ID: 1119910457

View in Genome Browser
Species Human (GRCh38)
Location 14:78345145-78345167
Sequence GCCTGTGGCCCACACTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119910451_1119910457 -6 Left 1119910451 14:78345128-78345150 CCTGTGTGTGGGTACATGCCTGT 0: 1
1: 0
2: 32
3: 421
4: 1777
Right 1119910457 14:78345145-78345167 GCCTGTGGCCCACACTTGGGGGG 0: 1
1: 0
2: 0
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119910457 Original CRISPR GCCTGTGGCCCACACTTGGG GGG Intronic
900479129 1:2889763-2889785 GCCTGTGACCCATGCTTGGTGGG + Intergenic
900507032 1:3034885-3034907 GCCTGGGGCAGACACCTGGGTGG - Intergenic
901062277 1:6477246-6477268 GCCTGTGGCCCACACAGAGAAGG - Intronic
901089158 1:6629907-6629929 GCCCCTGGGCCACACTGGGGTGG - Intronic
901604471 1:10448587-10448609 GCCTATGACCCACAAGTGGGTGG + Intronic
901650334 1:10739432-10739454 GTGTGTGGCCCACACAAGGGCGG + Intronic
901687235 1:10949687-10949709 TCCTGCAGCCCACACCTGGGAGG + Exonic
902960619 1:19960702-19960724 GCCCTTGGCCCACACTTGCCTGG + Intergenic
904706521 1:32394895-32394917 GGCTGTGGCCCAGAGTTTGGAGG + Intergenic
904878081 1:33671805-33671827 GCCTGTGGGCAGCACTTGAGAGG - Intronic
905357804 1:37396816-37396838 GGCTGTGGCCCAGTCATGGGTGG - Intergenic
905397426 1:37675848-37675870 GCCTGTGACCCACACTTACAAGG - Intergenic
905708915 1:40084563-40084585 GCCTGCTGCCCACATTGGGGTGG - Intronic
906233478 1:44186555-44186577 GCCTGTAGTCCCCGCTTGGGAGG - Intergenic
908724408 1:67159634-67159656 GCTTGTGGTCCCTACTTGGGAGG + Intronic
911231221 1:95363455-95363477 CCATGTGGCCCACACCTGGCAGG - Intergenic
911450354 1:98053943-98053965 GTCTCTGGCCCAAACTCGGGAGG - Intergenic
912768736 1:112442245-112442267 GCCTGTAGTCCCCACTTGGGAGG - Intronic
917120124 1:171638351-171638373 TCCTATCACCCACACTTGGGAGG - Intronic
920585199 1:207152359-207152381 GCCTGTAGCAGTCACTTGGGAGG + Intergenic
922897621 1:229112743-229112765 GCCTGTAGCCCAGAATTGGTGGG - Intergenic
923144778 1:231190435-231190457 GGCTGTGGCCCAGAGCTGGGGGG - Intronic
923512448 1:234664171-234664193 GCCACTGGCCCACATTTGGGAGG + Intergenic
923740597 1:236651403-236651425 GCCTTTGGCCCACATTTGGCAGG + Intergenic
1067716526 10:48694871-48694893 GCTTATGGCCCAGACTGGGGAGG - Intronic
1070275084 10:74998208-74998230 ACCTGAATCCCACACTTGGGAGG - Intronic
1070300910 10:75202858-75202880 GCCTCTGTCCCACACTGGGAGGG - Intergenic
1070664325 10:78332784-78332806 GCCTGTGACCCATGCATGGGAGG - Intergenic
1072050777 10:91700991-91701013 CCCTGGGACCCACACCTGGGAGG + Intergenic
1073302445 10:102479394-102479416 TGCTGTGGCCCACACCTGGCAGG + Exonic
1073478189 10:103768005-103768027 GCCTGAGGCCCAACCTTGAGAGG - Intronic
1075533281 10:123248563-123248585 ACCTGTTGCCCTCAATTGGGAGG + Intergenic
1076825946 10:132968265-132968287 GCATGATGCCCACACTGGGGAGG - Intergenic
1077133537 11:987085-987107 GCCTGTCACCTACTCTTGGGAGG + Intronic
1077340214 11:2023100-2023122 GCCTGTGGCCCACGCTCAGAGGG - Intergenic
