ID: 1119905827

View in Genome Browser
Species Human (GRCh38)
Location 14:78301129-78301151
Sequence TCCACATTAAATAAAATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 497}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119905827 Original CRISPR TCCACATTAAATAAAATTTC AGG (reversed) Intronic
904244285 1:29175393-29175415 TCCATCTCAAAAAAAATTTCCGG + Intronic
907171549 1:52470797-52470819 TCCAGGTAAGATAAAATTTCTGG - Intronic
908215997 1:61952593-61952615 TGCACATGAAAGAAAATTGCAGG - Intronic
908528833 1:65013609-65013631 ACCAAATTAAATGAAATTTGTGG - Intergenic
908679521 1:66644809-66644831 ACCACAGTAAATAATATTTAAGG + Intronic
908739432 1:67311655-67311677 AACACATTAAGTAAAATATCAGG + Intronic
909159152 1:72123056-72123078 TGCTCCCTAAATAAAATTTCTGG - Intronic
909216444 1:72896647-72896669 TTTCCATTAATTAAAATTTCAGG + Intergenic
909220601 1:72955775-72955797 CCCATTTTAAATAATATTTCAGG + Intergenic
909555078 1:76944536-76944558 GCCACATTAAACAAAAATCCCGG - Intronic
909738081 1:78991910-78991932 TACACATTAATTGAAATATCTGG - Intronic
909967841 1:81939468-81939490 TTCATACTAAATAAAATTTGTGG - Intronic
910134668 1:83953485-83953507 TCAATATTAAAGAAAATTTAGGG + Intronic
910318799 1:85920663-85920685 TCCACATTAAATGTAATGACTGG + Intronic
910670686 1:89769713-89769735 TCAACATTAAATAAAATTCAAGG + Intronic
911862152 1:102966144-102966166 TACTCACTAAATAAAACTTCTGG + Intronic
911954063 1:104214135-104214157 TCAACAATAAAAAAAATTACTGG + Intergenic
912109719 1:106326382-106326404 TCCACTTTAAGAAATATTTCAGG + Intergenic
914723673 1:150309598-150309620 ACTACATTAAAAAAATTTTCCGG - Intergenic
917586197 1:176429221-176429243 TGATCATTAAATTAAATTTCTGG + Intergenic
918588551 1:186215774-186215796 TCCACATTGAAAACAATTACTGG + Intergenic
919214079 1:194529246-194529268 AACACATTAATTAAAATTTCAGG + Intergenic
919511475 1:198470885-198470907 TCCACAATAAGTAAAAATACTGG - Intergenic
919605974 1:199684965-199684987 TCCACATTGCATAAAATTCTAGG - Intergenic
920064147 1:203253890-203253912 TCCCAAATAAATAAAATTTGAGG - Intronic
920898805 1:210086005-210086027 TCCCCAATAAAGAAAATTCCAGG - Intronic
920978419 1:210808262-210808284 TCAAGATTAAATTAATTTTCTGG - Intronic
921486148 1:215717967-215717989 TACACATAAATTAGAATTTCTGG - Intronic
921508371 1:216002566-216002588 GCCACATGGAATATAATTTCTGG - Intronic
921683715 1:218065309-218065331 TTCACTTTAGATAATATTTCTGG - Intergenic
921698140 1:218236021-218236043 ACAACAAAAAATAAAATTTCAGG + Intergenic
921710775 1:218370997-218371019 CCCACTTTAAAAAAACTTTCTGG + Intronic
921821627 1:219623314-219623336 TCCTGATAAGATAAAATTTCTGG + Intergenic
921870891 1:220138527-220138549 TACAAATTATATAAAATTACTGG - Intronic
922327113 1:224538248-224538270 TCCACTTTAATTAACATGTCTGG - Intronic
923329801 1:232912421-232912443 TCAAAATTATATAAAATTTTAGG - Intergenic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1062772773 10:116219-116241 TACACAGGTAATAAAATTTCTGG - Intergenic
1063521387 10:6744577-6744599 GGCAGATAAAATAAAATTTCAGG + Intergenic
1063649246 10:7917177-7917199 TAAACATTTGATAAAATTTCAGG + Intronic
1064211529 10:13364172-13364194 GCTACTTTAAAAAAAATTTCTGG + Intergenic
1064404456 10:15048787-15048809 TTTAAATTAAATAAACTTTCAGG - Intronic
1065829117 10:29598388-29598410 ACCACAATAAAAAAAATTTGAGG + Intronic
1065875200 10:29991793-29991815 GCCTCATTAAATCATATTTCTGG - Intergenic
1066065352 10:31757613-31757635 TCCACACTAATTGCAATTTCTGG + Intergenic
1068443582 10:57092173-57092195 TCTGTATTACATAAAATTTCTGG + Intergenic
1068682207 10:59832304-59832326 ACCACAATTAATAAAGTTTCAGG - Intronic
1069003247 10:63289695-63289717 TCCATATTACTTAAAGTTTCTGG + Intronic
1069141411 10:64830719-64830741 TACACATAAAATTAATTTTCTGG + Intergenic
1069247769 10:66229131-66229153 TCAACATTCAATAAAATCTTTGG - Intronic
1069342009 10:67422082-67422104 TCCACATTAAATGAAACTAAGGG + Intronic
1070464159 10:76703108-76703130 ACCACAATGAATAAAATTTCTGG + Intergenic
1070623529 10:78032342-78032364 TCCAGAGTAACTAAAATTACAGG - Intergenic
1072098449 10:92205950-92205972 TCCACATTTATTAAAATATTTGG + Intronic
1072369496 10:94750261-94750283 TACGCATAAAATAAAATATCAGG - Intronic
1073243507 10:102073633-102073655 TCTGCTTTAAATAAAAATTCAGG + Intergenic
1073795955 10:106988723-106988745 TCTACAATAAATAAAAAATCAGG + Intronic
1073837403 10:107460193-107460215 TCCTCTTTAAATAAAATGTACGG + Intergenic
1076146754 10:128128018-128128040 TCCACATTAACAAAAATTCCTGG + Intergenic
1078414161 11:11151479-11151501 TCGTCAGAAAATAAAATTTCTGG - Intergenic
1078642235 11:13107607-13107629 TCTACATCCGATAAAATTTCAGG + Intergenic
1078989631 11:16633320-16633342 GCAAAATTAAATTAAATTTCTGG + Intronic
1079028398 11:16966971-16966993 TACACATTAAATTACTTTTCAGG + Intronic
1079097101 11:17518001-17518023 TCCACATTATGTCAAAATTCAGG - Intronic
1079175517 11:18136853-18136875 TCCACCTGAGAGAAAATTTCAGG + Intronic
