ID: 1119898675

View in Genome Browser
Species Human (GRCh38)
Location 14:78242371-78242393
Sequence GACCTGTGGGAAGAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 844
Summary {0: 1, 1: 0, 2: 8, 3: 75, 4: 760}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119898675_1119898685 -4 Left 1119898675 14:78242371-78242393 CCCTCCCCCTCTTCCCACAGGTC 0: 1
1: 0
2: 8
3: 75
4: 760
Right 1119898685 14:78242390-78242412 GGTCTTTTCTCTGGAGTCCTGGG 0: 1
1: 0
2: 3
3: 21
4: 255
1119898675_1119898686 -1 Left 1119898675 14:78242371-78242393 CCCTCCCCCTCTTCCCACAGGTC 0: 1
1: 0
2: 8
3: 75
4: 760
Right 1119898686 14:78242393-78242415 CTTTTCTCTGGAGTCCTGGGAGG 0: 1
1: 0
2: 2
3: 29
4: 283
1119898675_1119898690 25 Left 1119898675 14:78242371-78242393 CCCTCCCCCTCTTCCCACAGGTC 0: 1
1: 0
2: 8
3: 75
4: 760
Right 1119898690 14:78242419-78242441 GTTATGGGCAGCACTGCTTCTGG 0: 1
1: 0
2: 2
3: 8
4: 128
1119898675_1119898687 9 Left 1119898675 14:78242371-78242393 CCCTCCCCCTCTTCCCACAGGTC 0: 1
1: 0
2: 8
3: 75
4: 760
Right 1119898687 14:78242403-78242425 GAGTCCTGGGAGGCAAGTTATGG 0: 1
1: 0
2: 0
3: 15
4: 174
1119898675_1119898688 10 Left 1119898675 14:78242371-78242393 CCCTCCCCCTCTTCCCACAGGTC 0: 1
1: 0
2: 8
3: 75
4: 760
Right 1119898688 14:78242404-78242426 AGTCCTGGGAGGCAAGTTATGGG 0: 1
1: 0
2: 0
3: 10
4: 134
1119898675_1119898684 -5 Left 1119898675 14:78242371-78242393 CCCTCCCCCTCTTCCCACAGGTC 0: 1
1: 0
2: 8
3: 75
4: 760
Right 1119898684 14:78242389-78242411 AGGTCTTTTCTCTGGAGTCCTGG 0: 1
1: 0
2: 1
3: 28
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119898675 Original CRISPR GACCTGTGGGAAGAGGGGGA GGG (reversed) Intronic
900492099 1:2955489-2955511 GAGCTGTGAGAAGAGGGCCATGG - Intergenic
900719230 1:4164562-4164584 CACCTGTGGGAGGAGGAAGATGG - Intergenic
900960347 1:5915117-5915139 GTCCTGAGGGAGGAGGGAGAGGG + Intronic
901103361 1:6736522-6736544 GACCTTTGGGAAGTGGAGGCAGG - Intergenic
901234980 1:7662898-7662920 CAGCTGTGGGAAGTTGGGGAGGG + Intronic
901289610 1:8113753-8113775 GCCCTGCGGGGATAGGGGGAGGG - Intergenic
901468407 1:9438691-9438713 GACCTGGGGGAGCTGGGGGAAGG - Intergenic
901731854 1:11285740-11285762 GACCAGTGGGAAGATGGCCAGGG - Exonic
901781494 1:11597679-11597701 GACCTGTCTGAAGAAGGGAAAGG - Intergenic
901817041 1:11800289-11800311 GACCAGTGGGAAGAGGAGGAGGG - Exonic
901930608 1:12594603-12594625 GACCTGAGGGAAGTGAAGGAGGG + Intronic
902037718 1:13469712-13469734 GACATTGGGGAGGAGGGGGAGGG + Intergenic
902323396 1:15683782-15683804 GGCCTGAGGGCTGAGGGGGAGGG + Intergenic
902469874 1:16641653-16641675 GGCTTGTGGGGAGATGGGGATGG + Intergenic
902479415 1:16703912-16703934 GCCCAGGAGGAAGAGGGGGAGGG - Intergenic
902490571 1:16777994-16778016 GACCTCCGGGAAGAGGGGCTAGG + Intronic
902837805 1:19058149-19058171 GACCTGAGGGAAGGGGGAGGGGG + Intergenic
903215848 1:21842919-21842941 GAGCTGTGGGCACAGGGGGTGGG + Exonic
903291990 1:22319804-22319826 GACCTGCAGGAAGAGAGAGAGGG + Intergenic
903354032 1:22735615-22735637 GACCCCTGGGAAGTGGGAGAAGG - Intronic
903502785 1:23810797-23810819 TACCTGTGGGAAGACAGGGGAGG + Exonic
903528389 1:24010693-24010715 GACCTGAAGGAAGAGAGGGAGGG + Intergenic
903577997 1:24351085-24351107 GAGCTGTGGGCAGAGGGGCTAGG - Intronic
903774004 1:25781492-25781514 TGCCTGTGGGAAGAGGAGGGAGG - Intronic
903969732 1:27110867-27110889 GGCCTGGGGGAAGGGAGGGAAGG + Intronic
904236204 1:29118938-29118960 GACCTGTGGAACGAAGAGGATGG + Exonic
904592965 1:31625476-31625498 GACCTGTGGGAGGAGGGCCCTGG + Intronic
904953147 1:34260534-34260556 GAGCTGGAGGAAGAGGGGAATGG + Intergenic
905033157 1:34900942-34900964 GACGTGGGGGATGAGGGGGCGGG + Intronic
905440925 1:37996325-37996347 AATCCTTGGGAAGAGGGGGAAGG + Intergenic
905579915 1:39076475-39076497 GACCTGTGGGATGTTGTGGACGG + Intergenic
905668801 1:39778127-39778149 GACCCTTGGGAAGAAGGGGCCGG - Intronic
906217710 1:44053516-44053538 GACCTGTTGGATAAAGGGGAGGG - Intergenic
906607547 1:47182486-47182508 GACCTTTGGGACAAGGTGGATGG + Intergenic
907049759 1:51322050-51322072 GATCTGTTGGAGGTGGGGGAGGG + Intronic
907466476 1:54641114-54641136 GACCTGGGGGAACAGGAAGATGG + Intergenic
907470471 1:54670587-54670609 GGGCTGTGGGAACAGGGAGAGGG - Intronic
908328744 1:63049599-63049621 GTCCTGTGGGAAGAGGGATGTGG + Intergenic
909984148 1:82140017-82140039 GAACTGTGGGAAGAGGGCTGGGG + Intergenic
910894433 1:92053275-92053297 GCCCTGTGGGAAGATGGAGGAGG + Intronic
912223035 1:107699527-107699549 GAGCTGTGAGAAGAGGGCCACGG - Intronic
912546744 1:110456683-110456705 TACATGTGGGGAGAGGGGCAGGG - Exonic
912763555 1:112389023-112389045 GAGGGGTGGGAAGAGAGGGAAGG + Intergenic
914454876 1:147826636-147826658 GAAGCGTGGGAAGAGGGTGAGGG - Intergenic
914988052 1:152476526-152476548 GAGCTGTGAGAAGAGGGCTATGG - Intergenic
915030787 1:152878996-152879018 GGCCTGTGGGCAGAGGGAGAAGG + Intronic
915318996 1:155045873-155045895 GACCTGTGGGTGGATGGGCAGGG - Exonic
915698287 1:157767140-157767162 GCTGTGTGTGAAGAGGGGGAAGG - Intronic
915835671 1:159173012-159173034 GCCCTGTCGGAAGAGGAGGAGGG + Intronic
916082325 1:161242194-161242216 GGCATGTTGGAAGAGGGTGAGGG - Intergenic
916131801 1:161617372-161617394 AGACTGTGGGGAGAGGGGGAGGG + Intronic
916411469 1:164551056-164551078 GAGCTGTGAGAAGAGGGCCATGG - Intergenic
916991585 1:170250804-170250826 GACCAATGGGAAGGGGGGGCTGG + Intergenic
917456889 1:175193094-175193116 CACCGGCGGGAAGACGGGGAGGG - Intergenic
917521571 1:175752149-175752171 GAACTGTGGGAAGGGGGTGAGGG + Intergenic
917711378 1:177688672-177688694 TGCCTGTGGGAAGTGAGGGAGGG + Intergenic
918128835 1:181607458-181607480 GACCAGTGGGAAGGGGAGGAAGG - Intronic
918144848 1:181746606-181746628 GACCTATGGGTAGATGGAGAAGG + Intronic
918144938 1:181747307-181747329 GTCCTTTGAGAAGAGGGGGCTGG + Intronic
918812890 1:189142797-189142819 GACCGAAGGGAAGAGTGGGAAGG - Intergenic
919308741 1:195878334-195878356 GAGCTGTGAGAAGAGGGCCATGG - Intergenic
919521946 1:198599937-198599959 GAGCTGTGAGAAGAGGGCCATGG + Intergenic
919738401 1:200968021-200968043 GACCTGTGGGGAGCGAGGGTGGG + Intergenic
919752760 1:201048463-201048485 GAACTGTGGGAAGAAGTAGAGGG - Intronic
920366762 1:205452034-205452056 GGCCTGGGGCAAGAGGCGGAGGG + Intronic
921218445 1:212956185-212956207 GACCTGTGGGAAGAACGCAAGGG - Intronic
921366335 1:214378241-214378263 GCCCAGTGGGAATAGTGGGAAGG - Intronic
921863518 1:220064413-220064435 CACCTGTGGAAGGAGGAGGAGGG + Intronic
922738186 1:228000966-228000988 GCCCTGTGGGACGAGGGCAAGGG - Intergenic
922862358 1:228830275-228830297 GGCCTGTGGGAAGTGGGCCAGGG + Intergenic
923482555 1:234397680-234397702 GAGGTGAGGGAAGAGGGGGAGGG + Intronic
923482611 1:234397797-234397819 GAGGCGGGGGAAGAGGGGGAGGG + Intronic
923529870 1:234804541-234804563 GACCTCCGGGAAGAGGGGCTAGG - Intergenic
923711373 1:236390154-236390176 GACTTGAGGGAAGAGTGGGAGGG + Intronic
924567061 1:245207743-245207765 GAGCTGTGGGAAGTGGGTGGTGG - Intronic
1062922217 10:1288962-1288984 GACATGATGGAAGAGGGGGTCGG + Intronic
1062976184 10:1685036-1685058 GGACTGTGGGATGAGGAGGAGGG + Intronic
1063557290 10:7092906-7092928 GGCCTGTGGGGAGTGGGGGGAGG + Intergenic
1063778588 10:9293566-9293588 GGTCTGTGGGGAGAGGGGCAGGG + Intergenic
1063863848 10:10342555-10342577 GACCTGTGGGAATTGGGGCTTGG - Intergenic
1064004187 10:11687374-11687396 GACCTGTGGGAAGAAGGAAAGGG - Intergenic
1064703417 10:18045902-18045924 GAGTTCTGGGAAGCGGGGGAGGG - Intergenic
1064906021 10:20347015-20347037 GAAAGGTGGGAAGAGGGGGAAGG - Intergenic
1066805716 10:39250683-39250705 GTGGAGTGGGAAGAGGGGGAGGG - Intergenic
1067222824 10:44356418-44356440 GACAGGTGGGAAGTCGGGGACGG + Intergenic
1069436173 10:68385546-68385568 GAACAGTGGGAAGAGAGGGACGG + Intronic
