ID: 1119899496

View in Genome Browser
Species Human (GRCh38)
Location 14:78247932-78247954
Sequence GCATGAAGTCAGCCTGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119899494_1119899496 2 Left 1119899494 14:78247907-78247929 CCAGTGTCTCTGAAGAGTTCATT 0: 1
1: 0
2: 0
3: 23
4: 227
Right 1119899496 14:78247932-78247954 GCATGAAGTCAGCCTGTGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119899496 Original CRISPR GCATGAAGTCAGCCTGTGGC AGG Intronic
900677982 1:3900412-3900434 GCAGGAAGTCGGCCTGTGGCCGG + Intergenic
900758222 1:4452348-4452370 GCATGATGTTAGCCTGTGCGAGG - Intergenic
901023425 1:6266768-6266790 GCAGGAAGCCAGGCTGTGGGCGG - Intronic
902453737 1:16516413-16516435 GCATGGAGTCAGCTTCTGGGTGG + Intergenic
902473791 1:16669077-16669099 GCATGGAGTCAGCTTCTGGGTGG + Intergenic
902485012 1:16738365-16738387 GCATGGAGTCAGCTTCTGGGTGG - Intergenic
902498747 1:16893848-16893870 GCATGGAGTCAGCTTCTGGGTGG - Intronic
902738596 1:18418319-18418341 TCATGAAGACAGCCTGTGTCTGG + Intergenic
903257514 1:22112869-22112891 GCATGAAATCTGTCTCTGGCTGG - Intergenic
904499812 1:30907602-30907624 GCATGATGTGTGCCTGTGCCTGG - Intronic
904901463 1:33860884-33860906 TCATGAGGTCAGTCTGTGGGTGG + Exonic
907383335 1:54109372-54109394 GCATGAAGTGAGCCTGGAGAAGG + Intronic
914220224 1:145674737-145674759 GCTTGAAGACAGCCTGTCGTGGG + Intronic
914472802 1:147997599-147997621 GCTTGAAGACAGCCTGTCGTGGG + Intergenic
915180735 1:154057222-154057244 GCATGATGGGAGGCTGTGGCAGG - Intronic
917531745 1:175842056-175842078 GCAGGAAGGCAGCGAGTGGCTGG + Intergenic
917687724 1:177434484-177434506 GCACCAAGTCAGCCTGTTGTAGG + Intergenic
919169366 1:193934889-193934911 GCAGGAGCGCAGCCTGTGGCTGG - Intergenic
919669270 1:200324086-200324108 GAATGAACACAGCCTGTGTCTGG + Intergenic
921177752 1:212608668-212608690 GCATTACGTCAGCCTGGGACTGG + Exonic
922658669 1:227409485-227409507 GCTTGCAGTCAGCCTGTTGTGGG - Intergenic
923802144 1:237220491-237220513 GCTTGCAGTCAGCCTGTCGTAGG + Intronic
1063498558 10:6532199-6532221 GCATTCAATCAGCCAGTGGCCGG + Intronic
1063544088 10:6962879-6962901 CCCTGAAGTTTGCCTGTGGCAGG - Intergenic
1064126300 10:12663717-12663739 GCATGAAATGAGCCTTTGCCTGG + Intronic
1064332544 10:14407348-14407370 ACAGGAAGTCAGCCTGAGGACGG + Intronic
1067126058 10:43516543-43516565 GCATGCAGACAGCCTGTTGTGGG - Intergenic
1067518143 10:46972974-46972996 GCAAGAAGGCAGCCATTGGCAGG + Intronic
1067644106 10:48078854-48078876 GCAAGAAGGCAGCCATTGGCAGG - Intergenic
1068050917 10:51947756-51947778 CCATGGAGTCCCCCTGTGGCTGG - Intronic
1073476627 10:103757854-103757876 GCAGGAAGTGAGGCTGTGCCTGG + Intronic
1073836754 10:107453091-107453113 GAAGGAAGTCATCCTCTGGCTGG + Intergenic
1074402426 10:113153003-113153025 AGAGGAAGTCAGCCTTTGGCAGG + Intronic