1078372271 11:10758361-10758383 GATTGTGGCTCACACTAGGGAGG + Intronic
1078618507 11:12886551-12886573 TCATGGAGCCCACACTTGGGTGG + Intronic
1080443821 11:32318832-32318854 GCATGTGGCTCAGACTTGGATGG + Intergenic
1083417658 11:62535954-62535976 CCCTGCGGCCCGCACTGGGGTGG - Exonic
1083712060 11:64555676-64555698 CCCTCTGGTCCACACTTGGTGGG + Exonic
1083791336 11:64988248-64988270 GCCTGGGGGCCACACAGGGGTGG + Exonic
1084540061 11:69780844-69780866 GCCTGTCGCCCAGACCTGGCTGG - Intergenic
1084640507 11:70423200-70423222 GCCTGGGGCCCCCAGTTAGGAGG - Intronic
1084706245 11:70817470-70817492 GGCAGTGGCCCACAGTTAGGGGG + Intronic
1085089018 11:73693754-73693776 GCCTGTAGTCCCTACTTGGGAGG + Intronic
1086795248 11:91093043-91093065 GCGCGTGGCTCACACCTGGGAGG - Intergenic
1088598618 11:111457259-111457281 GGCAGTGGCTCACTCTTGGGAGG + Intronic
1089004791 11:115082338-115082360 CCTGGTGGCCCCCACTTGGGTGG + Intergenic
1202823199 11_KI270721v1_random:78289-78311 GCCTGTGGCCCACGCTCAGAGGG - Intergenic
1091879345 12:3964356-3964378 GGCTGTGGCCCACACTGAGACGG + Intergenic
1092915153 12:13182899-13182921 CCCTGTCCACCACACTTGGGAGG + Intergenic
1094135612 12:27122314-27122336 GTCTGTGGACCACACTTTGAGGG + Intergenic
1096785246 12:54013588-54013610 GCCAATGGCCCACACTATGGGGG - Intronic
1098381969 12:69879210-69879232 CCCTGAGGCCCACAGCTGGGAGG + Intronic
1098970945 12:76856434-76856456 GGCTTTGGGCCAGACTTGGGAGG - Intergenic
1100871003 12:98910017-98910039 GCCTGTGGGCCACAGTTAGCTGG + Intronic
1101837035 12:108303020-108303042 GCCTGGGGCTCATGCTTGGGTGG + Intronic
1102059541 12:109922435-109922457 GCCTGTGGCCCACACTGGCCCGG + Intronic
1102443162 12:112978876-112978898 GTGCGAGGCCCACACTTGGGTGG + Intronic
1103509110 12:121462100-121462122 GCCTGTGGCCTTCCCTTGTGGGG - Intronic
1103939728 12:124495212-124495234 GCCTGTGGCACAGACGTGGAGGG - Exonic
1104923324 12:132302677-132302699 GCCTCTGACCCACACCTGCGTGG - Intronic
1105541333 13:21319761-21319783 GCCTGTGGCCCGCACCTGGCAGG - Intergenic
1107021316 13:35755384-35755406 GCCTGTGACACAGACTTAGGAGG + Intergenic
1107801152 13:44109089-44109111 GATTCTGGCCCAGACTTGGGTGG - Intergenic
1108168870 13:47720797-47720819 GCCTGTGGACCACATTTTGAAGG + Intergenic
1111525794 13:89467262-89467284 GCCTGTGACACAGCCTTGGGAGG + Intergenic
1114555623 14:23560655-23560677 ACCTGAGGCCCGGACTTGGGAGG + Intronic
1118355701 14:65011776-65011798 GGCTGTGGGTCACACGTGGGAGG + Intronic
1119678224 14:76572354-76572376 GGCTGTGCCCCACACAGGGGAGG - Intergenic
1119910457 14:78345145-78345167 GCCTGTGGCCCACACTTGGGGGG + Intronic
1121340066 14:93099817-93099839 GCCTGGGGCTCAGACTTGTGGGG + Intronic
1122650148 14:103221605-103221627 GCCCGTGGTCCTCATTTGGGTGG - Intergenic
1122921693 14:104882934-104882956 GCCTGTCTCCCCCTCTTGGGTGG + Intronic
1122923973 14:104891443-104891465 GAGAGTGGCCCACACTGGGGTGG + Intronic
1128552858 15:68609483-68609505 GCCTCTGTCCCAGACTTGGGTGG + Intronic