1069652800 10:70062879-70062901 GAAAGGTGGGAAGAGGGTGAGGG + Intronic
1070166861 10:73905497-73905519 TATCTGTGGGAAGAGGGAGCAGG - Intergenic
1070777498 10:79118407-79118429 GTCCTGTGGGAAGCGGGAGGAGG + Intronic
1070793585 10:79203995-79204017 GAGATGTGGGAGGAGGGGCATGG - Intronic
1070803909 10:79259310-79259332 GACCTAGGGGAGGAGTGGGAGGG + Intronic
1071279417 10:84086757-84086779 CTCATGTGGGAAGAGGTGGAAGG - Intergenic
1071873411 10:89818837-89818859 GAGCTGTGAGAAGAGGGCCACGG - Intergenic
1071949343 10:90684815-90684837 GGCATGAGGGAAGAGGGGAAGGG + Intergenic
1072026162 10:91460107-91460129 GACTTTTGGGAAGAGGGGAGAGG + Intronic
1072888271 10:99299212-99299234 GGCGTGTTGGATGAGGGGGAGGG - Intergenic
1073091119 10:100940741-100940763 GAAGTGGGGGAAGATGGGGAAGG - Intronic
1073469996 10:103716371-103716393 GACCTGGGGTGAGAGGAGGATGG - Intronic
1073576510 10:104630676-104630698 GACCTGTGGAAAGAGGAGTTTGG + Intergenic
1073742144 10:106419682-106419704 GAATTGTGGGAAGGGTGGGAGGG + Intergenic
1074142864 10:110690542-110690564 GAGCTGGGGGAAGAGGGACATGG - Intronic
1074191218 10:111139362-111139384 GACCTTTGGGGTGAGGGGTAAGG + Intergenic
1074684960 10:115952832-115952854 GCCCTCTGAGAAGAGGGGCATGG - Intergenic
1074769918 10:116726569-116726591 GAACTGTGGGAAATTGGGGATGG - Intronic
1075071632 10:119323845-119323867 GACTTGGGGGAAGGGGAGGAGGG - Intronic
1075222701 10:120598795-120598817 GCCATGTGACAAGAGGGGGAGGG + Exonic
1075236608 10:120736559-120736581 GACCCGTGGGAAGTGGGACATGG + Intergenic
1075717407 10:124565001-124565023 GACTTGGAGGAAGAGTGGGAGGG + Intronic
1076727670 10:132421133-132421155 GACCTGGGGCAGGAAGGGGAGGG - Intergenic
1076770522 10:132660773-132660795 GAACTGGGGGAAGATGGAGAAGG + Intronic
1076784754 10:132744310-132744332 GGCCTGTGGGTGGTGGGGGATGG - Intronic
1076831073 10:132994524-132994546 GACGGGTGGGAAGGGCGGGAGGG + Intergenic
1077117039 11:889887-889909 GACAGGTGGGCAGAGGGGGAGGG - Intronic
1077252271 11:1565932-1565954 GACCTGCAGGGACAGGGGGATGG + Exonic
1077304854 11:1864441-1864463 GGCCTGAGGGCAGAGGCGGAGGG + Intronic
1077363687 11:2152658-2152680 GACCTGTGGGTAGGGGAGGCAGG - Intronic
1077793113 11:5462361-5462383 GAACTCAGGGAAGAGGGGAAAGG + Intronic
1078388267 11:10912264-10912286 GACCTGTGGGAAGAGGAGAAGGG + Intergenic
1078533312 11:12153700-12153722 GATCTGGGGGAAGTGGGGAATGG - Intronic
1078542445 11:12222785-12222807 GAACAGTGGGAAGAGGTGGTGGG + Intronic
1078659703 11:13277399-13277421 GACCTGAGGGGAAAGGGAGAGGG + Intronic
1079242338 11:18729581-18729603 GACCGGTGGGGTGAGGGGCAGGG + Intronic
1080359299 11:31494059-31494081 GAGCTGTGAGAAGAGGGCCATGG - Intronic
1080587400 11:33694486-33694508 CACCTGTGGGTGGAGGGGGCGGG - Intergenic
1080748204 11:35127723-35127745 GTCCTGTGGGAAATGGGGGCTGG - Intergenic
1080925020 11:36747265-36747287 GACTTGGGTGAAGAGGTGGAAGG + Intergenic
1081525637 11:43925693-43925715 GCCCTGTGGGGAGAGGTGGAAGG + Intronic
1081532649 11:43973527-43973549 GACCAGTAAGAAGATGGGGATGG - Intergenic
1081623598 11:44633751-44633773 AACATGCGGGAAGAGGGGCATGG + Intergenic
1081814973 11:45934005-45934027 CAGCTCTGGGAGGAGGGGGAAGG + Exonic
1083274250 11:61587892-61587914 GCCCAGAGGGAGGAGGGGGACGG + Intergenic
1083295430 11:61712758-61712780 GGCCACTGGGAAGAAGGGGAAGG + Intronic
1083616412 11:64028681-64028703 GAGCTGCGGGAGGAGGGGGAGGG - Intronic
1083706861 11:64522663-64522685 GACGAGAGGGAAGAGAGGGAGGG - Intergenic
1084182519 11:67454053-67454075 GAGCTGTGGGAAGCGGGAGAGGG - Intronic
1084296841 11:68217702-68217724 TACCTGTTTGAAGAGGTGGAAGG - Intergenic
1084368611 11:68721272-68721294 GCCCTGTGGCAAGAGAGGGAGGG - Intronic
1084594138 11:70107133-70107155 GATCTGAGGGATGATGGGGAGGG + Intronic
1084945148 11:72634312-72634334 GGCCTGTGGGAAGAGGAAGACGG + Intronic
1085526635 11:77167828-77167850 GATCTGTGGGCAGAGGGGAGAGG - Intronic
1085567752 11:77530177-77530199 GAGCTGAGGGGAGAGGGGAAAGG - Intronic
1085609343 11:77933210-77933232 AGACTGTGGGGAGAGGGGGATGG - Intronic
1085761678 11:79246808-79246830 GAGGTGAGGGAAGAGGGAGAGGG + Intronic
1085868235 11:80319953-80319975 CACCTGTGGAAGGAGAGGGAAGG - Intergenic
1086957826 11:92952055-92952077 GACCTGTGAGAAGAGAGAAATGG - Intergenic
1087127331 11:94640856-94640878 GACAGGTGGGAAGAGGGGGATGG - Intergenic
1088630211 11:111766822-111766844 GAGCCGCGGGAAGAGGTGGAGGG - Intergenic
1088729064 11:112664699-112664721 GTCATGTGGGAAGAGAGGGAAGG + Intergenic
1088735683 11:112725885-112725907 GAGATGTGGGAAGAAGGGAATGG + Intergenic
1088810684 11:113389747-113389769 AATCTGTGGCAAGAGGGGCATGG + Intronic
1088842472 11:113638609-113638631 GAGCAGAGGGAAGAGAGGGAGGG + Intergenic
1089171578 11:116515386-116515408 GACCTGTCAGAAGAGAGGGCGGG - Intergenic
1089347509 11:117799891-117799913 GACCTGTGGGAACTGGGAGGAGG + Intronic
1089413923 11:118271011-118271033 GGGCTGGGGGAAGAGGGGAATGG + Intergenic
1089498434 11:118919263-118919285 GACCTGGGGGAGGAGAGGGATGG + Intronic
1089759965 11:120716005-120716027 GGCATGTGGGCAGTGGGGGAAGG + Intronic
1090081773 11:123618407-123618429 CACCTGGGGGAAGAGAGGTACGG - Intronic
1090285297 11:125495123-125495145 GAGCAGCGGGAGGAGGGGGAGGG - Intronic
1090332215 11:125941253-125941275 GAGCTGTTGTAAGAGCGGGATGG - Intergenic
1090342216 11:126034166-126034188 GACTTGGGAGAAGTGGGGGAAGG - Intronic
1090404650 11:126469437-126469459 GCCCTGGGGGAGGAGGGGGTGGG + Intronic
1090738554 11:129634456-129634478 GACCTACGGGAAGAGTGAGAAGG + Intergenic
1091356861 11:134944108-134944130 GACCAGTGGGAAGCAGGAGAAGG + Intergenic
1091551587 12:1539159-1539181 GTCCCGTGGGGAGAGCGGGAGGG + Intronic
1092745559 12:11669276-11669298 AGACTGTGGGAGGAGGGGGAAGG + Intronic
1092774562 12:11931153-11931175 GACCTGTTGGATGAGGAGAAAGG - Intergenic
1093037665 12:14348037-14348059 GGCCTGGGGGAAGTGGGGAATGG - Intergenic
1093218916 12:16395569-16395591 GACTTGGGGGAAGTGGGGGAGGG - Intronic
1093238529 12:16640865-16640887 GAGCTGTGAGAAGAGGGCCATGG - Intergenic
1094521865 12:31199507-31199529 GTGCAGTGGGGAGAGGGGGAGGG - Intergenic
1095147687 12:38750340-38750362 GAGCTGTGAGAAGAGGGCCATGG + Intronic
1095977877 12:47952126-47952148 GGCCTGTGGGAAAAGGGACAAGG + Intergenic
1096063286 12:48719962-48719984 GAGCTGTGAGAAGAGGGCCATGG - Intergenic
1096113497 12:49042065-49042087 TACCTGTGGGATGAGGGCAAGGG - Intronic
1096542349 12:52314816-52314838 CACCTGTGGGAACAAGGGCAGGG + Exonic
1096773232 12:53949649-53949671 GACTTCTGGGAGGAGGAGGAGGG + Intergenic
1097066627 12:56325295-56325317 GGCCTGTGGGATGTGGGGAAAGG - Intronic
1097192678 12:57226943-57226965 GAGCTTTGGGATGAGGGGGTGGG + Intergenic
1097397510 12:59093719-59093741 GAACTGTGGGTAGTGGGGAAAGG + Intergenic
1097639234 12:62159700-62159722 GACTTGGGGGAAGAGTGGGAGGG + Intronic
1097938320 12:65278265-65278287 GACCTGTGGGAAGACGTGTCAGG - Intergenic
1098475899 12:70902726-70902748 GACCAGGGAGAAGAGTGGGAGGG + Intronic
1098512390 12:71332017-71332039 GAGCTGTGGGGAGGGGGGAATGG + Intronic
1098616363 12:72529429-72529451 TACCTCTGGGAATAGAGGGAGGG - Intronic
1099018255 12:77371446-77371468 TACCAGTGGGAAGAGGGAGAGGG + Intergenic
1100228337 12:92581734-92581756 AAGCTGAGGGAAAAGGGGGAGGG - Intergenic
1100352653 12:93799030-93799052 GAAGGGAGGGAAGAGGGGGAGGG + Intronic
1100412423 12:94334065-94334087 GGTATGTGGGAAGAGGAGGATGG - Intronic
1100545024 12:95593503-95593525 GACTTGTGGAATGAGGGGGAGGG + Intergenic
1100820743 12:98427261-98427283 GGCCTGTCGGGGGAGGGGGAGGG - Intergenic
1100822080 12:98441086-98441108 GACTTGTGGGAAGACAGAGAGGG + Intergenic
1101249564 12:102918407-102918429 GAACAGTGGGAGGAGAGGGATGG - Intronic
1101832481 12:108270071-108270093 CACCTGTGGAAGGATGGGGAAGG - Intergenic
