ID: 1119893077

View in Genome Browser
Species Human (GRCh38)
Location 14:78197615-78197637
Sequence CTCCCTTGCTTCCTTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119893072_1119893077 16 Left 1119893072 14:78197576-78197598 CCAAGTCTTGGTAAACAGGCTGG No data
Right 1119893077 14:78197615-78197637 CTCCCTTGCTTCCTTCCTGGTGG No data
1119893071_1119893077 17 Left 1119893071 14:78197575-78197597 CCCAAGTCTTGGTAAACAGGCTG No data
Right 1119893077 14:78197615-78197637 CTCCCTTGCTTCCTTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119893077 Original CRISPR CTCCCTTGCTTCCTTCCTGG TGG Intergenic