ID: 1119893077 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:78197615-78197637 |
Sequence | CTCCCTTGCTTCCTTCCTGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1119893072_1119893077 | 16 | Left | 1119893072 | 14:78197576-78197598 | CCAAGTCTTGGTAAACAGGCTGG | No data | ||
Right | 1119893077 | 14:78197615-78197637 | CTCCCTTGCTTCCTTCCTGGTGG | No data | ||||
1119893071_1119893077 | 17 | Left | 1119893071 | 14:78197575-78197597 | CCCAAGTCTTGGTAAACAGGCTG | No data | ||
Right | 1119893077 | 14:78197615-78197637 | CTCCCTTGCTTCCTTCCTGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1119893077 | Original CRISPR | CTCCCTTGCTTCCTTCCTGG TGG | Intergenic | ||