1102043985 12:109818205-109818227 GACCAGGGAGGAGAGGGGGAAGG + Intronic
1102378854 12:112446120-112446142 GACCAAGGAGAAGAGGGGGAAGG + Intronic
1102688777 12:114744167-114744189 ATCCTGTGGGAAAAGGGGAAAGG + Intergenic
1102829669 12:115986031-115986053 GACGTGTGGTAAGAATGGGAGGG + Intronic
1103097594 12:118144566-118144588 GGCCTGTGGGGAGAGGCAGAGGG - Exonic
1103137466 12:118519832-118519854 GACCTGAGGGATTAGGAGGAGGG + Intergenic
1103614432 12:122143182-122143204 GCCCTGCAGGAAGAGAGGGAGGG - Exonic
1103642251 12:122361011-122361033 GAGCTGAGGGAAGAGGCAGAAGG + Exonic
1103779502 12:123389399-123389421 GACCCGGGGGAAGCGGGGGAGGG - Intronic
1103820137 12:123691301-123691323 GAGCTGAGGGAAGAGGGGTAGGG - Intronic
1103997914 12:124842038-124842060 GGACTGTGGGAGGAGGAGGAGGG - Intronic
1104410501 12:128553877-128553899 GGCCTGCGGGAGGAGAGGGAGGG + Intronic
1104873460 12:132016874-132016896 GACTTGTGGGAAGAGGAGGGAGG - Intronic
1104897910 12:132173298-132173320 GACCTGTGGGCGGTGTGGGAGGG - Intergenic
1105003089 12:132703713-132703735 GACCTCTGGGCAGAGGGGGCTGG + Intronic
1105465631 13:20637127-20637149 GGGCTGGGGGAAGAGGAGGATGG + Intronic
1106120614 13:26857348-26857370 AAACAGTGGGAAGAGGGTGAGGG - Intergenic
1106397153 13:29392220-29392242 GGGCTGCGGGAAGAGGGGAATGG - Intronic
1107035953 13:35902584-35902606 AGCCTGGGGGATGAGGGGGATGG + Intronic
1109177173 13:59170890-59170912 GACAGGAGGGAAGAGGAGGAAGG - Intergenic
1109824947 13:67706644-67706666 GACCTGTCAGAAGTGGGTGAGGG + Intergenic
1110156460 13:72322610-72322632 TACCTGTTGGAAGAGGGAGTGGG - Intergenic
1111182190 13:84684474-84684496 GACCTGTGGGGACAGGGAGAGGG + Intergenic
1113330608 13:109323340-109323362 GACTTGGGGGAAGAAGGGGAGGG + Intergenic
1113445354 13:110362037-110362059 GACATATGGGAAGAGGAGTACGG - Intronic
1113749231 13:112766847-112766869 CCCCTGTGGGAAGGTGGGGAGGG + Intronic
1113749262 13:112766926-112766948 CCCCTGTGGGAAGGTGGGGAGGG + Intronic
1113749327 13:112767085-112767107 CCCCTGTGGGAAGGTGGGGAGGG + Intronic
1113749480 13:112767442-112767464 CCCCTGTGGGAAGGTGGGGAGGG + Intronic
1113768261 13:112894122-112894144 GAGGAGGGGGAAGAGGGGGATGG + Intergenic
1113902334 13:113804064-113804086 CACCTGTGTGAAGGTGGGGAGGG + Intronic
1113995030 14:16057760-16057782 GGCCTGCGGGGGGAGGGGGAAGG - Intergenic
1114311098 14:21468037-21468059 GGGCTGAGGGATGAGGGGGATGG + Intronic
1114423410 14:22603268-22603290 GAGCTGAGGGAAGTTGGGGAGGG + Intronic
1114526970 14:23372481-23372503 GACACCTGGGAAGAGGGGAATGG + Intergenic
1114639716 14:24211397-24211419 GACATGTGGGTACGGGGGGAGGG - Exonic
1115398464 14:32934449-32934471 CAGCTGAGGGAAGAAGGGGAGGG - Intergenic
1115513766 14:34164611-34164633 GACCAGTGGGTAGGGAGGGAGGG + Intronic
1115536717 14:34379933-34379955 GCCCTGTGAGCAGAGTGGGAAGG + Intronic
1115774483 14:36700240-36700262 GATTTGTTGGAAGAAGGGGATGG - Intronic
1116088511 14:40273836-40273858 GACTTGGGGGAAAAGTGGGAGGG - Intergenic
1116100475 14:40427368-40427390 GAGCTGTTGGAAAAGGTGGAGGG - Intergenic
1116557182 14:46325598-46325620 GAGCTGTGGAAAGAGAGGAAAGG - Intergenic
1116738970 14:48730885-48730907 GAACCATGGGCAGAGGGGGAGGG + Intergenic
1117353008 14:54899804-54899826 GACTGGCGAGAAGAGGGGGATGG - Intronic
1117657170 14:57967334-57967356 TACCTCTGGGGAGAGGAGGAGGG - Intronic
1118326897 14:64787237-64787259 GACTTGTGGGAAATGTGGGAAGG - Intronic
1118712004 14:68527332-68527354 GACCTCTGGGATGTGGGGGAAGG + Intronic
1118780527 14:69004836-69004858 GAGCTGGGGGAAGAGGGAGGAGG - Intergenic
1118793178 14:69114799-69114821 GACAAGTGGAAAGTGGGGGAGGG + Intronic
1119532156 14:75369919-75369941 CACCTGTGAAAAGAAGGGGAAGG - Intergenic
1119656930 14:76423884-76423906 GACCTGGGGGGAGAGTGGGCAGG + Intronic
1119898675 14:78242371-78242393 GACCTGTGGGAAGAGGGGGAGGG - Intronic
1119968437 14:78942954-78942976 GAGATGTTGGAAGAGAGGGAGGG + Intronic
1120002307 14:79316490-79316512 GAATTGTGGAAAGAGGGGAAAGG + Intronic
1120859150 14:89239104-89239126 GCTCTGAGGGAAGAGGGGGGCGG - Intronic
1120893630 14:89510538-89510560 GACCAGTGTGGAGAGGGGGTGGG + Intronic
1122299154 14:100722323-100722345 GACCTGGGGGCAGAGGGTGGAGG - Intergenic
1122451129 14:101808432-101808454 GCTCTGGGGAAAGAGGGGGAAGG + Intronic
1122601881 14:102925572-102925594 GACCTGTGGGCAGAGGAGTCAGG + Intronic
1122703819 14:103607953-103607975 GACCTGTGGAAACAGGAGGAGGG - Intronic
1122716943 14:103701569-103701591 GACCTCTTAGAAGTGGGGGAAGG + Intronic
1122745846 14:103896789-103896811 GGCCTGTGGGGGGAGTGGGAGGG + Intergenic
1122784069 14:104155851-104155873 GCCCTGTGGGAAGAGGGTGGAGG + Intronic
1123034369 14:105465955-105465977 GTCCTGTGGGAAGAGGTGGCTGG + Intronic
1124062409 15:26306373-26306395 GAGCTGTGAGAAGAGGGCCATGG + Intergenic
1124171332 15:27376361-27376383 GAGCTGTGAGAAGAGGGCCATGG - Intronic
1124609680 15:31200044-31200066 GAGCTCAGGGAAGAGGGAGAGGG + Intergenic
1124612265 15:31216323-31216345 GAGCGGTGGGAGGAGGAGGAGGG + Intergenic
1124683033 15:31753450-31753472 GACTTGGGGAAAGAGTGGGAAGG - Intronic
1124700817 15:31910235-31910257 GGCCTGTGGGCAGAGGACGATGG + Intergenic
1126954816 15:53921076-53921098 GCCCTGTGGTAGGAGGGGAAAGG + Intergenic
1127602501 15:60552354-60552376 GACTTGCGGGGAGAGGGCGAGGG - Intronic
1127827284 15:62715855-62715877 GGACAGAGGGAAGAGGGGGAAGG - Intronic
1127849261 15:62898631-62898653 CATCTGTGGAAAGAGGAGGAGGG - Intergenic
1127856768 15:62960014-62960036 ATACTGTGGGGAGAGGGGGATGG + Intergenic
1129824257 15:78624440-78624462 GCCCTGGGGGAAGAGGAAGAAGG + Exonic
1129878213 15:78990776-78990798 GTCCTGTGGGCAGAAGGGGCCGG + Intronic
1130661976 15:85837919-85837941 GACCAGTGGGGAGGTGGGGAAGG - Intergenic
1130793294 15:87179775-87179797 GACCAGAGGGAAAAGAGGGAGGG + Intergenic
1131336457 15:91553756-91553778 GCCCTGTGGGGACAGGGGGCAGG + Intergenic
1132122011 15:99184258-99184280 GAGCTGTGAGAAGAGGGCCACGG + Intronic
1132674782 16:1117108-1117130 GGCCTGTGGGGACAGGGTGAGGG - Intergenic
1132846367 16:2002776-2002798 GGCCTGTGGGAAGAGGCAGGAGG - Intronic
1132869750 16:2110653-2110675 TACCTGTGGGATCTGGGGGACGG - Exonic
1133413522 16:5588195-5588217 GGGCTGTGGGAATGGGGGGATGG + Intergenic
1134588498 16:15433519-15433541 GTCATGTGGGCAGAGGAGGAAGG - Intronic
1134717671 16:16364948-16364970 TACCTGTGGGATCTGGGGGACGG + Intergenic
1134956029 16:18382583-18382605 GACCTATGAGCAGAGGGGGTTGG + Intergenic
1134957081 16:18387211-18387233 TACCTGTGGGATCTGGGGGACGG - Intergenic
1135002507 16:18788839-18788861 GACCTGTGGGCTGTGGAGGAGGG - Intronic
1135193639 16:20376339-20376361 GAGCTTGGGGAAGAGGGGAATGG - Intronic
1136179228 16:28539344-28539366 GACGTGAGGAAGGAGGGGGAAGG + Intergenic
1136231586 16:28888767-28888789 GACCTGTGGGGAGGGAGGGAGGG - Exonic
1136468054 16:30458845-30458867 GGCAGGTGGGAAGAAGGGGAAGG + Intergenic
1136504442 16:30693926-30693948 GTCCTGTGGGGAGAGGGAGAAGG + Intergenic
1136513429 16:30753374-30753396 GACCTGGGGGAAGGGGAGGCGGG - Exonic
1137577154 16:49607828-49607850 CACCTGTGGGAATGCGGGGAGGG + Intronic
1137973429 16:53008845-53008867 GACTTGGGGGAAGAGTGAGAGGG + Intergenic
1138215894 16:55205067-55205089 TACCTGTGGGAAGACTGGGTTGG - Intergenic
1138442542 16:57043635-57043657 GACCTGTGGGATGGGGGACAGGG - Intronic
1138590263 16:57995862-57995884 GACCAGTGGGCCCAGGGGGAAGG - Exonic
1138798903 16:60002072-60002094 GAGCTGTGAGAAGAGGGCCATGG + Intergenic
1139852531 16:69959721-69959743 GACCTCTGGTCAGAGGAGGAGGG - Exonic
1139881502 16:70182629-70182651 GACCTCTGGTCAGAGGAGGAGGG - Exonic
1139914015 16:70417310-70417332 TTCCTGTGGGAAGTGGGGGCTGG - Intronic
1139921977 16:70466307-70466329 TACCTGGGGGAACAGTGGGAGGG - Intronic