1079268338 11:18957341-18957363 TCCACCTGAGAGAAAATTTCAGG - Intergenic
1079848879 11:25504164-25504186 TCCACAAAAAATAAAATACCTGG - Intergenic
1079990086 11:27237551-27237573 CCCACATTAAATATACTTTTTGG - Intergenic
1080153733 11:29083371-29083393 TCCAAAGGAAATAAAATTTGGGG + Intergenic
1080329384 11:31117913-31117935 TCCCGATTAAATATAATTTTAGG - Intronic
1080610152 11:33896935-33896957 TCCAAATTAACGAACATTTCTGG - Intergenic
1081109708 11:39120188-39120210 TCCCTATTAAATATAAGTTCCGG + Intergenic
1081346320 11:41991483-41991505 TCCAAATTGAAAAAAATTACTGG - Intergenic
1082149352 11:48714897-48714919 TTCACATAAAAAAAGATTTCTGG - Intergenic
1083182892 11:60999388-60999410 CCCACATGAAAAAAAATCTCAGG + Intronic
1083627699 11:64080010-64080032 TCAAAATTAAATAAAATTCCAGG - Intronic
1084623591 11:70291233-70291255 TCCACCTTAAAAATAATTTGTGG + Intronic
1085077506 11:73604754-73604776 TACACATTAAATAAAGTTAAGGG + Intergenic
1085600120 11:77848108-77848130 CCCAAATTAAATATTATTTCTGG - Intronic
1085901524 11:80705563-80705585 CACACAATAAATAAAAGTTCAGG + Intergenic
1086045180 11:82524150-82524172 GCCATTTTACATAAAATTTCAGG - Intergenic
1086639283 11:89131355-89131377 TCTTCCTCAAATAAAATTTCAGG - Intergenic
1086660163 11:89406291-89406313 GCCACATTTATTAAAATTTGAGG + Intronic
1086809718 11:91293347-91293369 TCCACTTTATATATAATTGCAGG - Intergenic
1087490287 11:98817366-98817388 TTAACATTCAATAAAATGTCAGG + Intergenic
1087741684 11:101895303-101895325 CCCAAATTAAGTAAAATTTGAGG + Intronic
1087943174 11:104126070-104126092 TCCACATGAAAGGAAATGTCAGG - Intronic
1088584674 11:111352260-111352282 CCCACTTTAAATAAAAACTCTGG - Exonic
1089265034 11:117252818-117252840 AAAACATTAAAAAAAATTTCAGG - Intronic
1089592455 11:119552452-119552474 TCTACATTTAATTAAATTCCAGG + Intergenic
1089799910 11:121018727-121018749 TACACAATATATATAATTTCAGG + Intergenic
1091190478 11:133690629-133690651 TACACGTTCAATAACATTTCAGG + Intergenic
1091717605 12:2790763-2790785 TCTACAAAAAATAAAATTACTGG + Intergenic
1092131908 12:6118795-6118817 TCCACTTTAAATAAAATCTGGGG + Intronic
1092445582 12:8553661-8553683 TCCACAGAATAAAAAATTTCTGG - Intergenic
1092734025 12:11562410-11562432 TCTATTTAAAATAAAATTTCAGG - Intergenic
1093109295 12:15129946-15129968 TCCACATGAAATAAAAGTCTGGG + Intronic
1093337525 12:17924749-17924771 TCCAAATTAAAAAAAATGCCTGG + Intergenic
1094307344 12:29035646-29035668 TCCAAATTATTTATAATTTCTGG + Intergenic
1094660074 12:32461505-32461527 TTCACATTAAATAAACTACCTGG - Intronic
1095218725 12:39582155-39582177 TGCACATAAAAAAAAACTTCAGG - Intronic
1098424818 12:70350456-70350478 TCCATATTAACTTAAATTTTAGG - Intronic
1098504320 12:71231794-71231816 TCCAGATTAAATAACCTGTCTGG + Intronic
1099128646 12:78798786-78798808 TCCACTTAAAAAAAAATTTTTGG - Intergenic
1099607240 12:84819909-84819931 TGGACATTAAATGGAATTTCTGG - Intergenic
1101020874 12:100552755-100552777 TCTACAAAAAATAAAATGTCTGG + Intronic
1101395517 12:104343497-104343519 TCCACATTAAATAAAGTAAGAGG + Intronic
1101504399 12:105332294-105332316 TCCACATTAAAAAAAATTGTAGG + Intronic
1102649635 12:114430236-114430258 TCCACCTAAAATGAAATTGCAGG + Intergenic
1105043371 12:132979804-132979826 TCCAGAATAAATAATACTTCTGG - Intergenic
1105563801 13:21522922-21522944 TCCAGATTAAACATCATTTCTGG + Intronic
1106762726 13:32882820-32882842 TCCACAGTGAATAAAACCTCTGG + Intergenic
1108332016 13:49396405-49396427 ACCACATAAAAAAAAATTTCAGG + Intronic
1108747013 13:53406077-53406099 TTTAAATTAAATTAAATTTCTGG + Intergenic
1108875107 13:55037700-55037722 ACCAAGTTAAATAAAATTTTAGG + Intergenic
1109780046 13:67097701-67097723 TCTACACTAAAGAAAATTTATGG + Intronic
1110415633 13:75248972-75248994 TCCAGATTTCATAACATTTCTGG - Intergenic
1111613774 13:90639264-90639286 TAAAAATTAAATAAAGTTTCTGG + Intergenic
1113810636 13:113140545-113140567 TGCACATTTTCTAAAATTTCAGG + Intronic
1114359221 14:21951658-21951680 TTCACATGCAATAAAATTTTTGG + Intergenic
1114797187 14:25729532-25729554 ACAACATAAAAGAAAATTTCAGG - Intergenic
1114849172 14:26361994-26362016 TCTACATTAAGAAAAATGTCTGG - Intergenic
1115020559 14:28675100-28675122 TCTACTTTTCATAAAATTTCTGG + Intergenic
1116109284 14:40555828-40555850 TGAACTTTAAAAAAAATTTCAGG + Intergenic
1116581373 14:46646432-46646454 CCGACATTAAAAAAAAATTCTGG + Intergenic
1116916973 14:50534416-50534438 GGCTCATTAAATAAAATTTTTGG - Intronic
1117051528 14:51865198-51865220 TGCACATTAAATAAAATTAGGGG - Intronic
1117562452 14:56954929-56954951 TCCAAATTAACCAAACTTTCAGG + Intergenic
1118831632 14:69438899-69438921 TCTACATTAAATAAAATATAGGG + Intronic
1119058407 14:71447898-71447920 TGCACATTAAATGAATATTCTGG - Intronic
1119110947 14:71973382-71973404 TTAACATTAAATAAAATTCCTGG + Intronic
1119272064 14:73315645-73315667 TCCAATCTAAATTAAATTTCAGG - Intronic
1119905827 14:78301129-78301151 TCCACATTAAATAAAATTTCAGG - Intronic