1074597131 10:114877790-114877812 GCATGAAGTCATCTTGCGTCTGG + Intronic
1076214610 10:128682908-128682930 GCATGATGTCCACCTGTGGCTGG + Intergenic
1076460638 10:130643363-130643385 ACTTGGACTCAGCCTGTGGCAGG - Intergenic
1077303137 11:1856267-1856289 GCATGGAGTTTGCCTGTAGCTGG - Intronic
1078808861 11:14737492-14737514 TAAAGAAGGCAGCCTGTGGCCGG - Intronic
1084084271 11:66847747-66847769 GCAGGAAATCAGCCTCTGGATGG - Intergenic
1084955692 11:72690136-72690158 GGAAGAAGTCAGGCTGTGGGTGG + Intronic
1085455050 11:76660860-76660882 GCTGGAACTCAGCCTGGGGCTGG + Exonic
1086459666 11:86994191-86994213 GCCTGAAGTCAGTCTTAGGCAGG + Intergenic
1086597487 11:88590923-88590945 TCATAAAGTTAGCTTGTGGCAGG + Intronic
1091596219 12:1880864-1880886 GCATGAAGCCAGCTTGTCCCTGG + Intronic
1092763614 12:11832172-11832194 GCATGATGTCAGCCTGCTGATGG + Intronic
1093800284 12:23364236-23364258 GCACCAAGTCAGCCTCTGGGTGG - Intergenic
1095164363 12:38954545-38954567 GCATCAAGTTAGCCTGTGACAGG - Intergenic
1095625487 12:44309259-44309281 TCATAAAGTCAGTCAGTGGCAGG + Intronic
1096317296 12:50579226-50579248 GAATGAAATGAGCCTGTTGCTGG + Intronic
1101377649 12:104184660-104184682 GCCTGAAGTCAGCCTGTGGTGGG - Intergenic
1101558776 12:105835818-105835840 CCATGAAGTCATCCTGTGTGAGG + Intergenic
1101709912 12:107255640-107255662 GGATGAACTAAGCCTGTTGCTGG - Intergenic
1101801835 12:108029192-108029214 GCATGAAGTCAGCAGCTGGGAGG + Intergenic
1102137991 12:110591309-110591331 GCAGTAACCCAGCCTGTGGCTGG + Intergenic
1104415009 12:128590732-128590754 GCATGCAGGCAGGCTGAGGCTGG + Intronic
1104742012 12:131184592-131184614 CCATGAAGTCAGCCAGTAGGGGG - Intergenic
1107193219 13:37615467-37615489 ACATGATGTCATCCTGTGGTAGG - Intergenic
1113110300 13:106815647-106815669 CCATGTAGGCAGCCAGTGGCTGG - Intergenic
1114675648 14:24438591-24438613 GCTTGAAGTCCTCCTGTGCCAGG + Exonic
1118354073 14:64997327-64997349 GCACTGAGTCAGCCTGTGGGTGG - Intronic
1119662290 14:76460606-76460628 GCTTGAGGTCAGCCTGAGCCAGG - Intronic
1119899496 14:78247932-78247954 GCATGAAGTCAGCCTGTGGCAGG + Intronic
1121099051 14:91237279-91237301 GCCTGAAGCCAGCCTGAGGTTGG + Intronic
1121175814 14:91889935-91889957 GCACGGTGCCAGCCTGTGGCTGG + Intronic
1122150267 14:99721843-99721865 GTATGCACTCAGCCTGTGGGTGG + Intronic
1122491130 14:102116851-102116873 GCTTGCAGGCAGCCTGGGGCAGG - Intronic
1124997458 15:34737521-34737543 GCAGGAAGTAATCCTGTGCCTGG + Intergenic
1128229914 15:66027262-66027284 GTGTGGACTCAGCCTGTGGCTGG - Intronic
1129600489 15:76995519-76995541 CCATCAGGCCAGCCTGTGGCAGG + Exonic
1129758657 15:78113980-78114002 GCATGAAGTCAGGCTGAGGTTGG + Intronic
1129944610 15:79527917-79527939 GCAGGAGGTGAGCCTGTGTCTGG + Intergenic