1139948421 16:70657249-70657271 GACGTGGGAGAAGTGGGGGAGGG + Intronic
1139971368 16:70777666-70777688 GTCCTGTGGTTAGAGGAGGAGGG + Intronic
1140371007 16:74412876-74412898 GACCTCTGGTCAGAGGAGGAGGG + Exonic
1140696407 16:77538665-77538687 GCCCTGGTGGAAGAGGGGCAGGG + Intergenic
1141333807 16:83136579-83136601 TCCCTGTGGAATGAGGGGGATGG - Intronic
1141848777 16:86629900-86629922 GACGTGTGGGAGGAGGGTGTAGG + Intergenic
1141864478 16:86740679-86740701 GAAGGGTGGGAAGAGGGTGAGGG + Intergenic
1142013980 16:87733860-87733882 GACCTGTGTGGAGAGGTGGGAGG - Intronic
1142020784 16:87780899-87780921 AGCCTGTGGGGAGAGGGTGAAGG - Intergenic
1142167742 16:88601827-88601849 GACCTCTGGGAACAGGGTCAGGG + Intronic
1142173388 16:88634302-88634324 GGCCTGCGGGAAGAGGGGTGAGG - Intergenic
1142225970 16:88877774-88877796 TCCCTGTGGGCAGAGGGGGTGGG + Intronic
1142765679 17:2062939-2062961 GGGCTGTGGGCAGAGGGGAAAGG + Intronic
1143504579 17:7356579-7356601 GACCTGAGGGAAGACGAGGGTGG - Exonic
1143552646 17:7640563-7640585 GATATGTGGGGAGAGGGGAATGG - Intergenic
1143580046 17:7820186-7820208 AAGCAGTGGGAAGATGGGGAGGG - Intronic
1145736903 17:27239397-27239419 CACCTGTGAGGAGTGGGGGAAGG + Intergenic
1146477123 17:33171986-33172008 GACCAGTGTGAAAAGGGAGAGGG - Intronic
1147155642 17:38543366-38543388 GAGCCCTGGGAAGAGGGAGAGGG + Intronic
1147156004 17:38544766-38544788 GGCCGGTGGGAGGAGGGGGCTGG + Intronic
1147294509 17:39471407-39471429 CAATTGTGGGAAGAGGTGGAGGG - Exonic
1147718375 17:42522813-42522835 TACCTGTGGGAAGAGGGGACTGG + Intergenic
1147741324 17:42672390-42672412 GACCTGTGGGAGGGTGGGGGCGG + Exonic
1147888287 17:43699113-43699135 GATCTGAAGGAAGTGGGGGAAGG - Intergenic
1148089222 17:45012900-45012922 GACCAGTGGGAAGTAGGGGCTGG + Intergenic
1148111769 17:45148541-45148563 GAGCTGTGGGAAGGGGGAGGAGG + Exonic
1148382334 17:47209165-47209187 GAGCTGTGGCATGAAGGGGAGGG + Intronic
1148400083 17:47351051-47351073 GAAGTGTGGGAAGGGGGTGAAGG - Intronic
1148456930 17:47816200-47816222 GACCTGCAGGGAGAGGGTGAGGG + Exonic
1148487172 17:47997940-47997962 GACTTGGGGGAAGAGGGGTGAGG + Intergenic
1148691321 17:49528497-49528519 GGCCTGAGGGAAGAGGGGAGGGG + Intergenic
1148769726 17:50059956-50059978 CACCAGTGGGGAGAGGGGGCTGG + Intronic
1148798582 17:50209575-50209597 GCCATGTGGCCAGAGGGGGAAGG + Intergenic
1149493074 17:57099078-57099100 GACTAGTGGGAAGTGGGGGCTGG + Intronic
1150223584 17:63510670-63510692 ATCCTCTGGGAAGAGGGTGAGGG - Intronic
1150920626 17:69478376-69478398 GACATATGGGAAGATGGGGGTGG + Intronic
1151254635 17:72866459-72866481 GACCTGGGGGTTGTGGGGGATGG - Intronic
1151313439 17:73308356-73308378 GGCCTGTGGGCGGAGGGAGAAGG - Intronic
1151340821 17:73469613-73469635 GACCTGTGGGTCCAGGGGAAGGG + Intronic
1151539270 17:74756962-74756984 GACTTCTGGGAGGAGGGTGAGGG + Intronic
1151630817 17:75309644-75309666 GAACTAGGGGAAGAGGGGCAGGG - Intergenic
1152232828 17:79123394-79123416 GAGCTGGGGGTAGAGGGGGTGGG - Intronic
1152301026 17:79495434-79495456 GAGGTGTGGGGAGAGGGAGAGGG + Intronic
1152380839 17:79941619-79941641 GGCGTCTGGGAAGTGGGGGAGGG + Intronic
1152628450 17:81399088-81399110 CACCTTTGGGCAGCGGGGGAGGG + Intronic
1152943446 17:83185177-83185199 GACCTGATGGAAGAGGCAGAAGG + Intergenic
1153427497 18:4982221-4982243 GACTTTGGGGAAGAGTGGGAGGG + Intergenic
1154388189 18:13914268-13914290 GAGCTGTGGGAGCAGGGAGACGG - Intronic
1156231859 18:35161066-35161088 GAACTGTGGGAAGGGGAGGCAGG - Intergenic
1156859391 18:41818500-41818522 AACCTGTGGGGGGAAGGGGAAGG - Intergenic
1157144910 18:45152277-45152299 GACTTGGGGGAAGAAGGTGAGGG - Intergenic
1157175327 18:45446700-45446722 GACCTGTGCGAGGTGGGGAAAGG - Intronic
1157286025 18:46378009-46378031 GGCATTTGGGAAGAGGGTGAGGG + Intronic
1157430352 18:47619574-47619596 AACTTGTGGGAGGAGGGGTAGGG - Intergenic
1157598538 18:48878523-48878545 GACCTGTGGGATGAAGGGGCAGG + Intergenic
1158181023 18:54714993-54715015 GACCTGCGGGTAGAGGGGAGTGG - Intergenic
1158753939 18:60299816-60299838 GGACAGAGGGAAGAGGGGGATGG + Intergenic
1159301593 18:66578962-66578984 GAACTGTGGGAAAATGGGGGTGG + Intronic
1159615074 18:70570447-70570469 GACCGTGGGGAAGAGGGAGAGGG + Intergenic
1160265287 18:77336500-77336522 GAGCAGTGGGAGGAGGTGGAAGG + Intergenic
1160700652 19:505445-505467 GGACTGTGGGATGAGGGAGATGG - Intergenic
1160707674 19:536993-537015 GTCCTGTGGGGAGAGTGGGTCGG - Exonic
1160913201 19:1484125-1484147 GACCTGAGGGCAGAGGGGGGTGG + Exonic
1160961066 19:1721038-1721060 GACCTTTGGGGAGAGGGTGAGGG - Intergenic
1161046855 19:2139697-2139719 GACCTGTCGGATGATGGAGAGGG - Intronic
1161316323 19:3619240-3619262 GAACTGTGGGGAGCAGGGGAAGG + Exonic
1161430466 19:4229412-4229434 GACCTGAAGGAAGTCGGGGAGGG + Intergenic
1161707637 19:5829532-5829554 GACGTGTGGGAAGGAGGGGAGGG - Intergenic
1161822122 19:6536109-6536131 GATTTGTGGGGAGAGGAGGATGG + Intergenic
1162145339 19:8609616-8609638 GGCCTGCGGGAGGAGGGGGCCGG + Intronic
1163007168 19:14404363-14404385 GTCCTGTGGGCAGATGGGGGTGG - Exonic
1163121830 19:15223040-15223062 TACCTGGGGGAAGGGAGGGAAGG - Intergenic
1163584518 19:18156545-18156567 GACCAGAGGGAGGAAGGGGAGGG + Intronic
1163623530 19:18374657-18374679 GGCGGGGGGGAAGAGGGGGAGGG + Intergenic
1163901101 19:20100892-20100914 CACCTGAGAGCAGAGGGGGAGGG + Intronic
1164592579 19:29514406-29514428 GAGATGGGGGATGAGGGGGAAGG + Intergenic
1165621488 19:37252092-37252114 GACCTGTGGACGGACGGGGAAGG - Intergenic
1165833991 19:38743587-38743609 GGTCTGAGGGAAGAGGGGGCTGG - Intronic
1165913433 19:39243905-39243927 GATCTGTGGGCAGAGGAGGGCGG + Exonic
1165917522 19:39269718-39269740 GATCTGTGGGCAGAGGAGGGCGG - Exonic
1166295378 19:41886873-41886895 GAGCTGTGGAAAGAGGGGTGGGG - Intronic
1166336943 19:42114049-42114071 GAGCTGAGGGAAGCTGGGGAAGG + Intronic
1166384070 19:42370564-42370586 GATCTGAGGGAGGAGGGGGTGGG + Intronic
1166531324 19:43545268-43545290 GAGTTGTGGGATGAGGGGCAGGG - Intronic
1166584619 19:43934951-43934973 GAGCTGTGGGAGGTGGGGGAAGG + Exonic
1166794978 19:45420518-45420540 GAGGTGTGGGAAGAGGTGGGAGG - Intronic
1167154616 19:47730375-47730397 AACCTGCAGGAAGAGGGGGAGGG - Intronic
1167281932 19:48574352-48574374 GGCCTCTGGGGAGTGGGGGAGGG + Intronic
1167412831 19:49355266-49355288 GACGTGGGGGCAAAGGGGGATGG - Intronic
1167498292 19:49831586-49831608 GACCTGTGGGATGCGGGGCGAGG + Intronic
1167517895 19:49933753-49933775 GGCCAGTGGGAGGAGGGGCAGGG + Exonic
1167676995 19:50893436-50893458 GGCTTTTGGGAAGAGGGGCAGGG + Intergenic
1167738712 19:51311767-51311789 GGCCTGGGGGGAGAGGGGGGAGG - Intergenic
1168258842 19:55181627-55181649 GTGCTGTGGGAGGAGGGGGCTGG - Exonic
1168582933 19:57570351-57570373 GACCTGTGGGTAGAGGGAGAAGG + Intergenic
1202713454 1_KI270714v1_random:29818-29840 GCCCAGGAGGAAGAGGGGGAGGG - Intergenic
925178666 2:1802369-1802391 AAGCTGTGGGAAGTGGGAGAGGG + Intronic
925284109 2:2704889-2704911 GCCCTGAGGGCAGAGGAGGAAGG + Intergenic
925291763 2:2752590-2752612 GTCCTGTGGGCAGGGAGGGAGGG + Intergenic
926109412 2:10172449-10172471 GAGCTGAGGGAAGACGGTGAAGG + Intronic
927276065 2:21263472-21263494 GACCTTGGAGAAGAAGGGGAGGG + Intergenic
928085845 2:28345849-28345871 GAGCTGTGGGAAGAGAGGAGGGG - Intergenic
928688337 2:33773311-33773333 GTCCTGTGGGAGGTGGGGGTGGG - Intergenic
929031590 2:37654326-37654348 GACATGTGAGAAGAGGCTGAAGG + Intronic
929313854 2:40454047-40454069 GACCTGTGGGGAGAGACAGAAGG + Intronic
929675293 2:43920764-43920786 GGACTGTGGGAAGACAGGGAAGG + Intronic
929784867 2:44982131-44982153 GACCTCTGAGAAGAGGCGGAGGG - Intergenic
930788239 2:55294640-55294662 GAGGGGTGGGAAGAGGAGGAAGG + Intronic
931306278 2:61031951-61031973 GACCTCTGGGCAGAGAGTGAAGG + Exonic