1129591211 15:76916556-76916578 GCCCCTGGCTCACACTTGGCAGG + Intergenic
1129658198 15:77538646-77538668 GCATCTGGCCCAGGCTTGGGAGG + Intergenic
1132598011 16:762009-762031 GCCTGTGGGCCACTGTGGGGTGG - Intronic
1133225691 16:4339233-4339255 GCCTGGGGCCCTCACAGGGGTGG - Exonic
1137394054 16:48104722-48104744 GGGTGGGGCCCACACTTTGGAGG - Intronic
1138511249 16:57509696-57509718 GCCTGTGTCCCACCCCAGGGAGG + Intergenic
1139382009 16:66538440-66538462 GCCTGTGACCCAGACTCTGGTGG - Intronic
1141765006 16:86052333-86052355 ACCTGTGGGCCACACAGGGGCGG - Intergenic
1142416800 16:89947716-89947738 GTGTGTGGCTCCCACTTGGGAGG + Intergenic
1142441858 16:90103633-90103655 GCCTGTGGCCCAGACCCAGGAGG - Intergenic
1142468091 17:147340-147362 GCCTGTGGCCCCCACACTGGGGG - Exonic
1142482125 17:225581-225603 GCCTGTGGCTCACACTTCCCGGG + Intronic
1142550342 17:734430-734452 GCCTGTAGTCCAAGCTTGGGAGG - Intronic
1142593818 17:1019951-1019973 GCCTGTGGCCCACCTTGGGGAGG - Intronic
1144952377 17:19001193-19001215 ACCTGTGGCCCAGGCTTGTGTGG - Intronic
1145903861 17:28506007-28506029 GCCTGTGCCCCACCTGTGGGTGG + Intronic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1150392756 17:64799745-64799767 GCCTGTGGCCCATCAGTGGGAGG + Intergenic
1151112430 17:71694552-71694574 CCCTGTTGCCCTCACTTGTGCGG - Intergenic
1155131833 18:22943177-22943199 CACAGTGGCACACACTTGGGAGG + Intronic
1157391692 18:47308684-47308706 GACTGTGGCCCACAATTGAGAGG + Intergenic
1160610629 18:80082226-80082248 GCCTGTGGCTGACTCTGGGGTGG + Intronic
1160739456 19:679294-679316 GCATGTGGGCCGCACCTGGGCGG - Intronic
1160930250 19:1566962-1566984 GCCTGGGGCCCTGACTGGGGTGG - Intronic
1162921687 19:13906648-13906670 GCCAGTAGGCCACACTTGGGTGG - Intronic
1163260937 19:16189576-16189598 GACTGTGGCCCACTCTTTGGTGG - Intronic
1163366598 19:16879101-16879123 TCCTGAGGCCCACACTTTGGAGG + Exonic
1165692449 19:37874095-37874117 ACTTGTGGCCAGCACTTGGGAGG + Intergenic
1165740008 19:38199383-38199405 TCCTGTGGCCCACGGTTGCGGGG - Intronic
1165802020 19:38558187-38558209 GCCTGTGGTCCCAACTTGGAAGG + Intronic
1167825482 19:51969086-51969108 GGCTGTGGACTTCACTTGGGAGG - Exonic
1168020010 19:53602317-53602339 GCCTGTAGTCCCTACTTGGGAGG - Intronic
925411982 2:3645048-3645070 GCCTGTGACCCACAGCTGGTGGG - Intergenic
928899123 2:36298915-36298937 GCCTGTAGTCCCTACTTGGGAGG + Intergenic
932420603 2:71599200-71599222 GCCTGTGGCACAGAGTTGAGAGG - Intronic
933622424 2:84558301-84558323 GCCTGTAGTCCCAACTTGGGAGG + Intronic
934602424 2:95667821-95667843 GCCTGTCCCCCACATTTGGCTGG - Intergenic
936535793 2:113309975-113309997 GCCTGTCCCCCACATTTGGCTGG - Intergenic
936863310 2:117047825-117047847 GCCTGAGGCCCTAACTGGGGAGG + Intergenic
937228304 2:120382409-120382431 GTCTGGGGTCCACACTTGGAGGG - Intergenic
938207930 2:129439587-129439609 GCCCATGGCCCACACTGAGGAGG - Intergenic
938489295 2:131753631-131753653 GCCTGAGGCGCACCCTGGGGTGG - Intronic