1120269927 14:82298520-82298542 TGCACATTAACTAAAAGTTTTGG + Intergenic
1122403679 14:101483427-101483449 ACCATATTTAATAAAATGTCAGG + Intergenic
1125626307 15:41112064-41112086 TCTACAGAAAATAAAATTTTTGG - Intronic
1125818774 15:42609737-42609759 TTCACTTAAATTAAAATTTCAGG - Intronic
1126118931 15:45233882-45233904 TCCATTTTAAATAAAATTTCTGG + Intergenic
1126223941 15:46248000-46248022 TCAACTCTAAATAAAATTTGTGG + Intergenic
1126442681 15:48708192-48708214 AACAAATTAAATAAAATTGCAGG - Intergenic
1126628307 15:50707585-50707607 TTCACATTAAATAAAACATATGG - Exonic
1127493590 15:59488556-59488578 AACAAATTCAATAAAATTTCAGG + Intronic
1127759765 15:62127374-62127396 ACCACATTAAAAAAAATTAATGG + Intergenic
1128194989 15:65745303-65745325 TACACATAAAATAATATGTCTGG + Intronic
1128973095 15:72126320-72126342 TGCAGATAAAAGAAAATTTCCGG + Intronic
1129175178 15:73834839-73834861 TGCAAATTAAATATAAATTCAGG + Intergenic
1130356839 15:83140878-83140900 TCCACATCAAAGAATATTTTTGG + Intronic
1131083374 15:89555295-89555317 TCCAGTTTAATTAGAATTTCTGG + Intergenic
1131384319 15:91990705-91990727 TCCAAATTAGAGAAAATATCTGG - Intronic
1131402170 15:92133974-92133996 GCCACATTAAATATATCTTCAGG - Intronic
1134466031 16:14478480-14478502 TCCCCATTAAGTAAGATTTTAGG - Intronic
1135899138 16:26440298-26440320 ACCAGATTCCATAAAATTTCTGG + Intergenic
1137317386 16:47340085-47340107 TTTACATTATATAAAATTTTGGG - Intronic
1137485382 16:48886088-48886110 GCCACATTAGATTAGATTTCTGG + Intergenic
1137898681 16:52241064-52241086 TGCTCATTAAATAAAAATTGAGG - Intergenic
1139261105 16:65594697-65594719 TTCACAATAAAGATAATTTCTGG + Intergenic
1139500328 16:67358516-67358538 TCCACAAAAAATAAAATAGCTGG - Intronic
1139766274 16:69232831-69232853 TCCCCAGCAATTAAAATTTCAGG - Intronic
1140678555 16:77360475-77360497 TCCACAGTTGATAGAATTTCTGG + Intronic
1141027262 16:80560284-80560306 TTTTCATTAAATAAAATTTGTGG - Intergenic
1142439112 16:90082971-90082993 TCTAAATTAAAAAAAATTTTAGG + Intronic
1143072048 17:4304331-4304353 TCCACAGAAATTAAAATTTCAGG - Intronic
1144227710 17:13166895-13166917 TCAACATTAAAGATAATTTTAGG + Intergenic
1144319204 17:14097059-14097081 ACCAAATAAAATATAATTTCAGG + Intronic
1145313184 17:21711642-21711664 CCCACTTTAAAAAAAATTTAAGG - Intergenic
1146113017 17:30108822-30108844 TCCAGTTTTAATAAAATTTTGGG + Intergenic
1146463914 17:33070662-33070684 ACCACAATTAATACAATTTCTGG + Intronic
1147048090 17:37769632-37769654 TCCACATTAAATATCTTCTCTGG - Intergenic
1148626786 17:49075545-49075567 GCCACACTGAATAAAAGTTCAGG + Intergenic
1149024741 17:52014092-52014114 TCCATATTAAAAATAATATCAGG + Intronic
1149149688 17:53546007-53546029 TCAAGAATAAATAAAATTTCAGG - Intergenic
1149471224 17:56916658-56916680 TCAAAATTAAATAAAATCGCTGG - Intergenic
1149941779 17:60877842-60877864 TCCACACTAAATAGATTTTAAGG - Intronic
1150049303 17:61944180-61944202 TCCATATTAAATAACCTGTCAGG + Exonic
1150312770 17:64142681-64142703 TACAGATTCAATATAATTTCAGG + Intergenic
1150662842 17:67099862-67099884 TCTATTTTAATTAAAATTTCTGG - Intronic
1150804235 17:68306524-68306546 TCTACATTTAAAAAAATTTTTGG - Intronic
1151773773 17:76183641-76183663 TCCACATTAAAAAACATTTATGG + Intronic
1153195310 18:2589200-2589222 TCCACATTAAATAAATCCTCTGG - Exonic
1153579115 18:6553558-6553580 TACACATAAAATAAAGTTCCAGG - Intronic
1153861540 18:9215136-9215158 TCCACATTAAAAAACTGTTCAGG - Intronic
1154268899 18:12902245-12902267 TGCACATTAAACACTATTTCTGG + Intronic
1155753826 18:29464117-29464139 TCTATATGAAATAAAATTTGGGG - Intergenic
1155805807 18:30169882-30169904 TCCAGATTAAACATTATTTCTGG - Intergenic
1157849684 18:51036449-51036471 ACCCCATTAAATATTATTTCCGG - Intronic
1157943067 18:51950412-51950434 TGCAAATTAAGTAAAATGTCTGG + Intergenic
1158504268 18:58032231-58032253 TCCAAATGAAAGCAAATTTCTGG - Intergenic
1159302980 18:66600180-66600202 TCCACATAATTTAAAATTTTAGG - Intronic
1159812707 18:73035682-73035704 TCCACATTAAAAATAATTTCAGG + Intergenic
1160283326 18:77514213-77514235 TTCATATTATATAACATTTCAGG - Intergenic
1160469170 18:79112481-79112503 TCATCATTCAATAAAATTTTAGG - Intronic
1162613727 19:11778446-11778468 ACAAAATAAAATAAAATTTCTGG - Intronic
1164421991 19:28102182-28102204 TCCACATGACAGAAAATTTAGGG - Intergenic
1165478023 19:36043226-36043248 TCAAGACTAAATAAAATTCCAGG - Intronic
1165930484 19:39355244-39355266 TCCCCTTTAAAAAAAATTGCTGG + Intronic
1166145333 19:40830636-40830658 TCTACATTAAAAAAATTTTTGGG + Intronic
1167316035 19:48763271-48763293 TCTACAAAAATTAAAATTTCGGG + Intergenic
925897852 2:8487286-8487308 CCAACATTAAAAAAAATATCCGG - Intergenic
926874718 2:17462516-17462538 TACAGATTAAAAAAACTTTCAGG - Intergenic
929065371 2:37968055-37968077 TCTAGATGACATAAAATTTCAGG + Intronic
929360709 2:41086280-41086302 TCCAGATGACATAAAATGTCAGG + Intergenic
929864497 2:45706696-45706718 CCCACAATGAATTAAATTTCAGG + Intronic
930357216 2:50336152-50336174 TCCACTTAAAATAACATTACAGG - Intronic