931439105 2:62274984-62275006 GACATGTGTGAAGAGGGGGCTGG - Intergenic
931763893 2:65437831-65437853 TAACTTTGGGAGGAGGGGGAAGG + Intergenic
931797212 2:65722581-65722603 GAGGTGCGGGGAGAGGGGGAAGG + Intergenic
932047246 2:68362194-68362216 GACACGTGGCAGGAGGGGGAGGG + Intergenic
932138757 2:69256292-69256314 CACCTGTGGTAGGTGGGGGATGG + Intergenic
932431098 2:71674042-71674064 GTCCTGTGGGAAGACTGGGAAGG - Intronic
932436340 2:71704473-71704495 GACCTGTGGGATGAGGAGGATGG + Intergenic
932713306 2:74083443-74083465 GAGCTGTGGGAAGACAGGGTTGG + Intronic
932715958 2:74100932-74100954 GAGCTCTGGGCAAAGGGGGAGGG - Exonic
932793205 2:74673572-74673594 GAACGGTGGGGAGAGGGAGAGGG + Exonic
932875069 2:75442811-75442833 GAAGGGTGGGAAGAGGGTGAGGG + Intergenic
933264704 2:80169304-80169326 GATCGGAGGGGAGAGGGGGAAGG + Intronic
933435571 2:82244976-82244998 GTGGGGTGGGAAGAGGGGGAAGG + Intergenic
933657693 2:84903271-84903293 CACCTATGGTAAGAGAGGGAGGG - Intronic
933837790 2:86259848-86259870 GAGAAGTGGGAAGAGGGGAATGG + Intronic
934844985 2:97656819-97656841 GGCATGTTGGGAGAGGGGGAGGG - Exonic
934857860 2:97739967-97739989 GACCCCTGGGAAGATGGGGCTGG + Intergenic
935274440 2:101463792-101463814 GAGCTGTGGGAGGAGGCAGAGGG + Intronic
935417961 2:102838427-102838449 TACCGATGTGAAGAGGGGGAAGG + Intronic
936058510 2:109279523-109279545 GACCTGTAGGACAAGGGTGATGG - Intronic
936903420 2:117510221-117510243 GACTTGAGGGAAAAGGTGGAGGG + Intergenic
937033535 2:118761827-118761849 GTTCTGTGGGAAGCTGGGGAGGG + Intergenic
937234655 2:120423405-120423427 GACCAATGGAAAGAGGAGGAGGG - Intergenic
937236645 2:120435328-120435350 CACCTCTGGGATGAGGAGGATGG - Intergenic
937301954 2:120848051-120848073 AAGCTGTGGGAAGAGGGAGAAGG + Intronic
937361835 2:121235056-121235078 GAAATGTGGCAAGAGGGGCACGG - Intronic
937413818 2:121698661-121698683 GACCTGAGAGGAGAGGGGAACGG + Intergenic
938296656 2:130183030-130183052 GGCCTGAGTGAAGAGGTGGAGGG - Intronic
938583187 2:132666518-132666540 GACCTGTGGCCAGAGGGGCCTGG + Intronic
938816708 2:134912076-134912098 GACTTGTGGGGATATGGGGATGG - Intergenic
938829300 2:135034813-135034835 GGGCTGTGGGGAGAGGGGGAGGG + Intronic
939156755 2:138534761-138534783 GACCTGTGGGGAGGGGGAAATGG - Intronic
939347524 2:140985945-140985967 TACCTCTGGAAAGAGAGGGAGGG - Intronic
939475880 2:142686118-142686140 GAGCAGGCGGAAGAGGGGGAGGG - Intergenic
939813536 2:146865860-146865882 GACTTGGGGGAAGAGTGGGAGGG + Intergenic
941133491 2:161684038-161684060 GGCCTGAGGGAAGAAGGGAATGG - Intronic
941174375 2:162178890-162178912 GACCTGTGGGAAATTGGAGATGG - Intronic
941318075 2:164019592-164019614 GACTTGAGGGAAGAGTGGGAGGG - Intergenic
941758326 2:169212761-169212783 GACTTGGGGGAAGGGTGGGAGGG + Intronic
942276404 2:174326832-174326854 GACCTGGGGGAGGCGGAGGAGGG - Intergenic
942733327 2:179082604-179082626 GAGCTGTGAGAAGAGGGCGAGGG - Intergenic
943620834 2:190146152-190146174 GACCTGGGGGAAGATTGGGAGGG - Intronic
944128524 2:196320487-196320509 GGCCTGTGGAAAGACGGCGAAGG - Intronic
945865275 2:215167638-215167660 GACGTGGGGGAATAGTGGGAGGG + Intergenic
945988769 2:216375653-216375675 GAGAGGTGGGAAGAGGGGGGAGG + Intergenic
946053037 2:216880028-216880050 GTCCTGTGGGTAAAGGGGAAAGG + Intergenic
946161186 2:217836991-217837013 CAGCTGTGGGAAGAGGGAGTGGG - Intronic
947363705 2:229372452-229372474 GGCCTGTGGGAGGGGGGTGAGGG + Intronic
947540385 2:230973354-230973376 GAGCTGGGGGAAGTGGGGGATGG + Intergenic
947586891 2:231361984-231362006 GAACTGTGGGAAGGATGGGAAGG + Intronic
947744862 2:232502259-232502281 GAGGGGTGGGAGGAGGGGGAGGG + Intergenic
947856761 2:233329294-233329316 CATCTGTGGGAAGCTGGGGAGGG - Intronic
947981997 2:234418558-234418580 GACTTGTGGGAAGGGGAGGGCGG - Intergenic
948294068 2:236847924-236847946 GAAGTGTAGGAGGAGGGGGAGGG + Intergenic
948294093 2:236848004-236848026 GAGGTGTAGGAGGAGGGGGAGGG + Intergenic
948294113 2:236848064-236848086 GAGGTGTAGGAGGAGGGGGAGGG + Intergenic
948783566 2:240339640-240339662 GACCTGTGAGAAGAGGCAGAGGG - Intergenic
948793627 2:240391489-240391511 GTCCTGGAGGAAGAGGGGGTGGG - Intergenic
948793802 2:240392133-240392155 GGACAGTGGGAAGAGAGGGAGGG - Intergenic
949019824 2:241734802-241734824 TGCCTGTGGGGGGAGGGGGACGG + Intronic
1168795091 20:606049-606071 GACCTGGGGGTGGAGGGGGCAGG - Intronic
1168806267 20:674057-674079 GACATGTGGGCAGAGGAGAAGGG + Intronic
1168955068 20:1828930-1828952 GAGATGGGGGAAGAGGGAGAGGG - Intergenic
1168981694 20:2009499-2009521 GACCTGTGAGAAGAGAGGGATGG + Intergenic
1169072017 20:2738594-2738616 GGCCTGAGGGGAGAGGAGGAAGG - Intronic
1169369637 20:5018791-5018813 GACGTGTGGGAAGAGACAGATGG + Intergenic
1169593919 20:7176720-7176742 GAGCTGTGAGAAGAGGGCCATGG - Intergenic
1170129369 20:13002146-13002168 GACCTGTGTGCACAGGGGCATGG + Intergenic
1170680790 20:18523323-18523345 AGCCTGAGGGAAGAGAGGGAAGG - Intronic
1170938124 20:20827204-20827226 GAACTCAGGGAAGAGGGAGAGGG + Intergenic
1171424125 20:25038993-25039015 GACAAGTGGGAGGAGGGGCAGGG - Intronic
1171732697 20:28729928-28729950 GTCGGGTGGGAGGAGGGGGAGGG - Intergenic
1171767220 20:29296930-29296952 GGCCTGTGAGGGGAGGGGGAAGG + Intergenic
1171810259 20:29741345-29741367 GACCTGCGGGGGGAGGGAGAAGG + Intergenic
1171865337 20:30484765-30484787 GGCCTGTTGGGGGAGGGGGAAGG + Intergenic
1172159800 20:32859261-32859283 GAGCTGACGGAAGAGGGGCAGGG - Intronic
1172808187 20:37628251-37628273 GACTTGGGAGATGAGGGGGAAGG - Intergenic
1172843616 20:37916390-37916412 GACATGTGGGAAGAGGAGGCGGG + Intronic
1172845746 20:37929151-37929173 GTCCTGTGGCAGGAGAGGGAGGG + Intronic
1173023311 20:39285817-39285839 GAGCTGAGGGAAGCGGGGCAGGG + Intergenic
1173807322 20:45934554-45934576 GACGGATGGGAAGAAGGGGAGGG + Intergenic
1173904189 20:46613819-46613841 GGGCTGGGGGCAGAGGGGGAAGG + Intronic
1174141410 20:48416794-48416816 GACCTGTGGGCGGTGGGAGAAGG - Intergenic
1174227121 20:49010212-49010234 GACCTGAGGAAAGAATGGGACGG - Exonic
1174302320 20:49591742-49591764 GACCTGTGGGAACATGGGTCTGG - Intergenic
1175563847 20:59956543-59956565 GAAGAGTGGGAAGAGGGTGAGGG - Intergenic
1175781370 20:61684309-61684331 GCCCTGTGGGAAGAGCAGGGGGG + Intronic
1175914783 20:62420801-62420823 GACCTGTGGGTAGGGGAGGCAGG - Intronic
1175914849 20:62421051-62421073 AATCTGTGGGAGGAGGGGGAAGG - Intronic
1176201725 20:63863945-63863967 CACCTGTGGGAGGAGGTGGCCGG + Intergenic
1176980442 21:15375520-15375542 GAACAGTGGGGAGAGGGGGAGGG + Intergenic
1177816950 21:25988026-25988048 GAGCTGAGGGGAGAGGGGAAAGG + Intronic
1178356422 21:31913475-31913497 GAGGTGTGGGAATAGGGGCAGGG + Intronic
1178830999 21:36056461-36056483 CACCTGTGGGAAGAGTGGAGTGG + Intronic
1179070759 21:38068643-38068665 GGTCTGTGGGAAGAGGCAGAAGG + Intronic
1179153629 21:38830911-38830933 GAACTGTGGCAAGAGGTAGAGGG + Intergenic
1179596445 21:42445993-42446015 GGACTGTGGGAAGCGGGGCAGGG - Intronic
1179810243 21:43865377-43865399 GGCGTGGGGGAAGAGGGGGGCGG - Intronic
1180092405 21:45539831-45539853 GGCCGCAGGGAAGAGGGGGAAGG + Intronic
1180312062 22:11249649-11249671 GGCCTGCGGGGGGAGGGGGAAGG + Intergenic
1180656999 22:17430352-17430374 GACATGTGGGAAGAGAGGGAGGG - Intronic
1181340066 22:22171670-22171692 GAACTGGTGGAAGATGGGGAAGG + Intergenic
1181484506 22:23222122-23222144 GACAGGTGAGAAGACGGGGAGGG - Intronic
1181685675 22:24526153-24526175 CACCAGTGGGAAGAGGGTGAGGG + Exonic
1181711632 22:24695237-24695259 GACCTGTGGGAAGGAGGGGGAGG + Intergenic
1181883385 22:25999546-25999568 GAGGAGGGGGAAGAGGGGGAGGG - Intronic
1182088311 22:27576569-27576591 CATCTGTGGGAAGGGAGGGAAGG + Intergenic
1182151657 22:28031414-28031436 GACCGGTGTGAAGAAGTGGAGGG + Intronic
1182875855 22:33690552-33690574 GACCTGGGGAAAAAGAGGGAGGG + Intronic