943334688 2:186599627-186599649 GCCTGTGGTCCCAACTTTGGGGG - Intronic
945065387 2:205943893-205943915 GCCTTAGGCTCACACTTGTGGGG - Intergenic
946339428 2:219058406-219058428 GCATGTGGCCCCCCATTGGGCGG - Intronic
947466046 2:230347513-230347535 GGCTGTGCCCCTCAGTTGGGAGG + Intronic
1169704583 20:8487895-8487917 GCCTGTGTGCCACCCCTGGGAGG - Intronic
1169871141 20:10249632-10249654 GTCTGTGGCCCACACTGAGCAGG - Intronic
1171750291 20:29042748-29042770 GGCTGTGGCCCAAACTCGTGTGG + Intergenic
1171998844 20:31755505-31755527 CGCGGTGGCTCACACTTGGGAGG + Intronic
1172083446 20:32359402-32359424 TCCTGTGGGCGACACCTGGGAGG + Intronic
1173128340 20:40362029-40362051 GCCTCTCGCCCACATTGGGGAGG - Intergenic
1173353167 20:42263330-42263352 GCCTGTGGCCCTAACTGAGGTGG - Intronic
1174143263 20:48432012-48432034 GCCCCTGGCCCACAGTTGGAGGG + Intergenic
1175978742 20:62726571-62726593 GCCTGTGGCCCCTGCCTGGGAGG + Intronic
1177148316 21:17430061-17430083 GCGTGTGTCCCAGAGTTGGGTGG - Intergenic
950948653 3:16976813-16976835 TCCATTGGCCCACACTAGGGTGG + Intronic
951629244 3:24700286-24700308 GCCTGTGGGCCACAGTTTGGAGG - Intergenic
951639116 3:24814182-24814204 GCCTGTGGCCAACATCTTGGTGG + Intergenic
952725667 3:36581997-36582019 CCCTGTGGCCCACAGTGGTGAGG - Intergenic
953608685 3:44429203-44429225 ACCTGTGGCCCACGCTTTCGGGG - Intergenic
954693178 3:52406639-52406661 GCCTGTGGCCTGCTCCTGGGTGG - Intronic
954809001 3:53236478-53236500 GCCTCAGGCCCACACTTCAGAGG + Intronic
956018618 3:64910391-64910413 GCCTGTGGCTTATGCTTGGGTGG + Intergenic
962998631 3:140655752-140655774 GGCTGTGTGCCACACCTGGGTGG - Intergenic
966849929 3:184158209-184158231 GCCTGTAGTCCCAACTTGGGAGG + Intronic
966917620 3:184593625-184593647 GCCTGGGTCACACACTGGGGAGG + Intronic
967822390 3:193850125-193850147 GACTGTGGCCCACGCATGTGGGG - Intergenic
968362123 3:198154600-198154622 GCCTGTGGCCCAGACCCAGGAGG - Intergenic
969196089 4:5565186-5565208 GCCTGTGGGCCAGGCTGGGGAGG - Intronic
969622775 4:8287023-8287045 GCATGTGGCCCACAGTGGGTGGG + Intronic
977215751 4:94281915-94281937 GCCTGTGGTCCCAACTAGGGAGG + Intronic
979962517 4:127037273-127037295 GACTGTGGCCAACACATGGCTGG - Intergenic
982574449 4:157091630-157091652 GGCTGTGGACCACACTTTGAGGG + Intronic
985926686 5:3024768-3024790 GCATGTGGTTCATACTTGGGAGG + Intergenic
997651083 5:135521400-135521422 GCCTGTAGTCCTTACTTGGGAGG - Intergenic
1000976250 5:167767799-167767821 GTCTGTAGACCACACTTGTGGGG + Intronic
1001210365 5:169805520-169805542 GCCAGTGGCCCCCAGTTTGGGGG + Intronic
1001398594 5:171433514-171433536 TCCTGAGGCCCACACCTGGTGGG - Intronic
1002181563 5:177433543-177433565 ACCTGTGGCCCGCACCTGGCAGG - Exonic
1006024950 6:31140750-31140772 GACTGTGGGCAACACGTGGGAGG + Intergenic
1006729411 6:36225180-36225202 GCCTGTGGCCTCCACTTGACTGG - Intronic
1006854941 6:37126122-37126144 GCCAGCAGCCCCCACTTGGGCGG - Intergenic
1012718461 6:102707848-102707870 GCCTTTTGCCTACACTTGGAAGG + Intergenic