930793951 2:55367904-55367926 TCCAAAATAAGTAATATTTCTGG + Intronic
930950626 2:57139812-57139834 TACACCTTCAATAAAATATCCGG - Intergenic
931013039 2:57940486-57940508 CCCAGATTAAATATTATTTCTGG - Intronic
931080598 2:58765565-58765587 TCTACATTAAAAAAAACTCCAGG - Intergenic
931090123 2:58876685-58876707 TCTACAAAAAATGAAATTTCTGG - Intergenic
931405395 2:61972214-61972236 TTCTCATTAAAGAAAATTTGGGG + Intronic
932865278 2:75335061-75335083 TCCAACTGAAATAGAATTTCTGG - Intergenic
933376482 2:81486484-81486506 TCAATATTAGATATAATTTCTGG - Intergenic
934812233 2:97289939-97289961 TCTACATAAAATAAAAGTACAGG + Intergenic
934825461 2:97417984-97418006 TCTACATAAAATAAAAGTACAGG - Intergenic
935074444 2:99727432-99727454 TTCACTTTACAGAAAATTTCAGG + Intronic
935099562 2:99980039-99980061 TTCACATTAAAAAAAATGGCTGG - Intronic
935760656 2:106317532-106317554 TACACATTAAATGAATTTGCGGG - Intergenic
937602211 2:123752108-123752130 TCCACCTCAAATTAAATTTGGGG - Intergenic
937630109 2:124091903-124091925 TACACATTACCTGAAATTTCTGG + Intronic
938602584 2:132857297-132857319 TCCACATTTAATACAATTTCTGG + Intronic
939162997 2:138611089-138611111 TCCAAATTAACTAAATTTTTAGG - Intergenic
939232839 2:139452778-139452800 TTCACAACAAAGAAAATTTCAGG - Intergenic
939615014 2:144352820-144352842 TACACATTAATTATTATTTCTGG + Intergenic
939818427 2:146925272-146925294 TTCACATTAAAAAAAATTTCTGG - Intergenic
941007952 2:160266740-160266762 CCCACCATAAACAAAATTTCCGG - Intronic
941087441 2:161134329-161134351 TCCCCATTTAATGAAACTTCTGG - Intergenic
941492996 2:166165415-166165437 TCCACATTAAACATTGTTTCTGG - Intergenic
943004271 2:182370465-182370487 TCATCCTTAAATAAAAGTTCAGG - Intronic
943030170 2:182676605-182676627 ACAACAGAAAATAAAATTTCAGG + Intergenic
943413312 2:187566188-187566210 TAGAAATAAAATAAAATTTCAGG + Intergenic
943816764 2:192267383-192267405 CCCACATTATATGGAATTTCAGG + Intergenic
943826114 2:192394695-192394717 TCCAAAATAAATATAATTTCAGG - Intergenic
943900496 2:193428157-193428179 TACATATTAAATATATTTTCAGG - Intergenic
943958679 2:194229986-194230008 TCTACCTTAAATAAAAATTAAGG - Intergenic
944655500 2:201873183-201873205 TCCACGTAGAATAAAATATCAGG + Intronic
945019127 2:205553463-205553485 TCTACATGAAATAGAAATTCTGG + Intronic
945633839 2:212321096-212321118 TCTACATTAAATAAAATTTGTGG + Intronic
945666545 2:212750985-212751007 TCTCCATAAAATAAAATTACAGG + Intergenic
945761253 2:213918219-213918241 ACAACAAAAAATAAAATTTCAGG - Intronic
946581499 2:221133044-221133066 TACACATTAAATGGCATTTCAGG - Intergenic
946959371 2:224967439-224967461 TCCATAATAAGTAAAATTTCAGG + Intronic
947050193 2:226033163-226033185 TCCAAATAAAATTAAATTTTTGG - Intergenic
947168277 2:227284676-227284698 TCCACATTAAAAAACTTTTCTGG + Intronic
947521005 2:230845978-230846000 TGCTCATTAAATGAAACTTCAGG + Intergenic
947789127 2:232852707-232852729 TCCAAATTGGAAAAAATTTCAGG - Intronic
1169596596 20:7206872-7206894 TGCACGATAAATAAAATTTGTGG + Intergenic
1170140570 20:13121815-13121837 TCCAAAAAAAATAAAATTTTGGG + Intronic
1170176565 20:13476535-13476557 TGCACAGTAAATAAAATATAAGG - Intronic
1171440689 20:25159637-25159659 TTGTCATTAAAAAAAATTTCAGG - Intergenic
1173487143 20:43449266-43449288 TTCAGATTAATTAACATTTCTGG + Intergenic
1173546927 20:43904788-43904810 ACAACATTAAATAAAGTTTGGGG + Intergenic
1173577059 20:44119187-44119209 ATCACATTAAACAAAATATCAGG + Intronic
1173955198 20:47026867-47026889 TTCACATTAAATAGAGTTTTAGG - Intronic
1174150066 20:48479671-48479693 TCCACACTATTGAAAATTTCAGG - Intergenic
1174814267 20:53673299-53673321 TCTCAATTAAATAATATTTCCGG - Intergenic
1175104488 20:56604845-56604867 TACACGTTAATAAAAATTTCTGG + Intergenic
1175858904 20:62138856-62138878 TCCACATAAATTAAAATTCTTGG - Intronic
1176641650 21:9310176-9310198 TAAAGATTATATAAAATTTCTGG + Intergenic
1176864956 21:14043551-14043573 TCAACTATAAATAAAATTTGTGG + Intergenic
1177625852 21:23658380-23658402 TCCAGATTAAATAATATATATGG - Intergenic
1177825381 21:26077102-26077124 TCCAGATTAAAACAAATGTCTGG + Intronic
1178282701 21:31297158-31297180 TTCACATTATATAAAATTAGAGG + Intronic
1178430177 21:32512040-32512062 TACCCTTTAAATAAAATTTTAGG + Intronic
1179238213 21:39565988-39566010 TCCAGTTGAAATAAAATTACAGG - Intronic
1180924275 22:19543009-19543031 ATCAGATTAAATAAAATTTAAGG - Intergenic
1181431390 22:22883901-22883923 CCCACAATGAACAAAATTTCAGG + Intronic
1181839559 22:25644952-25644974 TCCACAGAAAATAAAATAACTGG - Intronic
1182253962 22:29024778-29024800 TCCAGAAAAAATAAAATTTCAGG + Intronic
1183816941 22:40310035-40310057 TGCACTTTGAATAAAATTTTAGG - Intronic
1185008177 22:48298030-48298052 TCAACACCAAACAAAATTTCAGG - Intergenic
950983545 3:17334753-17334775 TCAACTTTAGATATAATTTCTGG + Intronic
951814918 3:26743714-26743736 ACCACAGTAAACAAAATGTCAGG - Intergenic
952547985 3:34443172-34443194 AACAAATTAAATAAAGTTTCAGG - Intergenic