1183180894 22:36258969-36258991 CACCTGTAGGGACAGGGGGAGGG - Intronic
1183308848 22:37098384-37098406 GATCTGGGGGATGAGAGGGAGGG - Intronic
1183330257 22:37216193-37216215 TACCTGTGGGATGGGGGGGTGGG - Intergenic
1183340156 22:37275655-37275677 GAGCTGTGGGAAAAGGGGTTGGG - Intergenic
1183422962 22:37723063-37723085 GACCTGTAGGAGGAGGGTGTGGG + Intronic
1183423535 22:37725666-37725688 GGGCTCTGGGAAGAAGGGGAAGG - Exonic
1183483261 22:38076181-38076203 GGGCTGTGGGAAGAGGGGCGTGG + Intergenic
1183726071 22:39590338-39590360 TACCTGCAGGAAGAAGGGGAGGG - Intronic
1183775729 22:39963685-39963707 GACCTGTGTTAAGAAGGAGATGG - Intronic
1184083513 22:42243033-42243055 GATCCAAGGGAAGAGGGGGAAGG + Intronic
1184332067 22:43833536-43833558 GGCGTGTGGGAGGAGGAGGAGGG - Intronic
1184374020 22:44100260-44100282 GACATGTTGGCAGAGGAGGACGG + Intronic
1184526851 22:45029079-45029101 GGCCTGAGTGAAGAGGGGGCTGG + Intergenic
1185276716 22:49953087-49953109 GCCCAGTGGGAGGAGGGGGCTGG + Intergenic
1185295472 22:50051190-50051212 GACTTGGGGGAAGATTGGGAGGG - Intronic
1185335286 22:50268548-50268570 GACCTCTGGGAAGTGGGGCTGGG - Intronic
1185377409 22:50488714-50488736 GCCGTGGGGGAAGTGGGGGAAGG - Intronic
1185415921 22:50710249-50710271 GCCCTGTTGGAGGAAGGGGAGGG + Intergenic
949261381 3:2106244-2106266 GAGCTGTGAGAAGAGGGCTATGG - Intronic
949459678 3:4276955-4276977 GTTCTGAGGGAAGATGGGGATGG + Intronic
949706664 3:6826213-6826235 CACCTGAAGGAAAAGGGGGAGGG + Intronic
950038140 3:9902101-9902123 AAGCTGTGGGATGATGGGGAGGG + Intergenic
950483633 3:13260096-13260118 GGGCTGGAGGAAGAGGGGGAAGG + Intergenic
950519456 3:13487988-13488010 GACATGTGGGAAGGGAGTGAGGG + Intronic
950542406 3:13620329-13620351 GGCCTGGGTGGAGAGGGGGAAGG + Intronic
950709949 3:14806937-14806959 GGCCTGTGGGAATAGGGAGCTGG + Intergenic
950932126 3:16800468-16800490 GACCTGTGGCAAGAGGGAGCCGG + Intergenic
951275726 3:20683256-20683278 GAAATGTGGGAGGAGGGTGAGGG + Intergenic
951486744 3:23221442-23221464 GAGCTGGGGGAAAATGGGGAAGG - Intronic
952354459 3:32571123-32571145 GACCTGTCTGAAGGGTGGGAGGG - Intergenic
952716706 3:36487098-36487120 GGATTGTGGGAAGAGGGGCAGGG + Intronic
952754338 3:36852955-36852977 AACCTGGGGGAAAAGGGTGATGG - Intronic
953133863 3:40166417-40166439 GACCTGTGGGAAGGGGCCGGGGG + Intronic
953234944 3:41097970-41097992 GACCTGGAGGAAGTGAGGGAGGG - Intergenic
954299559 3:49692600-49692622 GGCTTGTGGGGAGATGGGGATGG - Intronic
954704028 3:52469260-52469282 TACCTGTGGGATGTGGGGGTGGG + Intronic
954725641 3:52606755-52606777 GACCTGTGGGAAGATGAACAAGG - Intronic
956033108 3:65060921-65060943 ACCCTGTGAGAAGAGGGGAAAGG - Intergenic
956264774 3:67384750-67384772 CACATGTGGGAAGGGGTGGAGGG - Intronic
957243310 3:77686721-77686743 CTCCTGTGGGAAAAGGAGGAAGG + Intergenic
957739368 3:84243936-84243958 GAGCTGAGACAAGAGGGGGAAGG - Intergenic
958528958 3:95299631-95299653 GAGCTGGAGGAAGAGGGAGAGGG - Intergenic
959104026 3:102045895-102045917 GTGGTGTGGGAGGAGGGGGAAGG + Intergenic
959971660 3:112416743-112416765 GACATGTGGGATGAGGTGTAGGG + Intergenic
960738288 3:120804308-120804330 GGCATGTGGGAAGAGGTGCAGGG + Intergenic
961384527 3:126516349-126516371 GTGCTGGGGGACGAGGGGGAAGG - Intronic
961402592 3:126657713-126657735 GAACTGTGGGGAGGGGAGGAGGG - Intergenic
961457033 3:127029420-127029442 CACCTGTGGGCAGAGGGCCAGGG - Exonic
961555664 3:127695188-127695210 GACCTGGAGGAAGAAGGAGAGGG + Exonic
961988876 3:131166626-131166648 GAGGGGTGGGAAAAGGGGGATGG - Intronic
961996190 3:131246253-131246275 GACTTGTGGGGAAAGGGTGAGGG - Intronic
963041667 3:141074841-141074863 GACCTTTGGGAAAAAGGGAAGGG + Intronic
963088248 3:141458263-141458285 AACCTGGGGGCAGAGAGGGAGGG - Intergenic
963315205 3:143751618-143751640 GACCTGTGGAAAGAAGCGGTGGG - Intronic
963882590 3:150545857-150545879 GACCTGTGAGGTGAGGGGGCCGG - Intronic
964341627 3:155714425-155714447 AACCTGCGGGAAGTAGGGGAGGG - Intronic
965602303 3:170467375-170467397 GACCTGTGGGGCGAGGGGAAAGG + Exonic
966021998 3:175224540-175224562 GAGTTTTGGGAAGAGGAGGATGG - Intronic
966117200 3:176479559-176479581 GACTGGGGGGAAGAGTGGGAGGG - Intergenic
966137322 3:176713678-176713700 CAACTGTGGGAAGAGGAGGCAGG - Intergenic
966206853 3:177413686-177413708 AGACCGTGGGAAGAGGGGGAGGG + Intergenic
966431800 3:179840034-179840056 GTCCTGTGGAATGAGGAGGAGGG + Intronic
966818350 3:183906793-183906815 TACCTGAGGGTAGAGGGGCAGGG + Intergenic
967023122 3:185540192-185540214 GACCTCTGAGAAGATGGGGAGGG - Intronic
967109461 3:186280822-186280844 GCCCAGTGGGAAGAGGGACAGGG + Intronic
967579015 3:191129868-191129890 GAGCTGTTGGAAGAGAGGCAGGG + Intergenic
967681460 3:192368915-192368937 GACCCCTGGGCAGAGGAGGAAGG - Intronic
967903924 3:194486257-194486279 GTCCTGTGGGCAGAGGCGTAGGG - Intronic
967955233 3:194872626-194872648 GTCCTGTGGGAAGAGGGAAGGGG + Intergenic
968057806 3:195705922-195705944 TAACTGTGGGGAGTGGGGGAGGG + Intergenic
968439810 4:617582-617604 CACCTGTGGAAGGAGAGGGAAGG - Intergenic
968665066 4:1816494-1816516 GGGCTGTGGGAAGAGGAAGAGGG + Intronic
968889237 4:3359064-3359086 GAGGTGGAGGAAGAGGGGGAGGG - Intronic
969123763 4:4930684-4930706 GACCTTTGTGAAGACAGGGAGGG - Intergenic
969391238 4:6892581-6892603 GCCCTGTGGGAGGAGGGAGCAGG + Intergenic
969915323 4:10485209-10485231 GAGCTGTGGGGAGAGGGAAATGG - Intergenic
971558840 4:28047957-28047979 CTGCTGTGGAAAGAGGGGGAAGG + Intergenic
973199195 4:47480485-47480507 GAGCTGGGGGAAGAGAGGAATGG - Intergenic
973857760 4:55030582-55030604 GATATATGGGAAAAGGGGGAGGG - Intergenic
974165342 4:58194760-58194782 GACTAGGGGGAAGAGTGGGAAGG + Intergenic
974778838 4:66524932-66524954 GACCTGAAGGAAGAGAGGCAGGG + Intergenic
975214585 4:71738558-71738580 GAGCTGTGAGAAGAGGGCCATGG + Intergenic
975838626 4:78451142-78451164 AATCTCTGGGAAGAGGGGGCTGG - Intronic
976791826 4:88887137-88887159 GACTTGGGGAAAGAGTGGGAGGG + Intronic
977015944 4:91693507-91693529 GAGCTGTGAGAAGAGGGGCATGG - Intergenic
977681325 4:99801593-99801615 GCCATGTGGGAAGTGGGGGTGGG - Intergenic
978482997 4:109216029-109216051 GATATGGGGGCAGAGGGGGATGG - Intronic
978525560 4:109661702-109661724 GACCTGGGGGAAATGAGGGAGGG + Intronic
978549318 4:109907974-109907996 GACCTGGGGGAAGTGTGGGAAGG + Intergenic
979654529 4:123176834-123176856 GCCTTGTGGGAGGTGGGGGAAGG + Intronic
980081348 4:128347722-128347744 GAGCTGTGGGTAGGGGAGGATGG - Intergenic
980883523 4:138738784-138738806 AGACTGTGGGGAGAGGGGGAGGG - Intergenic
981529761 4:145741038-145741060 GACCTTTGTGAGGAGGAGGAGGG - Intronic
982966521 4:161915297-161915319 GACAGGTAGGGAGAGGGGGAGGG - Intronic
983396676 4:167206075-167206097 GAACTTTGGGAGGACGGGGAGGG + Intronic
985623044 5:965815-965837 GTCCTGTGGGCAGGAGGGGAGGG + Intergenic
986034838 5:3927605-3927627 GGCCTATGGGAAGAGGGCCATGG - Intergenic
986152995 5:5144910-5144932 CAACTGTGGAAAGAGTGGGAAGG + Intronic
986501877 5:8409464-8409486 AGCCTGTGGGAGGAGGAGGAGGG - Intergenic
986583339 5:9288408-9288430 GGCCTGTGGGAGAAAGGGGAGGG - Intronic
987663622 5:20907835-20907857 GAGCTGTGAGAAGAGGGCCATGG + Intergenic
987788547 5:22534341-22534363 GAAGTGTGGGAAGGGGGTGAGGG - Intronic
987902331 5:24028949-24028971 GACATGGGGGAAAAGTGGGAGGG + Intronic
988759063 5:34294354-34294376 GAGCTGTGAGAAGAGGGCCATGG - Intergenic
989200710 5:38760094-38760116 GACTTGGGGGAAGAGGGGGAGGG + Intergenic
990272621 5:54159984-54160006 GACTTGAGGGAAGGGGAGGAGGG - Intronic
990659461 5:57996695-57996717 GAAATGGGGGAAGAAGGGGAGGG + Intergenic
990673161 5:58155190-58155212 GAAGTGTGGGAGGAGGGCGAGGG + Intergenic
990859346 5:60309223-60309245 AACATGAGGGAGGAGGGGGAGGG + Intronic
