTGGGCAGGGAGGCTGATGAAGG No data
1119887139_1119887144 -6 Left 1119887139 14:78152583-78152605 CCACTTTGGTGTTGGTGTGGGCA No data
Right 1119887144 14:78152600-78152622 TGGGCAGGGAGGCTGATGAAGGG No data
1119887139_1119887146 -4 Left 1119887139 14:78152583-78152605 CCACTTTGGTGTTGGTGTGGGCA No data
Right 1119887146 14:78152602-78152624 GGCAGGGAGGCTGATGAAGGGGG No data
1119887139_1119887145 -5 Left 1119887139 14:78152583-78152605 CCACTTTGGTGTTGGTGTGGGCA No data
Right 1119887145 14:78152601-78152623 GGGCAGGGAGGCTGATGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119887139 Original CRISPR TGCCCACACCAACACCAAAG TGG (reversed) Intergenic
No off target data available for this crispr