952660635 3:35842356-35842378 GCCACATTAAATGAGATTTGGGG - Intergenic
952959697 3:38581530-38581552 TCCACATTCAATAAAATGAGGGG - Intronic
954904144 3:54045360-54045382 TCCACATTGAATTAAGCTTCTGG - Intergenic
955995883 3:64680275-64680297 TCCAAATTAAATAGCATCTCAGG - Intronic
956368045 3:68526942-68526964 TCCACTGTAAATAAACTTTAGGG + Intronic
956538263 3:70304265-70304287 TGGAAATTAAATAAAATTTCTGG - Intergenic
956801889 3:72766949-72766971 TTCAAATTAAATACAATTTAAGG - Intronic
957019924 3:75114558-75114580 TATACATTAAATAAATTTTAAGG + Intergenic
957097475 3:75789988-75790010 TACAAATAAAATAAAATATCTGG + Intergenic
957134028 3:76261918-76261940 TCCACATTATATACGATTTTTGG + Intronic
957416150 3:79908278-79908300 TCCATTTTTATTAAAATTTCAGG - Intergenic
957429946 3:80091141-80091163 GCCACATTTAATAAAATTATAGG + Intergenic
957451273 3:80385623-80385645 CCCAGATTAAATATCATTTCTGG - Intergenic
957833336 3:85552160-85552182 TCAGCCTTAAATAAAATGTCTGG - Intronic
958655124 3:96991567-96991589 TCCCCTATAAATAAACTTTCAGG - Intronic
958774433 3:98464648-98464670 TTCACATTTATTAAAATTTTGGG - Intergenic
958862394 3:99460059-99460081 TACAAATTAAATGAAGTTTCAGG + Intergenic
959100030 3:101999965-101999987 TCCATTTCAAATGAAATTTCTGG - Intergenic
959165370 3:102770604-102770626 GGCACATAAACTAAAATTTCTGG - Intergenic
959438084 3:106342175-106342197 TCCACATTGAAGAATAATTCTGG + Intergenic
959772281 3:110112745-110112767 TCTACATAAAATAACATTTAAGG - Intergenic
959914816 3:111805256-111805278 TCAACAATAAAAAAAATTACTGG + Intronic
961135531 3:124506522-124506544 TATACATTAACTAGAATTTCAGG + Intronic
961309498 3:125986330-125986352 TCTCCTTTAAAAAAAATTTCAGG + Intergenic
961996315 3:131247952-131247974 AACAAATTAAGTAAAATTTCAGG - Intronic
962133856 3:132711605-132711627 TTTACATTAAAGAAACTTTCTGG - Intronic
962416321 3:135185358-135185380 TCCACATTGAATAGAAGTTACGG + Intronic
962918041 3:139925384-139925406 TTCACATAAAATAAAATTTAAGG - Intergenic
963026891 3:140928549-140928571 ACCACAATAAAAAAAATTACAGG - Intergenic
963415574 3:144991812-144991834 TCAACATTTATTAGAATTTCTGG + Intergenic
963553028 3:146748700-146748722 GCCCTATAAAATAAAATTTCTGG - Intergenic
963973933 3:151460120-151460142 TTCAGCTTAAATAAAAGTTCTGG + Intergenic
964034476 3:152179229-152179251 TACATATGAAATATAATTTCAGG - Intergenic
964309100 3:155373391-155373413 TCTTCATTAAACAAAATCTCTGG + Intergenic
964505990 3:157399799-157399821 TCCACAAAAAAAAATATTTCAGG - Intronic
964740147 3:159956303-159956325 TCCACATTACAGAAGATTTGTGG + Intergenic
964929977 3:162006783-162006805 TCCACATTAATTAACGTTGCAGG + Intergenic
964941488 3:162161814-162161836 TCAACATTAAAAAAAAGTCCTGG - Intergenic
965107779 3:164380154-164380176 TGCACATTAAATAAATTTGTAGG - Intergenic
965444355 3:168756567-168756589 AACAAATTAAATAAAATTGCAGG - Intergenic
965848053 3:172987546-172987568 AAAACGTTAAATAAAATTTCAGG - Intronic
965954557 3:174352921-174352943 TAAAAAGTAAATAAAATTTCTGG - Intergenic
966560604 3:181315636-181315658 TAGACATTTAATAAAAATTCTGG + Intergenic
967139028 3:186537827-186537849 TCAAGATTAAATAAAATCTCAGG + Intergenic
967503845 3:190231017-190231039 TCCACATTAAACCATATATCTGG - Intergenic
1202745244 3_GL000221v1_random:94842-94864 TAAAGATTATATAAAATTTCTGG - Intergenic
970069731 4:12144078-12144100 TCCAAAATAAAGAAAATCTCAGG - Intergenic
970219189 4:13792330-13792352 TCAAATTTGAATAAAATTTCAGG + Intergenic
970352473 4:15216740-15216762 CCCAGATTAAATATTATTTCTGG - Intergenic
970671088 4:18397531-18397553 CCCTGATTAAATTAAATTTCAGG - Intergenic
970908258 4:21242468-21242490 TCCAGATTAAATGTCATTTCTGG + Intronic
970924753 4:21438655-21438677 TCCACATTAGTTTAAATATCTGG - Intronic
971116679 4:23654888-23654910 TCCAGTTTAAATATTATTTCTGG - Intergenic
971645962 4:29203537-29203559 TCTATATTAAATGAAATTACAGG - Intergenic
971647372 4:29226090-29226112 TCCAAAGTAAATATCATTTCAGG - Intergenic
971966914 4:33570740-33570762 ACTATAATAAATAAAATTTCAGG - Intergenic
974215000 4:58833345-58833367 GGAACATTACATAAAATTTCTGG - Intergenic
974476179 4:62384143-62384165 TCTTCAGTAAATAACATTTCAGG + Intergenic
974791780 4:66700369-66700391 TCAAAATTAAATAAAAGTTCAGG - Intergenic
974846360 4:67355139-67355161 CCCACATTAAACATTATTTCTGG - Intergenic
975690890 4:76962160-76962182 TCCACATTAAATAAACAAACTGG + Intronic
975943274 4:79673986-79674008 TACACAATAGATAAAATTTTTGG + Intergenic
976367774 4:84249038-84249060 TTCACATAAAATAAAGGTTCAGG - Intergenic
978276111 4:106952284-106952306 ACAGCATTAAATAAAACTTCTGG - Intronic
978975628 4:114866929-114866951 TCTACATCAAATGAAATTTCAGG - Intronic
978995032 4:115140131-115140153 TTCACATTCAATCACATTTCTGG - Intergenic
979055007 4:115982126-115982148 TCCACTTTACATGAAATTTGAGG - Intergenic
979063049 4:116091126-116091148 TTGACATTCAATAAAATTTTAGG + Intergenic
979900325 4:126207775-126207797 GCAACATCAAATAAAAGTTCTGG + Intergenic