991118527 5:62982929-62982951 TACCTGTGGGAAGCTGGAGACGG - Intergenic
991457631 5:66821879-66821901 GGCCTGGAGGAAGATGGGGAGGG + Intronic
991457939 5:66824292-66824314 GACTGGTGGGACGAGGGGCAGGG + Intronic
992095318 5:73357595-73357617 GAGTTATGGGAAGAGAGGGAAGG - Intergenic
992180130 5:74187916-74187938 AAGCTGAGAGAAGAGGGGGAGGG + Intergenic
992570087 5:78046405-78046427 GACCGTTGGGAATAGGGGGATGG - Intronic
992601964 5:78410298-78410320 GGCCTGTCGGGAGATGGGGATGG - Intronic
992987537 5:82248449-82248471 GACATTGGGGAAGAGGAGGAGGG + Intronic
993614231 5:90090768-90090790 GAAGGGTGGGAAGAGGGTGAGGG + Intergenic
993883386 5:93389160-93389182 GACTTGGGGGAAGAGTGAGAGGG - Intergenic
994649105 5:102504518-102504540 GACCTGTAAGAAGAGGGCCATGG + Intergenic
994943765 5:106359078-106359100 GATGAGCGGGAAGAGGGGGATGG + Intergenic
995717253 5:115092432-115092454 CACCTGAGAGCAGAGGGGGATGG + Intergenic
996423317 5:123285769-123285791 GGCGTGGGGGAAGAGGGAGAGGG - Intergenic
996989243 5:129608332-129608354 GAGCTGTAGGATGAGGGGAATGG + Intronic
997256910 5:132436016-132436038 GACCTGTGGGAAGTGGCTAAGGG + Intronic
997281130 5:132646594-132646616 GACGGGTGGGGTGAGGGGGATGG + Intergenic
997282360 5:132656850-132656872 TCCCTGTGGGAAGAGAGGGTGGG + Intronic
997389248 5:133500164-133500186 GACTTCAGGGAAGAGGAGGATGG - Intronic
997481042 5:134184745-134184767 GTCCTCTGGGCAGAGGGGTAGGG - Intronic
998114706 5:139527284-139527306 CTACTGTGGGGAGAGGGGGAAGG - Intronic
998256892 5:140594845-140594867 AGCCTCTTGGAAGAGGGGGAGGG - Intergenic
998596154 5:143532607-143532629 TACCTCTGGGAATATGGGGAAGG + Intergenic
998673637 5:144382253-144382275 AGCATGTGGGAAGAGGGTGAAGG + Intronic
998679697 5:144453192-144453214 CACCTGAGGGAAAAGGGAGATGG - Intronic
998873433 5:146575597-146575619 GAGCTGTGAGAAGAGGGCCATGG - Intergenic
998900963 5:146853853-146853875 GACCTGAAGGATGAGGAGGAGGG - Intronic
999867945 5:155721624-155721646 GACTTGTGGGAGGAGGAGAATGG - Intergenic
999874065 5:155782852-155782874 GACCAGGGTAAAGAGGGGGATGG - Intergenic
1000174135 5:158733971-158733993 AACATCTGGGAAGTGGGGGATGG + Intronic
1000381297 5:160632073-160632095 GTTCTGTGGGAAGAGAGGGAGGG - Intronic
1000412751 5:160950606-160950628 GACCTGTGGGAAGAGAGGAGGGG + Intergenic
1000540940 5:162538827-162538849 TACCTGAGAGAAGAGGAGGAAGG + Intergenic
1000688410 5:164283343-164283365 GACTTGGGGGAAAAGGTGGAGGG - Intergenic
1000788023 5:165570506-165570528 GAACTGTGAGAAGAGGGCCATGG - Intergenic
1001148390 5:169204643-169204665 CACCTGTGGCAACAGCGGGAAGG + Intronic
1001597547 5:172907730-172907752 GACCTTTGGGGAGAAGGGGCTGG - Intronic
1001644349 5:173269163-173269185 GACATGTGGGAAGTGGGTGGAGG - Intergenic
1001651326 5:173318197-173318219 GACCTGTGGGGAGGAGGTGAAGG - Exonic
1001937332 5:175714725-175714747 GTCCTGGGGCAAGAGGGGAAGGG - Intergenic
1001990531 5:176112551-176112573 GAGCTGTGGGAAGACTAGGAGGG - Intronic
1002226342 5:177725589-177725611 GAGCTGTGGGAAGACTAGGAGGG + Intronic
1002267506 5:178045624-178045646 GAGCTGTGGGAAGACTAGGAGGG - Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1002664194 5:180810604-180810626 GACCTTTGGGCGGAGGGAGAGGG - Intronic
1002915004 6:1521918-1521940 GAGCTGTGTGAAAAGGGAGATGG - Intergenic
1003351658 6:5323675-5323697 GGCCTGAGGGAAGAGCTGGAGGG + Intronic
1003746850 6:9011564-9011586 GACTTGGGGAAAGAGTGGGAGGG + Intergenic
1004064253 6:12227484-12227506 GGCCTGGGGGATGAGGGGCAGGG + Intergenic
1004553242 6:16670138-16670160 GACCTGTGGAATAAGGGGGAAGG - Intronic
1004755076 6:18601927-18601949 GCCCTCTGGCTAGAGGGGGATGG + Intergenic
1005837897 6:29721632-29721654 GGCCTGAGGGATGAGAGGGACGG + Intergenic
1005851496 6:29826581-29826603 GGCCTGAGGGATGAGAGGGACGG + Intergenic
1005904953 6:30254641-30254663 GAGCTGTGAGAAGAGGGCCACGG - Intergenic
1006098903 6:31673461-31673483 GGCCTGTGAGAGGAGAGGGAAGG + Exonic
1006370804 6:33642667-33642689 GGCCTGGGGGAGGAGGGAGAGGG - Intronic
1006420657 6:33931780-33931802 GCCATGTGGGAAGACGCGGAGGG - Intergenic
1006612232 6:35301034-35301056 GAGCTGGGGGAAGGGAGGGAGGG + Intronic
1006784819 6:36659250-36659272 GAGTTGTGGGAAGAGTGGAAGGG - Intergenic
1006889943 6:37418165-37418187 CACCTGGAGGAAGAGGGGGACGG + Intergenic
1007200819 6:40107091-40107113 AACCTGTAGGAACAGGGGAAAGG + Intergenic
1008409266 6:51154290-51154312 GAAGGGTGGGAAGAGGGCGAGGG - Intergenic
1009462724 6:63933589-63933611 GACCTCTGGGAAGAGGAGAGGGG - Intronic
1009878140 6:69531891-69531913 AACCGGTGCGAAGAGAGGGAAGG - Intergenic
1011565997 6:88672555-88672577 GAAGTGTGGGATGAGGGTGAGGG + Intronic
1011820355 6:91245722-91245744 GGACATTGGGAAGAGGGGGATGG + Intergenic
1012148659 6:95718344-95718366 GAGCTGTGAGAAGAGGGCCATGG - Intergenic
1012983876 6:105854902-105854924 GGGCCGTGGGGAGAGGGGGAGGG + Intergenic
1013050796 6:106533212-106533234 TAGCTGAGGGAAGAGGGGCAGGG + Intronic
1013693502 6:112673037-112673059 GAAGTGAGGGAAGAGGGGAAAGG - Intergenic
1014214168 6:118736876-118736898 GGAAGGTGGGAAGAGGGGGAAGG - Intergenic
1014580032 6:123125988-123126010 GACCTGTTGGAGGTGGGAGAAGG - Intergenic
1014604383 6:123454121-123454143 GACTTGGGGGAAGAGTGGGAGGG + Intronic
1015599569 6:134899405-134899427 GAGCTAGGGGAAGAGGGGAATGG - Intergenic
1015602081 6:134920422-134920444 GTCCTGTGTGAATAGGGGAATGG + Intronic
1015927734 6:138327093-138327115 CACCTGTGGGGAACGGGGGAGGG + Intronic
1015955100 6:138590461-138590483 AACCAGAGGGAAGAGGGGCAGGG - Intronic
1017352843 6:153463396-153463418 GGGCTGGGGGAAGAGGGGCAGGG + Intergenic
1017898469 6:158701421-158701443 GAGCCGTGGGAAGAGGGTCATGG + Intronic
1018958906 6:168432259-168432281 GGCCTGTGTGGTGAGGGGGACGG + Intergenic
1019217751 6:170454636-170454658 GGCCTGTGGTAGGAGGAGGATGG - Intergenic
1019477232 7:1249789-1249811 GAGCTGTGGGAGGAAGCGGAGGG - Intergenic
1019521244 7:1461433-1461455 GCCCTGTGGGCAGAGGCGGGGGG - Intergenic
1019650889 7:2157623-2157645 TGCCTGTGGGAAGAGAGGGCTGG + Intronic
1019781807 7:2944852-2944874 GCCTTGTGGGCAGAGGGGGTTGG + Intronic
1019864822 7:3698107-3698129 GTCCTTTGGGAGGAAGGGGAGGG - Intronic
1021081455 7:16370281-16370303 GCCTTGTGGGGAGATGGGGAGGG + Intronic
1021382450 7:19984190-19984212 GAGGAGAGGGAAGAGGGGGAAGG - Intergenic
1021398965 7:20187485-20187507 AAGCTGTGGGAAGAGGGAGAAGG - Intronic
1023196387 7:37644122-37644144 GACCTGGGAGAAGAGGAGAAGGG - Intergenic
1023777393 7:43620853-43620875 GACCTGGGAGAAGAGGAGGGCGG + Intronic
1023828962 7:44028326-44028348 GATCTGGGGTCAGAGGGGGAAGG + Intergenic
1024481183 7:49864969-49864991 CTCCTGTGGGAAGAATGGGAGGG + Intronic
1025777346 7:64570496-64570518 GGCCTGGGGGGAGAGGGGCAAGG + Intergenic
1026116848 7:67502940-67502962 GAGATGTGGGCAGAAGGGGAAGG + Intergenic
1026743169 7:72991355-72991377 GCCCGGTGGGAAGTGGAGGACGG - Intergenic
1027029283 7:74876052-74876074 GCCCGGTGGGAAGTGGAGGACGG - Intergenic
1027100566 7:75373723-75373745 GCCCGGTGGGAAGTGGAGGACGG + Intergenic
1027732723 7:81896716-81896738 GACTTGGGGGAAGGGTGGGAGGG - Intergenic
1027974634 7:85135506-85135528 GAGGTGGGGGTAGAGGGGGAGGG + Intronic
1028051653 7:86195377-86195399 AAACTGTAGGAAGAGGGCGAGGG - Intergenic
1028269209 7:88767315-88767337 TAGCTGTGGGAAGAAGGGCAGGG - Intronic
1028461117 7:91094016-91094038 GACTATTGGGAGGAGGGGGAGGG + Intronic
1029117991 7:98247661-98247683 GAGCCGGGGGAAGAGGAGGAAGG - Intronic
1029284163 7:99454627-99454649 GCTCTGTGGGAAGCGGGGAAAGG + Intronic
1029591114 7:101507663-101507685 AACCTTTGGGAAGTGGAGGAGGG - Intronic
1029702127 7:102254138-102254160 GAGCTTTGGGAACAGGTGGAAGG - Exonic
1029739261 7:102482583-102482605 GATCTGGGGTCAGAGGGGGAAGG + Intronic
1029757262 7:102581762-102581784 GATCTGGGGTCAGAGGGGGAAGG + Exonic
