ID: 1119890567

View in Genome Browser
Species Human (GRCh38)
Location 14:78179172-78179194
Sequence CATCTGTGTCACAGGATAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119890559_1119890567 17 Left 1119890559 14:78179132-78179154 CCCGTGGAGCAGGAACATGTGCA No data
Right 1119890567 14:78179172-78179194 CATCTGTGTCACAGGATAAAGGG No data
1119890557_1119890567 19 Left 1119890557 14:78179130-78179152 CCCCCGTGGAGCAGGAACATGTG No data
Right 1119890567 14:78179172-78179194 CATCTGTGTCACAGGATAAAGGG No data
1119890555_1119890567 26 Left 1119890555 14:78179123-78179145 CCTCCTTCCCCCGTGGAGCAGGA No data
Right 1119890567 14:78179172-78179194 CATCTGTGTCACAGGATAAAGGG No data
1119890556_1119890567 23 Left 1119890556 14:78179126-78179148 CCTTCCCCCGTGGAGCAGGAACA No data
Right 1119890567 14:78179172-78179194 CATCTGTGTCACAGGATAAAGGG No data
1119890560_1119890567 16 Left 1119890560 14:78179133-78179155 CCGTGGAGCAGGAACATGTGCAC No data
Right 1119890567 14:78179172-78179194 CATCTGTGTCACAGGATAAAGGG No data
1119890558_1119890567 18 Left 1119890558 14:78179131-78179153 CCCCGTGGAGCAGGAACATGTGC No data
Right 1119890567 14:78179172-78179194 CATCTGTGTCACAGGATAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119890567 Original CRISPR CATCTGTGTCACAGGATAAA GGG Intergenic
No off target data available for this crispr