ID: 1119904443

View in Genome Browser
Species Human (GRCh38)
Location 14:78288792-78288814
Sequence CAAGCTATTCCATCTCTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119904443_1119904447 19 Left 1119904443 14:78288792-78288814 CCACTAAGAGATGGAATAGCTTG 0: 1
1: 0
2: 1
3: 10
4: 115
Right 1119904447 14:78288834-78288856 CTTTCCCCTACACTGTAGTTAGG 0: 1
1: 0
2: 0
3: 12
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119904443 Original CRISPR CAAGCTATTCCATCTCTTAG TGG (reversed) Intronic
908890903 1:68846542-68846564 GTAGCTATTCTTTCTCTTAGTGG - Intergenic
909345546 1:74581788-74581810 GAAGCTATCCACTCTCTTAGTGG - Intronic
909595392 1:77400319-77400341 CAAGTTATTTAATCTCTTTGAGG + Intronic
910051657 1:82981618-82981640 CTATTTATTCCATCTGTTAGGGG + Intergenic
913378185 1:118178507-118178529 CATCCTATTCCAGATCTTAGAGG - Intronic
917805981 1:178614108-178614130 CAAGCTATTCTTTGTCTCAGTGG + Intergenic
918456354 1:184721032-184721054 AAATCTATTACATCTCTTATTGG + Intronic
920550036 1:206852171-206852193 CATGGTGTTCCATATCTTAGGGG - Intergenic
920778197 1:208961563-208961585 CAAGCTATGCCATCTCTTGCTGG + Intergenic
921713720 1:218397806-218397828 CAAGCTAGTCCCCCTCCTAGAGG - Intronic
922022778 1:221720953-221720975 CAAGATGTTCTTTCTCTTAGAGG + Intronic
1062965577 10:1605203-1605225 CAAGCCATGCCTTCTCTTTGTGG + Intronic
1064543789 10:16431347-16431369 CCAGCAATTCCACTTCTTAGTGG - Intergenic
1065752515 10:28900017-28900039 CAAACCATTCCATCTCTTGGTGG + Intergenic
1067928094 10:50531331-50531353 AAAGCTATTCTATCTGTTCGAGG + Intronic
1069186784 10:65433011-65433033 CAATGTATGCCATCTCTTAAGGG + Intergenic
1070965069 10:80524928-80524950 CAAGCCTTTCCATCTCTGAGAGG + Exonic
1078566531 11:12418991-12419013 CAAGTTATTCAATCTCTTCATGG - Intronic
1079476144 11:20831474-20831496 GAAGCTCTTTCAGCTCTTAGTGG + Intronic
1081140060 11:39487555-39487577 GAAGTTACTCCATCTCATAGTGG + Intergenic
1086806259 11:91246698-91246720 CAAGCTATTAAATTTCTGAGTGG - Intergenic
1088872975 11:113908483-113908505 CAAGCTTTGCCAGCCCTTAGGGG - Intronic
1091257512 11:134202687-134202709 CCAGCTGTTTCAACTCTTAGGGG + Intronic
1093433081 12:19105760-19105782 CCAGCTCTGCCATTTCTTAGTGG + Intergenic
1095241454 12:39864585-39864607 CAAGCTATTCCTCTTCCTAGGGG + Intronic
1098630611 12:72717231-72717253 CAGGCTGTTCCATCTCTCAGGGG + Intergenic
1099622755 12:85025500-85025522 AAAGCTATTCCATGTCTTAAAGG - Intronic
1100000368 12:89827394-89827416 CCAACTATTCCATTTCCTAGTGG - Intergenic
1104332390 12:127859089-127859111 CAAGATATTTAATCTCTTTGAGG - Intergenic
1104384574 12:128339223-128339245 CAAGGGCTTCCAGCTCTTAGAGG + Intronic
1108735530 13:53279677-53279699 CAAGCTTTTCCATAGCTTACAGG + Intergenic
1113094237 13:106646766-106646788 CAAGGGTTTCCATCTCTTCGAGG + Intergenic
1115034613 14:28841880-28841902 CAAGTTATTCATTATCTTAGAGG - Intergenic
1119126179 14:72129490-72129512 CAAACTACTCCAACACTTAGTGG + Intronic
1119178548 14:72587940-72587962 CAAGCACTACCATCTCTTACTGG - Intergenic
1119527629 14:75334781-75334803 CAAGTGATGTCATCTCTTAGTGG - Intergenic
1119637719 14:76290370-76290392 CAGGCTTTTGCAGCTCTTAGAGG + Intergenic