979928229 4:126594908-126594930 TCCAGATTCATTAACATTTCCGG - Intergenic
980109239 4:128619159-128619181 AACACATTCAATAAAATTGCAGG + Intergenic
980697965 4:136384204-136384226 GCCACATAAAATAATATTTGAGG + Intergenic
980704528 4:136475707-136475729 TCCACATGACATAAATATTCAGG - Intergenic
980924779 4:139124280-139124302 TCCACAAAAAATAAAATTAGAGG + Intronic
981065722 4:140483176-140483198 TGCACATAAACTAAAGTTTCAGG + Intronic
981103612 4:140856518-140856540 TCCCAGTTAAATATAATTTCAGG - Intergenic
982449008 4:155529982-155530004 TCCAGATTAAAGAACATTTATGG - Intergenic
982467126 4:155745109-155745131 CCCAGATTAAATATTATTTCTGG - Intergenic
982491408 4:156034328-156034350 TCAATATTAAAAAAACTTTCTGG + Intergenic
982757572 4:159240631-159240653 TCCTCATTTAAAAAAATTTTAGG - Intronic
982945223 4:161613745-161613767 TACACATTGTGTAAAATTTCTGG + Intronic
983218611 4:165023495-165023517 TCCAGATTAAATATATCTTCTGG - Intergenic
983652533 4:170047662-170047684 ACCAAATTAAAAAAAATTTAGGG - Intergenic
983790920 4:171795843-171795865 TCTCCTTTAAAAAAAATTTCTGG - Intergenic
984174790 4:176403953-176403975 ATCACATTACATAAAATTTTTGG + Intergenic
985140525 4:186834951-186834973 TCAACGTTTAAAAAAATTTCTGG - Intergenic
986104725 5:4648918-4648940 AACACATTAAATAAATTTTGGGG + Intergenic
986596999 5:9433116-9433138 TCCACAATAAATTAAAATTGGGG + Intronic
986899844 5:12418059-12418081 TAAAAATAAAATAAAATTTCAGG + Intergenic
987215557 5:15733388-15733410 TTCACATTAAATATGATTTCTGG - Intronic
987903803 5:24050254-24050276 GCCACAATAACTAAAATTTCTGG + Intronic
988026586 5:25700996-25701018 TCCACATTTAAAAAAAATTGTGG + Intergenic
988418855 5:30980617-30980639 TCCAGCTTAACTAAAATTTTTGG + Intergenic
988787396 5:34577639-34577661 TCCAGATTAAATATTATTTCTGG + Intergenic
989283417 5:39670969-39670991 TTCCAAATAAATAAAATTTCTGG + Intergenic
989345877 5:40428906-40428928 TGAACATAAAATACAATTTCAGG - Intergenic
990083897 5:51951719-51951741 TGTTCATTAAATAAAATTTGGGG + Intergenic
990087211 5:51993576-51993598 TCGACATCTAATAACATTTCTGG - Intergenic
990129410 5:52562475-52562497 TTAAAAGTAAATAAAATTTCTGG + Intergenic
990795549 5:59535908-59535930 TTGACATTCAATAAAAATTCTGG + Intronic
990804056 5:59637858-59637880 TCCATATTAAATCATATTTATGG - Intronic
991238089 5:64422540-64422562 ACAACAATAAAGAAAATTTCAGG + Intergenic
991249373 5:64542939-64542961 TCCACAAGAAAGAAAATATCTGG - Intronic
991392572 5:66163097-66163119 TCTGCATGAAATAGAATTTCTGG - Intronic
991676059 5:69091018-69091040 TCCAAATAAAAAAAAAATTCAGG + Intergenic
992670149 5:79051800-79051822 TTCACATTAAATAATATATCTGG + Intronic
992936096 5:81706972-81706994 TTCTCATTTAAGAAAATTTCAGG + Intronic
993096709 5:83486857-83486879 TCCACATAAAACAGATTTTCTGG + Intronic
993403780 5:87486064-87486086 ACAACAAAAAATAAAATTTCAGG - Intergenic
993592136 5:89807208-89807230 CCCACATTTATTGAAATTTCAGG + Intergenic
993835462 5:92814493-92814515 TACAGATTAATAAAAATTTCTGG - Intergenic
994149627 5:96432831-96432853 TCCACTTTCAAGAAACTTTCTGG - Intronic
994677157 5:102837887-102837909 TCCACATAAAATAATTTTTAAGG - Intronic
995001318 5:107133826-107133848 GCCACATTAATTTTAATTTCTGG - Intergenic
995210948 5:109538498-109538520 TCACCATTAAATATAATTTTAGG - Intergenic
995230996 5:109763252-109763274 TCTATGTTAAATAAAATTTATGG - Intronic
995377764 5:111495565-111495587 TCCTCATTTAATAAAACATCTGG - Intergenic
995614295 5:113943528-113943550 TCCTTTTTAAAAAAAATTTCAGG + Intergenic
995638443 5:114223477-114223499 TTCACATTTAATAAAATTAATGG + Intergenic
995937704 5:117537026-117537048 TTCATATAAAATAAAATTTTGGG + Intergenic
996043497 5:118843462-118843484 TCCTCATTAAAATAAATTACGGG - Intronic
996600931 5:125263199-125263221 TCCAGAAGAAAAAAAATTTCAGG - Intergenic
997203203 5:132025329-132025351 TCTAAATTAAACAAAAGTTCAGG + Intergenic
999006530 5:147986244-147986266 TCCACATGAATTAAAATTCAGGG + Intergenic
999238080 5:150111794-150111816 TGAAAATAAAATAAAATTTCAGG + Intronic
999655608 5:153807729-153807751 TGCAAATTGAATAAAATCTCAGG + Intronic
999898238 5:156058393-156058415 TGCACATTAAATAAAGTTTAAGG - Intronic
1000480459 5:161767499-161767521 TCTACATAAAATTAAATTTAAGG + Intergenic
1000558366 5:162755146-162755168 TACAAATTAAATAGTATTTCTGG - Intergenic
1002544668 5:179932076-179932098 TTCACTTTAGTTAAAATTTCAGG + Intronic
1003859736 6:10311691-10311713 TCCATACAAAATGAAATTTCAGG + Intergenic
1005021016 6:21418771-21418793 CCCACATTAAATATTATTTCTGG - Intergenic
1005717303 6:28562472-28562494 TCCTCATGAAATTTAATTTCTGG - Intergenic
1005877066 6:30019064-30019086 TCCCCATTAAACAGAATTACTGG - Intergenic
1007050582 6:38824599-38824621 TCCACCTTAAGTAGATTTTCAGG + Intronic
1009425820 6:63512498-63512520 TCCCCATTAAATAAAAAGTGGGG - Intergenic
1010039428 6:71363643-71363665 TACACATTTAATAAAATTTCAGG + Intergenic
1010109132 6:72203714-72203736 TACACATTAAAATAAATTTGGGG - Intronic