1131188245 15:90293461-90293483 GCATGAGGGCAGCTGGTGGCTGG - Intronic
1131256799 15:90868368-90868390 TCATTAAGTCAGCCAGTGGCTGG + Intergenic
1131282583 15:91033334-91033356 GCATGAGGGCAGCTGGTGGCTGG + Intergenic
1132720114 16:1311607-1311629 GCAGGAGGGCTGCCTGTGGCAGG + Intronic
1138855117 16:60681408-60681430 GCAGGAAGACAGCCTTTGCCTGG + Intergenic
1139183218 16:64771324-64771346 GCTTCCTGTCAGCCTGTGGCTGG - Intergenic
1140136261 16:72208239-72208261 CCATGAAGTTAGCTTGTGGAAGG + Intergenic
1141152751 16:81575519-81575541 GGATGAAGTCAGCCTCTGTATGG - Intronic
1142308513 16:89299136-89299158 GCAGAGAGTCAGGCTGTGGCAGG + Intronic
1144050366 17:11492769-11492791 GCATGAAGAGAGCCTGTGCTAGG - Intronic
1144073734 17:11698862-11698884 GCATAAAGTCTGGCTGTGCCGGG - Intronic
1145907381 17:28523984-28524006 GCGTGACGTCAGACTGCGGCGGG - Exonic
1146156688 17:30530316-30530338 GGATGAAGTCAGCCTGAAACAGG - Intergenic
1148761473 17:50004147-50004169 GCATGCATTCAGTGTGTGGCTGG - Intergenic
1150254569 17:63733777-63733799 TCATGTAGGCAGCCTGTGCCTGG - Intronic
1153728611 18:7983153-7983175 GCAGGAAGTGAGCCAGAGGCGGG + Intronic
1156982482 18:43306714-43306736 GCATGACCTCTGCCAGTGGCAGG + Intergenic
1157297210 18:46454732-46454754 TCTTGAAGTCAGCCTGTCTCTGG + Intronic
1158577858 18:58655423-58655445 TTATGAAGTCAGCTTCTGGCAGG + Intergenic
1161381231 19:3966139-3966161 TCATGCAGTCAGTCAGTGGCGGG + Intronic
1161451106 19:4345863-4345885 CCAAGAAGTCGGGCTGTGGCTGG + Exonic
1161967033 19:7554660-7554682 GGATGCAGTCGGCCTGTCGCAGG - Exonic
1162135582 19:8553252-8553274 GGAAGAAGTCAGACTGAGGCAGG + Intronic
1163701053 19:18786711-18786733 GGATGAGGCCAGCCTGAGGCTGG + Intronic
1164649584 19:29882369-29882391 GCAGGAAGTAAGCCTGTGAGAGG - Intergenic
1165327525 19:35122976-35122998 GCGTCCAGTCAGCCTGAGGCGGG - Intronic
1165355853 19:35303537-35303559 GGATGAGGTCAGCCTTGGGCAGG - Intronic
1165743761 19:38218472-38218494 GACTGAGGTCAGACTGTGGCAGG + Intronic
1166906463 19:46113323-46113345 GCCTGAAGTCAGACTGTTGTTGG + Intergenic
1167137282 19:47624548-47624570 ACATGAAGTGAGCTTGTGACTGG + Intronic
1202705982 1_KI270713v1_random:24152-24174 GCATGGAGTCAGCTTCTGGGTGG + Intergenic
926060623 2:9802563-9802585 GCATGGGATCAGCCTGGGGCTGG + Intergenic
926376448 2:12232988-12233010 TCTGGAAGGCAGCCTGTGGCCGG + Intergenic
927815665 2:26214923-26214945 GCATAAAGTCAGCCTTAGGTAGG - Intronic
928029112 2:27763905-27763927 GCATAAGGCCAGCCTGGGGCTGG - Intergenic
928865935 2:35917999-35918021 GCTTGAAGACAGCCTGTTGTGGG - Intergenic
930240633 2:48932570-48932592 TTATGAATCCAGCCTGTGGCAGG + Intergenic
932404738 2:71505520-71505542 GTCTGCAGTCAGCCTGCGGCAGG - Intronic
933422028 2:82061093-82061115 GAATTAAGTTAGCCTGAGGCTGG + Intergenic