1012918354 6:105195410-105195432 GCTTGTGGTCCCTACTTGGGAGG + Intergenic
1016211186 6:141535695-141535717 GCCAGTTGGCCACACTTGTGTGG + Intergenic
1016306850 6:142693778-142693800 GCTTGTTGCCAACACTTGGTGGG - Intergenic
1019253557 7:34107-34129 GCCTGTGGCCCAGACCCAGGAGG + Intergenic
1019538257 7:1539870-1539892 GCCTGGGACCGACACTGGGGTGG - Intronic
1019584121 7:1787457-1787479 GCCTGGGGACCACACTGGGAAGG - Intergenic
1019724448 7:2593414-2593436 GGATGTGGCCCACACCTGGGTGG - Intronic
1019786378 7:2980076-2980098 GCCCGTGGCCCCCAGCTGGGTGG - Intronic
1022972286 7:35529344-35529366 TCCTGTGTCTCACACTTGGGAGG - Intergenic
1023765944 7:43510884-43510906 TACTGTGGCCCACACTTGGCTGG + Intronic
1023999333 7:45180519-45180541 GCCTGTGGCCTTCCCTGGGGAGG + Intronic
1024064629 7:45722090-45722112 GCCTGGGGCCCAGAGTTGGGTGG - Exonic
1032218673 7:129977600-129977622 GCCTGTGTACCACACTGGGAGGG - Intergenic
1032633633 7:133682023-133682045 GCCTGTGGTCCCAGCTTGGGAGG - Intronic
1035332834 7:158107519-158107541 CCCTGTGGCTCACAATGGGGAGG - Intronic
1036218699 8:6902553-6902575 GACTCAGGCCCACACGTGGGAGG - Intergenic
1037064718 8:14563570-14563592 ACCTGTGGCACACATTTAGGTGG - Intronic
1037662894 8:20942258-20942280 TGCTGTGGCCTACACTTTGGGGG - Intergenic
1038135352 8:24779896-24779918 GCCTGTAGCCCATCCTTGGAGGG + Intergenic
1043237023 8:77880456-77880478 TGCTTTGGCCCACACTTGGTGGG + Intergenic
1043430307 8:80187820-80187842 GCCTGTGATCCCTACTTGGGAGG + Intronic
1044110288 8:88264603-88264625 GCATGTGCCCGACACTTAGGAGG - Intronic
1048958516 8:139556582-139556604 ACCTCTGGCCCAGACTTGGTTGG - Intergenic
1049257059 8:141619799-141619821 GGCTCTGGCCCTCTCTTGGGAGG - Intergenic
1049453536 8:142675441-142675463 GCCTGTGGGCCCCAGCTGGGTGG + Intronic
1049689997 8:143954141-143954163 GCCTGTGGGACACACGTGCGAGG + Intronic
1051937386 9:22459512-22459534 GACTGTGGCACAAACTTTGGTGG + Intergenic
1052269660 9:26614358-26614380 GCTTGCCGCCCACACTTGGCAGG + Intergenic
1057390525 9:94638809-94638831 GCCAGGTGCCCACACTTGGCCGG + Intronic
1059974296 9:119699266-119699288 GCCTGTGGGCCAGACCTGGCTGG - Intergenic
1061912513 9:133732539-133732561 GCTTCTGGCCCACACTCGGCGGG - Exonic
1062435554 9:136545287-136545309 GCCTCTGGCCCACGCCGGGGCGG - Intronic
1062702957 9:137917598-137917620 GCCTGTGGTGGACCCTTGGGTGG - Intronic
1062746810 9:138218262-138218284 GCCTGTGGCCCAGACCCAGGAGG - Intergenic
1203771361 EBV:51490-51512 GTCCGTGCCCCACCCTTGGGGGG + Intergenic
1195399668 X:104447844-104447866 CCCTGAGGCCCACACTTTGAAGG - Intergenic
1197562966 X:128047254-128047276 GTCTGTGGCCACCACTTGAGTGG - Intergenic
1197755069 X:129987683-129987705 GCCTGTGGGCCAGAATTGGAGGG + Intronic
1199034608 X:143034831-143034853 CCCAGTGCCCCACACTTGGTAGG - Intergenic
1199073713 X:143507850-143507872 CCCAGTGCCCCACACTTGGTAGG + Intergenic
1200058582 X:153474087-153474109 GCCTGTGGCCCTAACTCTGGAGG + Intronic