1119904443 14:78288792-78288814 CAAGCTATTCCATCTCTTAGTGG - Intronic
1120215109 14:81673305-81673327 CAGGCTATGCAACCTCTTAGAGG + Intergenic
1124221912 15:27856621-27856643 GAAGCTGTTCCATCACTTGGAGG - Intronic
1126337636 15:47604395-47604417 TAAGCTATTTCATTTCTTAGGGG + Intronic
1126636618 15:50786266-50786288 CAACCTATTCTCTCTCTCAGTGG + Intergenic
1126960501 15:53988523-53988545 CAAGCTCTTGCATCTTTTGGGGG + Intergenic
1127479717 15:59367593-59367615 CAGGCTATTCCCTCTCTTTAGGG + Intronic
1129960983 15:79683781-79683803 CCAGCTATTCTTTTTCTTAGAGG - Intergenic
1131794195 15:95997339-95997361 AAAGCAATTCTATATCTTAGAGG + Intergenic
1131971390 15:97896948-97896970 CAAGTTATTCCATTCTTTAGTGG - Intergenic
1134217539 16:12327685-12327707 CAAGCAACTCCATCTATTATAGG - Intronic
1140338667 16:74136158-74136180 TAAACTATTCCACCTCTCAGAGG + Intergenic
1147000972 17:37361774-37361796 CAAGCTATTACGTCTGTAAGAGG + Intronic
1155596447 18:27493510-27493532 CGAGCTTTTCCATAGCTTAGTGG + Intergenic
1157269443 18:46260154-46260176 CAATTCATTCCATTTCTTAGTGG + Intronic
1158402638 18:57134635-57134657 CAAGCTCTCCCATCTCCTAGTGG - Intergenic
925242692 2:2346337-2346359 CAAGCTGTTCCATCTTTGGGTGG + Intergenic
925890584 2:8430935-8430957 AAAGCTTTTCCACCTCTTATGGG - Intergenic
926510991 2:13777868-13777890 CAAGCTATTCAGACTCTTAAAGG + Intergenic
927716238 2:25355175-25355197 CAAGTTAGCCCATATCTTAGCGG + Intergenic
929724597 2:44412111-44412133 CAAGCAGTTCCATCTCCTTGTGG - Intronic
931647680 2:64439808-64439830 CCAGCAATTTCACCTCTTAGTGG + Intergenic
931894515 2:66714072-66714094 CAAGCTATTCCTTTTCTTATGGG + Intergenic
932063946 2:68533449-68533471 CAAGCTACTCCAACTCTTAGTGG + Intronic
933263048 2:80151404-80151426 CAAGCTATTGCTTCTCTTTGAGG + Intronic
935236249 2:101140686-101140708 CAACCTCTTCCAACTCTTAATGG + Intronic
936677813 2:114735633-114735655 CAAGATATTTCACCTCTTTGAGG - Intronic
937302869 2:120853904-120853926 CAAGCTGCTCCATCTCATAGGGG - Intronic
937563836 2:123259473-123259495 CCAGCATTTCCATCTCTGAGTGG + Intergenic
940661978 2:156557629-156557651 CAAGCCATTCCAGCTCTCACTGG + Intronic
941155933 2:161978082-161978104 CAAGCTTTTCAATTTCTTACAGG - Intronic
944257049 2:197634088-197634110 CAAGTTACTCCATCTTCTAGTGG - Intronic
947929056 2:233948100-233948122 TAATCTATTCCCTGTCTTAGAGG - Intronic
1168948908 20:1783157-1783179 CCAGCCATCCCATCTCTTTGGGG + Intergenic
1169967046 20:11229508-11229530 AAAATTATTCCATCTCTTTGAGG + Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1172885185 20:38226235-38226257 CTAGTTCTTCCATGTCTTAGAGG - Intronic
1173009202 20:39166149-39166171 CCAGCCACTCCATCTCTCAGTGG - Intergenic
1179135628 21:38677888-38677910 CAAGCTATTCCTTATCTCCGTGG - Intergenic
1179842979 21:44089307-44089329 AAAGCTATTACATCCCTTAAGGG - Intronic
951580521 3:24157991-24158013 CAACGTATTCCCTTTCTTAGTGG - Intronic
952641465 3:35601739-35601761 CAAGAAATTCCATCTCTTGATGG + Intergenic
955347274 3:58170446-58170468 CACGCTCTCCCACCTCTTAGGGG + Intronic
958163919 3:89854529-89854551 CAAGTTATTTAATCTCTCAGTGG - Intergenic
963001502 3:140685838-140685860 CAAGCTTTTTCATCTATAAGTGG + Intronic