934714508 2:96535964-96535986 GCATGAGTTCAGGCTGTGGGAGG - Intergenic
935185389 2:100727085-100727107 CCATGAAGGCAGGCTGTGGCTGG + Intergenic
935570750 2:104658595-104658617 TTATGAAGGCAGCCTGTGCCAGG + Intergenic
937077476 2:119117616-119117638 TCATGAAGTGAGCCTGGGGCTGG + Intergenic
939985320 2:148824496-148824518 GCTTGCAGACAGCCTGTTGCAGG + Intergenic
947665686 2:231904147-231904169 ACAGGATGTCAGCCTGGGGCTGG + Intergenic
948024285 2:234764767-234764789 GCATAAAGTCAACATTTGGCAGG + Intergenic
948872353 2:240809358-240809380 GCATGAAGTCGGGCTGTGCTGGG + Intronic
1170476825 20:16723206-16723228 GAATTCAGTCAGACTGTGGCAGG - Intergenic
1170536831 20:17348979-17349001 GCATGAAGACACCAAGTGGCTGG - Intronic
1172561694 20:35894515-35894537 GCATGCAGTGAGGCTGTGGGTGG + Intronic
1172615730 20:36282444-36282466 CCATAAAGTCTGCCTGGGGCTGG + Intergenic
1172757178 20:37293926-37293948 GCATGAAGTCAGGGTGTTCCAGG - Intronic
1175727820 20:61331658-61331680 GCAGGAGGTGAGCCTGGGGCAGG - Intronic
1179116532 21:38498498-38498520 AAATGAAGTCAGCCAATGGCAGG + Intronic
1179237708 21:39562340-39562362 GCATGAAATAAGCCTGTATCAGG + Intronic
1181675043 22:24445839-24445861 CCAGGAAGTCAGCATGAGGCTGG + Intergenic
1182598113 22:31437942-31437964 GCATGAAGTCAGTCTCTTCCTGG - Intronic
1183318103 22:37147998-37148020 GCATGGGGTCATCCTGAGGCTGG - Intronic
1183745217 22:39688036-39688058 GGAAGAACTCAGCTTGTGGCCGG + Exonic
1183822991 22:40362002-40362024 GAATGAAGTCAACATGTGCCAGG + Intronic
1184474314 22:44712315-44712337 GCTGGATCTCAGCCTGTGGCCGG + Intronic
949204346 3:1420306-1420328 CCATGGAGTCAGTTTGTGGCTGG + Intergenic
950007034 3:9698013-9698035 GTATGAAGGAGGCCTGTGGCTGG + Intronic
951593141 3:24288208-24288230 GGATGAAGACAGCCAGTGGCTGG + Intronic
952180804 3:30914515-30914537 GCATGTGGTTAGTCTGTGGCAGG - Intergenic
953278129 3:41524609-41524631 GCCTGAAGTCAGCCAGAGGCAGG + Intronic
953443430 3:42940689-42940711 GCATGAAGACAGGCTGCGGGTGG + Intronic
954907643 3:54076535-54076557 GCCTGAAATCAGCATGTGTCTGG - Intergenic
955128924 3:56143983-56144005 GCAAGAAGTCAGACTATGTCAGG + Intronic
956044035 3:65176178-65176200 GCAAGCAGCCAGCCTGTGGTAGG + Intergenic
961269875 3:125680654-125680676 TCATGGTGTCAGCCTGGGGCTGG - Intergenic
964728892 3:159844046-159844068 GCAGAAAGGCAGCCTCTGGCAGG - Intronic
965331489 3:167380053-167380075 GCACTATGTCAGCCTATGGCAGG + Intronic
967943045 3:194780908-194780930 GACTCAAGTCAGCTTGTGGCTGG - Intergenic
968926267 4:3550008-3550030 CCCTGAGGCCAGCCTGTGGCAGG + Intergenic
969219997 4:5753156-5753178 GCAGAAAGGCAGCCTGTGCCCGG - Intronic
969707161 4:8818316-8818338 GCCTCAATTCAGCCTGTGTCTGG + Intergenic
970015260 4:11505818-11505840 GCATTAAGTCATCCTTTGGCAGG + Intergenic
970529664 4:16968813-16968835 ACATGAATTCAGCCTGGGGGTGG - Intergenic