1029775202 7:102680823-102680845 GATCTGGGGTCAGAGGGGGAAGG + Intergenic
1030066307 7:105661893-105661915 CACCTGTGGGAAGAAGAGAAAGG - Intronic
1031123022 7:117742692-117742714 GGACTGTGGGACGAGGGTGAGGG + Intronic
1031574441 7:123398369-123398391 GACATATGGGAAGAGGAGCAAGG + Intergenic
1031574716 7:123401117-123401139 GACCAGGGGGTGGAGGGGGATGG + Intergenic
1031971125 7:128065874-128065896 GACCTTTGGGAAGATGGGTCCGG + Intronic
1031986258 7:128166541-128166563 GGCCTTTGGGAGGAAGGGGAAGG + Intergenic
1032365833 7:131298585-131298607 GATCTGTGAGAAAAGAGGGAAGG - Intronic
1032478344 7:132227293-132227315 GTGTTATGGGAAGAGGGGGATGG - Intronic
1032605708 7:133349314-133349336 GAGCTGGGAGAAGAGGGGTATGG - Intronic
1033528922 7:142244004-142244026 GACCTGTGAGCAAAGGGAGAAGG + Intergenic
1033556270 7:142490776-142490798 GACCTGTGGAGACAGTGGGAGGG + Intergenic
1034277207 7:149829200-149829222 GGACTGTGGGAAGAGGGGCAGGG - Intergenic
1034411006 7:150942223-150942245 GAGCTGTGGCAAGAGAGGAAGGG - Intergenic
1034552775 7:151832113-151832135 GGCCTGGGGGAAGGGGAGGAAGG + Intronic
1035371294 7:158380660-158380682 GAGCTGTGAGAAGAGGGCCACGG - Intronic
1035474376 7:159131547-159131569 GTCCTGTGGGGAGAGGGGCGAGG - Intronic
1035660094 8:1341073-1341095 GACCTGTGGGAGGAGGAGGGTGG + Intergenic
1035763169 8:2084982-2085004 ATTCTGTTGGAAGAGGGGGAAGG - Intronic
1036444490 8:8809702-8809724 GACAGTTGGGGAGAGGGGGAGGG + Intronic
1036937405 8:13016753-13016775 GTCCTCTGGGGAAAGGGGGAAGG - Intronic
1037467303 8:19172725-19172747 GACGGGAGGGGAGAGGGGGAGGG + Intergenic
1037833308 8:22201569-22201591 CAGCTGTGGGGAGAGGAGGATGG - Intronic
1037884865 8:22590559-22590581 GAACAGTGGGGAGAAGGGGAGGG + Intronic
1037917065 8:22779074-22779096 GAGGTGGGGGAGGAGGGGGATGG + Intronic
1037941710 8:22956462-22956484 GACCAGGAGGAGGAGGGGGAGGG - Intronic
1038037948 8:23702385-23702407 GACCTGCGGGCGGAGGGGAAGGG + Intergenic
1038692266 8:29774180-29774202 GACCTGTGGGCATTGGGGGAGGG - Intergenic
1038715646 8:29988279-29988301 GACCTGAGGCAAGAGTGAGAGGG - Intergenic
1040488287 8:47895333-47895355 TACCTGTTGGAAGAAGGGCAAGG + Intronic
1041897598 8:62943991-62944013 GACTTTGGGGAATAGGGGGAAGG + Intronic
1042179111 8:66067183-66067205 GGGCGGTGGGAAGTGGGGGAGGG - Intronic
1042432768 8:68727471-68727493 GAGCTGTGAGAAGAGGGCCACGG - Intronic
1043427061 8:80158196-80158218 GGCCTGTGGGAATGGGGGAATGG - Intronic
1043753737 8:83974998-83975020 AACCTGGGGGAAGAAGGGAATGG - Intergenic
1044036215 8:87306752-87306774 GATGTGGGGGAAGAGTGGGAGGG + Intronic
1044443036 8:92243262-92243284 GAGCTGTGAGAAGAGGGCCACGG - Intergenic
1045065323 8:98438940-98438962 CACCCGTGGGGAGAAGGGGATGG + Intronic
1045271786 8:100668368-100668390 GACCTGAAGGAAGAGAGGAATGG - Intergenic
1045577789 8:103444800-103444822 CACCTGTGGTAAGAGATGGAAGG + Intergenic
1045891747 8:107166037-107166059 GACCTGTGGGAAGAAGGACTCGG + Intergenic
1046588132 8:116173014-116173036 GACAGGTGGAAAGAAGGGGAGGG + Intergenic
1047791198 8:128205656-128205678 GACTTGTGGGATCAAGGGGATGG - Intergenic
1047937596 8:129797731-129797753 GAGCAGTGGGAAGAGAGAGAAGG + Intergenic
1048018386 8:130517476-130517498 GCCCTTTGGGGAGAGGAGGATGG + Intergenic
1048260991 8:132944901-132944923 TCCCTGTGGGAAGAGGGTGCAGG + Intronic
1048450309 8:134527699-134527721 ATCCTGTGGGAAGAGGGGCTGGG - Intronic
1048987016 8:139740194-139740216 GACAGGAGGGAAGAGGGGGCCGG - Intronic
1049192810 8:141298112-141298134 GGCCTGTGGGATGAAGGGAAGGG - Intronic
1049508444 8:143015866-143015888 GTCCTGTGTGAGGAGGAGGAGGG + Intergenic
1049915496 9:313602-313624 GGGCTGTGGGGAGAGGGAGAAGG + Intronic
1050039618 9:1475574-1475596 GGCCAGTGAGAAGAGGTGGAAGG - Intergenic
1050107237 9:2178273-2178295 GACATGGGGTAAGTGGGGGAGGG - Intronic
1050328702 9:4523086-4523108 GAGCTGTGGGAAGACAGGGATGG - Intronic
1050459645 9:5866755-5866777 CAGCTGTGGGAAGAGAGGGTGGG + Intergenic
1050534760 9:6622272-6622294 GGCCCGTGGAAAGAGGGAGAGGG - Intronic
1051001410 9:12287015-12287037 ACCCTGTGAGAGGAGGGGGAGGG + Intergenic
1051335740 9:16064394-16064416 GAGGTGTGGGGAGAGGGTGAGGG + Intergenic
1051437053 9:17044172-17044194 GACATGTAGAGAGAGGGGGACGG - Intergenic
1052283466 9:26758360-26758382 GCCCAGTGGGAAGAAGGGCAAGG + Intergenic
1053055538 9:34991292-34991314 GGCCTGTGGGTAGGGGGGAAGGG + Intronic
1055186680 9:73464837-73464859 GACTTGTGGGAAAAGGTAGAAGG - Intergenic
1055325528 9:75124399-75124421 AACCTGGGGGGAGACGGGGATGG - Intronic
1056412471 9:86344424-86344446 GACCTTTGGCATGATGGGGAGGG - Intronic
1056413902 9:86358114-86358136 GACCTCTGTGAAGGGGAGGAGGG + Intergenic
1057057382 9:91974169-91974191 GGCCTGTTGGAAGCTGGGGAGGG + Intergenic
1057306337 9:93914316-93914338 TTCCTGTGGGAAGATGGGTAGGG - Intergenic
1057614077 9:96572343-96572365 GACTTGTGGGAAGGAGGGGGTGG + Intronic
1057876625 9:98760341-98760363 AACCTCTGGGGAGAGGGAGAGGG - Intronic
1059457099 9:114406542-114406564 GACCCGTGGGAAGGGGCCGATGG + Exonic
1059530383 9:115030200-115030222 GGCCTAGGGGAAGAGGGAGAGGG - Intronic
1060327588 9:122632571-122632593 GACTTGGGGGAAGCGGTGGAAGG - Intergenic
1060566887 9:124600858-124600880 GACCTGAAGGAAGAAGGAGAAGG + Intronic
1060819437 9:126652772-126652794 AGCCTGTGGGAACAAGGGGATGG + Intronic
1060867022 9:127008504-127008526 CAGCTGTGGGAAAAGTGGGATGG + Intronic
1061010350 9:127950917-127950939 GGCCTGTGGGAAGTGGGTGCTGG + Intronic
1061714983 9:132513442-132513464 GTCCTCAGGGAAGACGGGGAGGG - Intronic
1061882654 9:133575792-133575814 GACCTGTGGGGGCAGGGGGCAGG + Intergenic
1061916171 9:133755629-133755651 CACCAGTGGGGAGAGGGAGAGGG + Intergenic
1061985194 9:134126540-134126562 GACCTGCGGGAAGCGGTGAAGGG - Intergenic
1062483542 9:136763303-136763325 GGCCTGTGGGAAGTTGGGGAGGG + Intronic
1062622497 9:137429155-137429177 GACCTGCGGGAAGGGGGTGGGGG + Intronic
1203360549 Un_KI270442v1:217085-217107 GGCCTGTGGGGGGAGGGAGAAGG + Intergenic
1185937452 X:4274954-4274976 GACTCGGGGGAAGAGTGGGAGGG - Intergenic
1186540534 X:10395726-10395748 AAGCTGTGGGGAGATGGGGAGGG - Intergenic
1187242006 X:17522304-17522326 GACCTGTAGGATAAGGGGGCGGG + Intronic
1187432193 X:19235305-19235327 GACTTGTGGGAGAAGGGTGAGGG - Intergenic
1188032783 X:25282997-25283019 GAGCTGTGGGTAGGGGAGGATGG - Intergenic
1188423837 X:30023515-30023537 GATATGTGGGAAGACGGGGGTGG + Intergenic
1188671882 X:32890430-32890452 GGCCTGTGGGGGGTGGGGGAGGG + Intronic
1188864239 X:35294908-35294930 GAGCTGGGGGAAGAGGGAAATGG - Intergenic
1189312939 X:40032788-40032810 GACCTGGGGGAGGAAGAGGAGGG + Intergenic
1189948845 X:46207656-46207678 TACCTGTAGAAAGAAGGGGATGG - Intergenic
1190035326 X:47018210-47018232 GAGGTGTGGGAAGAAGGAGATGG - Intronic
1191808980 X:65166186-65166208 GTGGGGTGGGAAGAGGGGGAGGG - Intergenic
1191911931 X:66160695-66160717 GACCTCTGGGGAAAGGTGGAGGG - Intergenic
1192433732 X:71129531-71129553 GACCTTTGGGGAGGAGGGGAGGG + Intronic
1192947150 X:75976636-75976658 GACTTGAGGGAAGAGTGGGAGGG - Intergenic
1193599321 X:83489976-83489998 GAACTTTGGGAAGAGGAGGCTGG + Intergenic
1196531213 X:116788836-116788858 GACATGGGGGGAAAGGGGGAAGG + Intergenic
1197101458 X:122660925-122660947 TATCTGTGGGATGAGTGGGATGG - Intergenic
1197598638 X:128499371-128499393 TACTTGAGGGAGGAGGGGGAAGG - Intergenic
1198791163 X:140347906-140347928 GAGCTAAGGAAAGAGGGGGAAGG - Intergenic
1199372058 X:147061048-147061070 GACTTCTGTGAAGAAGGGGAAGG + Intergenic
1199428951 X:147736663-147736685 GGCAGGAGGGAAGAGGGGGAGGG - Intergenic
1199969663 X:152850245-152850267 GGCCTGTGGAAAGAGAGGAACGG - Exonic
1200066062 X:153504601-153504623 GACCTGGGGGAAGAGGCGAGGGG - Exonic
1200219418 X:154383833-154383855 GGCGTGAGGGAAGAGAGGGAAGG + Intergenic