ID: 1119889975

View in Genome Browser
Species Human (GRCh38)
Location 14:78175246-78175268
Sequence GGTCAGCCCCAAGAAGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119889975_1119889980 -9 Left 1119889975 14:78175246-78175268 CCTCTCCCTTCTTGGGGCTGACC No data
Right 1119889980 14:78175260-78175282 GGGCTGACCCTGAGGAGTTAGGG No data
1119889975_1119889979 -10 Left 1119889975 14:78175246-78175268 CCTCTCCCTTCTTGGGGCTGACC No data
Right 1119889979 14:78175259-78175281 GGGGCTGACCCTGAGGAGTTAGG No data
1119889975_1119889987 23 Left 1119889975 14:78175246-78175268 CCTCTCCCTTCTTGGGGCTGACC No data
Right 1119889987 14:78175292-78175314 TACGTCATTGCCAGAGAAAGGGG No data
1119889975_1119889986 22 Left 1119889975 14:78175246-78175268 CCTCTCCCTTCTTGGGGCTGACC No data
Right 1119889986 14:78175291-78175313 TTACGTCATTGCCAGAGAAAGGG No data
1119889975_1119889985 21 Left 1119889975 14:78175246-78175268 CCTCTCCCTTCTTGGGGCTGACC No data
Right 1119889985 14:78175290-78175312 GTTACGTCATTGCCAGAGAAAGG No data
1119889975_1119889984 -1 Left 1119889975 14:78175246-78175268 CCTCTCCCTTCTTGGGGCTGACC No data
Right 1119889984 14:78175268-78175290 CCTGAGGAGTTAGGGAGACAGGG No data
1119889975_1119889982 -2 Left 1119889975 14:78175246-78175268 CCTCTCCCTTCTTGGGGCTGACC No data
Right 1119889982 14:78175267-78175289 CCCTGAGGAGTTAGGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119889975 Original CRISPR GGTCAGCCCCAAGAAGGGAG AGG (reversed) Intergenic
No off target data available for this crispr