965388880 3:168080529-168080551 CAAGTCATTCCATCTCTTTAAGG + Intronic
968956878 4:3723999-3724021 CAAGCAATTACATCTTTTAAGGG - Intergenic
970961484 4:21876913-21876935 CAAGCCAGTCCATCTGCTAGTGG + Intronic
971104028 4:23501568-23501590 CAAACTATTTCAAATCTTAGTGG + Intergenic
978132585 4:105216764-105216786 AAAGCTAATTCATCTTTTAGCGG + Intronic
978143544 4:105345145-105345167 TAGGCTATTTCATCTCTTATGGG - Intergenic
978635511 4:110800534-110800556 CAAGTTATTACTTCTCTGAGTGG + Intergenic
979098122 4:116576429-116576451 CAACCCAATCCAGCTCTTAGGGG + Intergenic
984913435 4:184698282-184698304 CAAACTGTTTCATCTCTCAGTGG + Intronic
986779352 5:11049866-11049888 CAAGCAATTCGCTGTCTTAGTGG + Intronic
986837950 5:11662756-11662778 CAAACTGTCCCATCTCATAGAGG - Intronic
990451395 5:55934245-55934267 CAAGTTATTCAACCTCTTGGAGG + Intergenic
993150501 5:84155369-84155391 TAACCTGTTACATCTCTTAGGGG + Intronic
994841081 5:104925873-104925895 CAAACTATTCCAGAACTTAGTGG - Intergenic
998520200 5:142793442-142793464 CCATCTATTCCATCTCTCTGGGG - Intronic
999296729 5:150464419-150464441 CAAGCTAACCCATCTCTAACCGG + Intergenic
999381577 5:151124871-151124893 CACACTATGCCATCTCTTAATGG + Intronic
1000283375 5:159802478-159802500 AAAGCTATTCAACCTATTAGAGG + Intergenic
1000481479 5:161781131-161781153 TAAATTATTCCATCTCTGAGTGG - Intergenic
1000955109 5:167533952-167533974 CAAGCTATTGAACCTCTCAGAGG + Intronic
1005696408 6:28356373-28356395 CCAGCTTTTCCATCTCAGAGGGG + Intronic
1007132758 6:39491955-39491977 AAAGCTATTCCATTTTTGAGTGG + Intronic
1014720524 6:124912011-124912033 CAAGTGTTTCCATCTCTCAGGGG + Intergenic
1014941889 6:127450499-127450521 CCAGCTAATCCATATTTTAGAGG - Intronic
1016885514 6:148956109-148956131 CAAGCTGTTCAACCTCTTGGGGG + Intronic
1017233439 6:152096263-152096285 AAAGAGATTCCTTCTCTTAGTGG + Intronic
1018306183 6:162458578-162458600 CAAGCTGTCCCATCTCTGGGAGG - Intronic
1022520908 7:31006356-31006378 CAGGCTACTCCGTCTCTTGGAGG + Intergenic
1026092747 7:67315050-67315072 CAAACCATTCCAAGTCTTAGTGG - Intergenic
1026308169 7:69160592-69160614 CAAGCTCTTTCATTTCTCAGGGG + Intergenic
1029435482 7:100561914-100561936 CAGGCTTTTCCATCTCTTGAGGG + Intronic
1030833998 7:114260787-114260809 CAAGCTAGTGAATATCTTAGTGG + Intronic
1032321034 7:130886946-130886968 CAAGCTATTCAATCCTTTTGGGG + Intergenic
1039742916 8:40398455-40398477 CAAGCTTTTCCACCTCATGGGGG + Intergenic
1042631880 8:70826584-70826606 CAAGCTATTACAATTCTTAAAGG - Intergenic
1044245579 8:89940603-89940625 AAAGCTACTCCATCTACTAGAGG + Intronic
1048549850 8:135424220-135424242 CATGATATCCCAGCTCTTAGTGG - Intergenic
1055470224 9:76603405-76603427 CAAATTATTCCAAATCTTAGTGG + Intergenic
1056089190 9:83187710-83187732 CATGCTATTCAATCTCTTGAGGG + Intergenic
1057927967 9:99169884-99169906 CGAGTTATTCCATCTATCAGTGG + Intergenic
1058569681 9:106327302-106327324 GAAGCTATGTCATCTTTTAGTGG - Intergenic
1059023490 9:110600351-110600373 TAATCTATTCCATCTGTTTGAGG + Intergenic
1190468660 X:50752995-50753017 CAAGACACTCCATCTCTCAGAGG - Intronic
1194892049 X:99392296-99392318 ATAGCTACTCCATCTCTTTGTGG + Intergenic
1200978976 Y:9243992-9244014 CAAGCTAAACCTCCTCTTAGGGG - Intergenic