1010300312 6:74252512-74252534 TACTCATTCAATAAAATTTAAGG - Intergenic
1010379741 6:75210395-75210417 TCCACATAAAATAACGTCTCAGG + Intergenic
1010667344 6:78646130-78646152 GACACAACAAATAAAATTTCAGG - Intergenic
1010772470 6:79847191-79847213 TCCACAAAAAATACATTTTCAGG - Intergenic
1010778588 6:79916543-79916565 CCCATATCATATAAAATTTCAGG - Exonic
1011002203 6:82603735-82603757 CCCAGATTAAATATTATTTCTGG - Intergenic
1011075900 6:83438193-83438215 TCCAAATTGAAAAAATTTTCAGG - Intergenic
1012097023 6:94975665-94975687 TCCACTTAAATTAATATTTCTGG - Intergenic
1012131988 6:95507152-95507174 TCCACAAAAAAGAAAATTACAGG + Intergenic
1012370853 6:98505216-98505238 TCCAAATTTAATAAAATATATGG - Intergenic
1012724043 6:102785522-102785544 TCAACATTAAAAAAATTATCTGG - Intergenic
1012737211 6:102963867-102963889 TACACATGAAATAAAACTTTAGG + Intergenic
1012865971 6:104618085-104618107 GCCAGATTCAATAAAAGTTCAGG + Intergenic
1013855612 6:114568506-114568528 GCAACAATAAATAAAATTGCTGG + Intergenic
1014091166 6:117404937-117404959 TTCACATTATAAAATATTTCAGG + Intronic
1014576896 6:123084496-123084518 TCCTGATTAAATTAACTTTCTGG - Intergenic
1014954990 6:127603741-127603763 TCCCCATCAAAGAAAAGTTCGGG - Intergenic
1015471474 6:133611414-133611436 TAAACAATAAATAAAATGTCAGG - Intergenic
1016180295 6:141137956-141137978 TAAACATTAATTAAAATTTGGGG + Intergenic
1016542383 6:145180023-145180045 ACTGCATTAAATAAAATTTCAGG + Intergenic
1016899961 6:149091728-149091750 AACACTTTAAATAAAATTTCAGG + Intergenic
1018211258 6:161484226-161484248 TTCAGCTTAAAGAAAATTTCTGG + Intronic
1018268322 6:162050169-162050191 TGCACATAAAATAGATTTTCAGG - Intronic
1018302756 6:162420668-162420690 ACTACATTAAATTAAAATTCAGG + Intronic
1019671331 7:2281257-2281279 TCTACAAAAAATAAAATTACGGG + Intronic
1020503532 7:8953968-8953990 TTAACACTAAATAAATTTTCTGG + Intergenic
1020591936 7:10150251-10150273 ACCAAAATAAATAAAATCTCAGG - Intergenic
1020626838 7:10591506-10591528 TGCACATTAAAAAAAATTGGAGG + Intergenic
1020631190 7:10641867-10641889 TCAGGATTTAATAAAATTTCAGG + Intergenic
1021017812 7:15557105-15557127 TCAGGATTACATAAAATTTCAGG - Intronic
1021291778 7:18854168-18854190 ATCACATTAAGGAAAATTTCTGG - Intronic
1021428745 7:20535458-20535480 ACCACATGAAAAAAAACTTCTGG - Intergenic
1021588064 7:22231263-22231285 GCCACATTAAAAAAAATATATGG - Intronic
1022145351 7:27533054-27533076 TCCATTTGAAATATAATTTCAGG + Intronic
1023061450 7:36331224-36331246 TCTTCATTACATAAAATGTCAGG + Intronic
1023263650 7:38382451-38382473 TCCACATTCAAGGACATTTCTGG + Intergenic
1024907400 7:54402606-54402628 TCCAAATTAAATAATACTTCTGG + Intergenic
1026767416 7:73169162-73169184 ACCACAATTAATAAAATTTGAGG + Intergenic
1026808753 7:73444653-73444675 TCCTCATTAAATACAATTTAGGG + Intronic
1027043883 7:74978864-74978886 ACCACAATTAATAAAATTTGAGG + Intronic
1027079762 7:75223488-75223510 ACCACAATTAATAAAATTTGAGG - Intergenic
1027570966 7:79866537-79866559 TCCAAATAATATAAAGTTTCAGG - Intergenic
1028579393 7:92390186-92390208 TCCACATTAAATAAAACAAGTGG - Intronic
1028789227 7:94834609-94834631 TTTACATTAAATAAAAAGTCTGG - Intergenic
1029655373 7:101920655-101920677 TGCAAATTAACTACAATTTCTGG - Intronic
1029819781 7:103135375-103135397 TTCACATTCAATAAGATTCCAGG + Intronic
1029910605 7:104142972-104142994 TTCCCATTCATTAAAATTTCAGG - Intronic
1029910794 7:104145171-104145193 TTCCCATTCATTAAAATTTCAGG - Intronic
1030456747 7:109784108-109784130 TCTGTATTAAATAAAATTTCTGG - Intergenic
1030551174 7:110961832-110961854 TTCCATTTAAATAAAATTTCTGG + Intronic
1031501806 7:122527153-122527175 TTCACATTAAGTTAAAATTCAGG - Intronic
1031663662 7:124458367-124458389 ACCATATTAAATAATATTTTTGG - Intergenic
1034065462 7:148132466-148132488 TCTACATTAAAATACATTTCAGG - Intronic
1035846655 8:2872964-2872986 GCCACATAAAATACAACTTCTGG + Intergenic
1037020651 8:13966184-13966206 TCCATATGAAATATTATTTCTGG - Intergenic
1037227684 8:16613160-16613182 TCAACATTAATTAATATTTGAGG - Intergenic
1037431827 8:18821444-18821466 TCCTCATGAAAAAAAATTACAGG + Intronic
1038868355 8:31464606-31464628 TTCACGTTAAATAAAATTTAAGG + Intergenic
1040956902 8:52988912-52988934 TCCACATTTAATAAAAGCTAAGG - Intergenic
1041036602 8:53797697-53797719 TCCACTTTAAACAAAATTAGTGG + Intronic
1041282766 8:56228265-56228287 TTTAGATTAAATAAAAGTTCTGG + Intergenic
1041332302 8:56739984-56740006 TCCACATGAAAGAAAACCTCAGG - Intergenic
1041695537 8:60732248-60732270 TCTACATTTTAAAAAATTTCTGG - Intronic
1041977438 8:63816198-63816220 TTCACATTAAATTAGCTTTCAGG + Intergenic
1042045613 8:64647851-64647873 CCCAGATTAAATATTATTTCTGG - Intronic
1042361083 8:67884048-67884070 TCCACGCTAAATAATACTTCAGG + Intergenic
1042539752 8:69896393-69896415 GCCACATTTAATCAAAGTTCTGG + Intergenic
1042969571 8:74393452-74393474 TGCACATTAAACAAAAATTTGGG - Intronic
1043025597 8:75064038-75064060 TCAACTTTGGATAAAATTTCTGG + Intergenic