970919565 4:21377290-21377312 GCATGGAATCAGTATGTGGCAGG - Intronic
971117653 4:23666826-23666848 ACATTAAGTCAGCCTTAGGCAGG - Intergenic
976341473 4:83950205-83950227 GCATAAAGTCTCCCTGTGGGAGG - Intergenic
979279473 4:118849059-118849081 TCATGAAGTAAGTCTCTGGCAGG + Intergenic
981475233 4:145180612-145180634 GCAGGAAGTCGGCTTGCGGCGGG + Intergenic
983161153 4:164416644-164416666 GTATGAAGCCAGCATGTGGTTGG + Intergenic
986423033 5:7603162-7603184 GAATGAAGTCAGCCTCAGGAAGG - Intronic
986436860 5:7742716-7742738 GGAGGATGTCAGCTTGTGGCTGG + Intronic
986953636 5:13123128-13123150 GCTTAAAGTCTGCCTGTGCCTGG - Intergenic
989644278 5:43612577-43612599 GAATGGAGTCAGCATGTGGAGGG + Intronic
991024872 5:62018818-62018840 GCCTGGAGTCATCCTCTGGCAGG + Intergenic
993841414 5:92884556-92884578 GAATGAATTCAGACTGTAGCTGG - Intergenic
997417586 5:133740918-133740940 GTTTGAAGTCAGCCTCTGGATGG + Intergenic
997951462 5:138245902-138245924 GGATGAAGTGAGCCTGTGTCTGG - Intergenic
1000637931 5:163664735-163664757 GCATGAGGGCAGGCTGTGGTAGG + Intergenic
1001529378 5:172451726-172451748 GCATGAAGGCAGCTATTGGCAGG - Intronic
1001765140 5:174239878-174239900 GCATGAAATCATCATGTGTCAGG - Intronic
1004478932 6:16000585-16000607 GGATGCTGGCAGCCTGTGGCTGG - Intergenic
1006672754 6:35739751-35739773 TCCTGAAGTGAGCTTGTGGCAGG - Intronic
1007428088 6:41760021-41760043 GCATGAAGACCCCCTGAGGCTGG - Intergenic
1013598822 6:111685254-111685276 GCATGAAGTCAGACTGACACGGG - Intronic
1016439188 6:144065957-144065979 GCATGAAGTCAGGCTGGGCGCGG + Intergenic
1016936944 6:149454715-149454737 GCCTGATGACAGCCTGGGGCGGG - Intronic
1023122207 7:36921094-36921116 GCAGGAAGTGAGCCTTTGCCAGG + Intronic
1023623575 7:42095713-42095735 GCATGGATTCAGCCTGAGACAGG + Intronic
1024604059 7:51010579-51010601 GCATGATGACAACCTGTGCCAGG + Intergenic
1030249591 7:107427712-107427734 GCACCAGCTCAGCCTGTGGCTGG + Intronic
1031671063 7:124546333-124546355 GCTTCAAGTCAGTGTGTGGCAGG + Intergenic
1032789485 7:135232017-135232039 TCAAGAAATCAGGCTGTGGCAGG + Exonic
1033062606 7:138122772-138122794 GTATGTAGGCAGCCTGTGGGCGG + Intergenic
1033531565 7:142269302-142269324 GTATGAAGGCAGCCTGCGGGAGG - Intergenic
1033608049 7:142941786-142941808 GCACACAGTCAGCCTGTCGCAGG + Intronic
1036222609 8:6933434-6933456 GCACAAACTCAGTCTGTGGCCGG - Intergenic
1036223595 8:6940603-6940625 GCACAAACTCAGTCTGTGGCCGG - Intergenic
1037734477 8:21555474-21555496 GCCTGAACTAACCCTGTGGCCGG - Intergenic
1038021586 8:23555696-23555718 CCAGGAGGTCAGACTGTGGCTGG + Intronic
1038368706 8:26965386-26965408 GCATGAATGCAGCCTGAAGCAGG + Intergenic
1040889400 8:52300728-52300750 GCATGAAAGCAGCCAGTGACAGG - Intronic
1041219586 8:55635730-55635752 TCATGAAGACACCCTGAGGCCGG + Intergenic
1047398284 8:124523935-124523957 ATATGAAGTCAGACTGTGACTGG + Intronic
1048407776 8:134140553-134140575 GCATGGAGATAGCCAGTGGCAGG - Intergenic
1049630448 8:143651988-143652010 GCAGGAAGTCAGGCAGTGGGAGG - Exonic
1049635291 8:143684929-143684951 GCAGGAGCTCAGCCTGGGGCCGG - Intronic
1049758971 8:144323345-144323367 GCCTGAGGTGAGGCTGTGGCTGG - Intronic
1049908838 9:245651-245673 ACATGAAGCCAGCCTATGGTAGG - Intronic
1050333224 9:4566200-4566222 GCAGGAAGTAAACCTGTGACTGG + Intronic
1050388037 9:5111266-5111288 GCAGGAAGCCAGCCTGAGTCAGG - Intronic
1051338084 9:16085109-16085131 GCAGCATGTCAGCCTGTGCCAGG + Intergenic
1051518993 9:17962947-17962969 TCATGATGTCACCCTGTGTCAGG + Intergenic
1052976654 9:34415933-34415955 GCATGAAGTCAAGCTTTGGATGG - Intronic
1053801194 9:41765414-41765436 CCCTGAGGCCAGCCTGTGGCAGG + Intergenic
1054144007 9:61549423-61549445 CCCTGAGGCCAGCCTGTGGCAGG - Intergenic
1054189623 9:61977564-61977586 CCCTGAGGCCAGCCTGTGGCAGG + Intergenic
1054463782 9:65480779-65480801 CCCTGAGGCCAGCCTGTGGCAGG - Intergenic
1054648892 9:67611045-67611067 TCCTGAGGCCAGCCTGTGGCAGG - Intergenic
1054891537 9:70257583-70257605 GCATAATGTCAGACTGTGACAGG - Intergenic
1055065514 9:72114551-72114573 GCTTGCAGTCAGACTGAGGCGGG - Intergenic
1055791065 9:79923682-79923704 GCTTGCAGACAGCCTGTGGTGGG + Intergenic
1055828409 9:80354124-80354146 GAATGGAGTCAGCATGTGGGAGG - Intergenic
1056222444 9:84463580-84463602 GCTTGAAGACAGCCTGTCGTGGG + Intergenic
1056814288 9:89790312-89790334 TCATGACGACAACCTGTGGCGGG + Intergenic
1057541900 9:95982191-95982213 GCATGCTGTCAGCCTGGGGTGGG + Intronic
1057686541 9:97239665-97239687 GCATGAAGTTGGCCTGTGTATGG + Intergenic
1058935412 9:109765202-109765224 TGATGAAGTCAGTCTGAGGCAGG + Intronic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1059463389 9:114449670-114449692 GCAATCACTCAGCCTGTGGCAGG + Intronic
1060270250 9:122135093-122135115 CCATTCAGACAGCCTGTGGCTGG + Intergenic
1060783365 9:126430205-126430227 GAATGCAGTCAGGCTGTGGAGGG - Intronic
1060895579 9:127215167-127215189 CCATGAAGTCAGCTCTTGGCAGG - Intronic
1060988187 9:127832446-127832468 ACAGGAAGTCAGCCAGGGGCTGG + Intronic
1062576173 9:137209419-137209441 GCATTCAGTCAGCCAGTGGCAGG + Intronic
1186296221 X:8151385-8151407 GCAAGAGGTCAGCTGGTGGCTGG + Intergenic
1186552227 X:10518242-10518264 CCATGAAGTCAGCCTAAGTCAGG + Intronic
1187856876 X:23645289-23645311 GAAGGAAGTCAACCTGTGACAGG + Intergenic
1188984280 X:36755431-36755453 GATTGAAGCCAGCCTGAGGCAGG - Intergenic
1190496268 X:51031134-51031156 GCCTGAAGTCAGCAAGTGGTGGG + Intergenic
1191095390 X:56668428-56668450 GCTTGCAGACAGCCTGTGGTGGG - Intergenic
1197488672 X:127088355-127088377 GTATGTAGTCAGCCAGTGGTGGG + Intergenic