1043359049 8:79449176-79449198 TCCCAATTAAAAAAAATTTCTGG + Intergenic
1043756691 8:84012298-84012320 TCCCCAGTCAGTAAAATTTCAGG + Intergenic
1044044604 8:87415428-87415450 TCACCAGTAGATAAAATTTCAGG - Intronic
1044418993 8:91969676-91969698 TACACATTAAATAGAAACTCTGG + Intronic
1044905549 8:96997571-96997593 TTGACATAAAAAAAAATTTCAGG + Intronic
1045134338 8:99197424-99197446 TCCCCATCAAAGAAAAGTTCTGG - Intronic
1045239923 8:100391271-100391293 TCCACCTTAAATACCAGTTCAGG + Intronic
1046301929 8:112305931-112305953 TCTAAAATACATAAAATTTCAGG + Intronic
1046419642 8:113963240-113963262 TTCACATTAAAAATAATTTATGG - Intergenic
1046529973 8:115431876-115431898 TCCAAATGGAATAAAATTTATGG - Intronic
1046598908 8:116295067-116295089 TTCATATTAGATAAAATTTAAGG - Intergenic
1047146010 8:122200106-122200128 GACACAACAAATAAAATTTCAGG + Intergenic
1048724866 8:137372137-137372159 TCTCCATTAAATAAACTTTGGGG + Intergenic
1050204817 9:3185526-3185548 ACCACATTAATTAGAATTGCTGG + Intergenic
1051002815 9:12305605-12305627 TTCATATCAAATAAAGTTTCTGG + Intergenic
1051094661 9:13452796-13452818 TGGACAATAATTAAAATTTCTGG - Intergenic
1051215115 9:14789205-14789227 TCCAATATAAATAATATTTCAGG + Intronic
1052122412 9:24734213-24734235 TCAACATTAAATAAACTTTTGGG + Intergenic
1052146807 9:25060588-25060610 TCTAGAGTAAAGAAAATTTCAGG - Intergenic
1052148743 9:25085090-25085112 TATACAATAAATAAAATTTTAGG + Intergenic
1052391337 9:27881886-27881908 CCCAGATTAAATATTATTTCTGG + Intergenic
1052558139 9:30047278-30047300 TGCAGATTAAATATTATTTCTGG - Intergenic
1053031921 9:34787688-34787710 CACACATTAAATCATATTTCTGG - Intergenic
1053611695 9:39720264-39720286 TCACCATTAAAAAAAATTTCTGG - Intergenic
1053869727 9:42478263-42478285 TCACCATTAAAAAAAATTTCTGG - Intergenic
1054086560 9:60750891-60750913 TCACCATTAAAAAAAATTTCTGG + Intergenic
1054241826 9:62622130-62622152 TCACCATTAAAAAAAATTTCTGG + Intergenic
1054555950 9:66656652-66656674 TCACCATTAAAAAAAATTTCTGG + Intergenic
1054742704 9:68824519-68824541 TGTTCATTAAAAAAAATTTCTGG - Intronic
1055307365 9:74943637-74943659 TGGACACTAAATAACATTTCAGG - Intergenic
1058203621 9:102073888-102073910 TACACATAAAATAATAATTCAGG + Intergenic
1058491818 9:105509601-105509623 TCCAAATCCAATCAAATTTCTGG - Intronic
1058614237 9:106808854-106808876 TACTCATTTTATAAAATTTCGGG + Intergenic
1058866278 9:109164940-109164962 TCCACATTCATAAAACTTTCTGG + Intronic
1058947430 9:109870799-109870821 TCCACATGATCTAAATTTTCTGG - Intronic
1059186404 9:112276395-112276417 TGCTAAATAAATAAAATTTCAGG + Intronic
1185706617 X:2272246-2272268 TTCACATCAAATAAAATATGAGG - Intronic
1185957648 X:4509506-4509528 TAAACATTAACTAATATTTCTGG + Intergenic
1185982497 X:4795125-4795147 TAAAAATAAAATAAAATTTCAGG - Intergenic
1186091381 X:6052449-6052471 TTCACATTACCTGAAATTTCAGG - Intronic
1187560351 X:20397205-20397227 TCCACTTTTAAAAAAAATTCTGG - Intergenic
1187614718 X:20980694-20980716 TTAACATCAAATAAAATTTGTGG + Intergenic
1188547574 X:31325979-31326001 TCCAAATTAGAAAGAATTTCTGG - Intronic
1188632242 X:32378380-32378402 GCCACACTAAATAATTTTTCTGG + Intronic
1188664518 X:32802921-32802943 GACACAATAAAAAAAATTTCAGG - Intronic
1188891255 X:35612691-35612713 TCCTTATTAAATAAAACTTGAGG - Intergenic
1188930198 X:36099709-36099731 ACAACATTAATTAAAATTTAAGG - Intronic
1189014341 X:37080108-37080130 TCAAAATTAAATAACAATTCAGG - Intergenic
1189604617 X:42662928-42662950 TCCAAATTAAATATTATCTCAGG - Intergenic
1191001743 X:55667002-55667024 TCATCATTTAATAAAGTTTCAGG + Intergenic
1191699215 X:64021463-64021485 TCCAAATTAAACACCATTTCTGG + Intergenic
1192078652 X:68025608-68025630 CCCACATTAAACATTATTTCTGG + Intergenic
1194064615 X:89246229-89246251 ACAACATGAAACAAAATTTCAGG - Intergenic
1194162342 X:90469177-90469199 TCTAAATAAAATAAAATTTTTGG - Intergenic
1195238574 X:102927564-102927586 TCCACTTTATATAAATTCTCAGG - Intergenic
1195263189 X:103154001-103154023 TTTCCATTAAATAAAATTCCAGG - Intergenic
1195428776 X:104764409-104764431 AACAAATTAAGTAAAATTTCAGG - Intronic
1195486943 X:105420024-105420046 TCCACATTAAAAAAAAATGTTGG + Intronic
1196059968 X:111397607-111397629 AAGACATTAAATAAAATTTGGGG - Intronic
1196280786 X:113821644-113821666 ACAACAAAAAATAAAATTTCAGG - Intergenic
1196748156 X:119090148-119090170 TGCACATGATATGAAATTTCAGG - Intronic
1197006512 X:121508251-121508273 TACACTTTAAATACAATTTTTGG + Intergenic
1197094587 X:122578024-122578046 ACAACAAAAAATAAAATTTCAGG + Intergenic
1197728727 X:129793268-129793290 TCCACTTGAATTAGAATTTCAGG + Intronic
1198874479 X:141208374-141208396 TTCACATTAAAGAAACTTTTGGG + Intergenic
1199104342 X:143844959-143844981 TCCACATTAAACATTCTTTCAGG - Intergenic
1200508622 Y:4046914-4046936 TCTAAATAAAATAAAATTTTTGG - Intergenic
1201260660 Y:12156013-12156035 TCAACATTAAAAAAAATGACTGG + Intergenic
1201745957 Y:17374090-17374112 TGAACATTAACTAATATTTCTGG + Intergenic