ID: 1119913064

View in Genome Browser
Species Human (GRCh38)
Location 14:78368803-78368825
Sequence ATGGATTTATGAGGTTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 307}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119913064 Original CRISPR ATGGATTTATGAGGTTTTAA GGG Intronic
901360904 1:8699494-8699516 ATGGATTAATTAGATTTTAGAGG + Intronic
902317873 1:15637090-15637112 ATTGATTCATGCTGTTTTAAGGG + Intronic
904466108 1:30708340-30708362 GTGGAATTATGTGGTTTGAATGG - Intergenic
906624076 1:47310697-47310719 ATGGTTTTATGAGGGTTGTAAGG - Intronic
908206428 1:61855057-61855079 CTGGATTTGTGTGGTTTTATAGG + Intronic
910308772 1:85798925-85798947 ATGGATTTATGATATTTGCAAGG + Intronic
910413206 1:86967960-86967982 ATTGTTTTATGACTTTTTAATGG + Intronic
910839168 1:91545659-91545681 GTGGGTTTATGGGGTTTTAGAGG - Intergenic
911059522 1:93735682-93735704 ATGGATAAATGAGCTTTTCATGG - Intronic
915125791 1:153663143-153663165 AGGGAGGTATGAGGTATTAAAGG + Intronic
915677088 1:157542002-157542024 ATGGATGTGTGAGATTATAAAGG - Intronic
917057665 1:171001537-171001559 ATGTATTTGTGTGGTTTTGAAGG + Intronic
917291903 1:173478789-173478811 AGGGACTTAAGAGGTTATAAAGG - Intronic
917758425 1:178128184-178128206 TTTGAATTCTGAGGTTTTAAAGG - Intronic
918577244 1:186077455-186077477 ATGGATTTATGAGTATTTTAGGG + Intronic
920266106 1:204724293-204724315 CTGGAAATTTGAGGTTTTAAGGG + Intergenic
920906758 1:210177249-210177271 ATGGAGTTATGAGTTTTAAATGG + Intergenic
921073504 1:211681962-211681984 AGGGACTTAGGAGGTTTTAGAGG + Intergenic
921083392 1:211763299-211763321 ATGGATTAATGAGTTATCAATGG + Intronic
921433432 1:215089170-215089192 ATAGACTTACGAGGTTTTAAGGG - Intronic
922603178 1:226871981-226872003 ATGGATGTATCAGGTTTTTGGGG + Intronic
923646593 1:235827568-235827590 ATGAATGTTTGAGTTTTTAAGGG - Intronic
924077306 1:240353719-240353741 AGGGTTTTATGAGGATTGAATGG + Intronic
924166897 1:241293119-241293141 ATGGTTTCATGAGATTATAATGG + Intronic
1063107714 10:3007990-3008012 ATCCATTTAGGAGGGTTTAATGG - Intergenic
1064773847 10:18753504-18753526 ATGGTTGTATGGGGTTTTATAGG - Intergenic
1065393718 10:25211529-25211551 ATGGATTAATGTGGTTATTAAGG - Intronic
1066282370 10:33930332-33930354 ATAGATTGATGAGTTTTCAAGGG - Intergenic
1066672564 10:37856235-37856257 ATGGATTTCTGAAGTTTATAAGG - Intronic
1068834665 10:61540942-61540964 TGGGATTTTTGAGGCTTTAAAGG - Intergenic
1068914673 10:62416527-62416549 ATGGATTAAAGATGTTTGAAAGG + Intronic
1069084068 10:64119182-64119204 AGGGATTTGAGATGTTTTAAAGG - Intergenic
1070287384 10:75093801-75093823 AGGTATTTATGGGGTTTAAATGG - Intergenic
1070481146 10:76884019-76884041 ATGGAATTTTGAGGTTTTCCTGG - Intronic
1071696955 10:87886739-87886761 ATGGATTAATGCTGTTTGAATGG + Intronic
1072554535 10:96504640-96504662 AGGGATTTATGGGATTTTAAGGG - Intronic
1072919881 10:99567692-99567714 TTGAATTTATCAGTTTTTAATGG + Intergenic
1074675578 10:115846303-115846325 ATGGTTTTATGTGGTTATAAAGG - Intronic
1075429281 10:122366836-122366858 ATGGCTTTATCAGGTTTGTATGG + Intergenic
1077742417 11:4860959-4860981 ATGGTATTGTGAGGTTTTAATGG - Intronic
1078257233 11:9669099-9669121 ATGGAGCCATGAGATTTTAAAGG + Intronic
1078411719 11:11127062-11127084 ATGTATTTATATAGTTTTAAGGG + Intergenic
1078966048 11:16344537-16344559 TTTGATTTATGAGTTTCTAAAGG - Intronic
1079564202 11:21861226-21861248 CTGGATTTTGGAGGTTTTAAAGG + Intergenic
1080310378 11:30883669-30883691 ATGAAGTTATGAAGTTTTTAGGG + Intronic
1080589167 11:33706425-33706447 ATGGATTTACAAGGTTGTTAAGG - Intronic
1080967580 11:37231433-37231455 GTGAATTCATGAGGCTTTAAGGG + Intergenic
1082872757 11:57958754-57958776 ATGGATATATGGGTTGTTAATGG + Intergenic
1084497906 11:69515810-69515832 ATGGATTGATGAGGTTGTCATGG + Intergenic
1085590673 11:77757088-77757110 AAGGATGAATGAGGTTTTAGTGG + Intronic
1086042090 11:82491872-82491894 ATGTAATTATATGGTTTTAAGGG + Intergenic
1086974243 11:93114483-93114505 CTTCATTTAGGAGGTTTTAATGG + Intergenic
1087847741 11:102992553-102992575 ATTGATTTATGAGTTGTTCAGGG - Intergenic
1089510898 11:118996590-118996612 GTGGTTTTATGAGCTTTTCAGGG - Intergenic
1092586995 12:9910083-9910105 ATGGATTTGTTAACTTTTAATGG - Intronic
1093192303 12:16089014-16089036 ATTGATTTATGAGGCATGAATGG + Intergenic
1093389833 12:18604743-18604765 ATGTATTTGTGTGGTTTTGAAGG - Intronic
1093639950 12:21514527-21514549 ATGGATTTATTAGAATTTTAAGG - Intronic
1094282692 12:28757270-28757292 ATGGATTTATGATGGTTTTATGG + Intergenic
1094501555 12:31025735-31025757 ATGTATTTACGTGGTTTCAAAGG - Intergenic
1095121069 12:38419975-38419997 ATGTATTTATATGGTTTTGAGGG - Intergenic
1096536464 12:52278227-52278249 AGGGTTTTGTGAGGTGTTAAAGG - Intronic
1097378949 12:58872466-58872488 ATGGAGTTATGAATTTTAAAAGG - Exonic
1097497701 12:60362192-60362214 ATGGATTTAACAGTTTGTAAAGG + Intergenic
1097728138 12:63098212-63098234 AAGCATTTATGAAGTTTTAATGG + Intergenic
1098947196 12:76602043-76602065 ATGGATTAATGGGTTATTAAGGG - Intergenic
1099611791 12:84881793-84881815 ATGACTTTATGAGGAATTAAAGG - Intronic
1101981235 12:109408763-109408785 ATGTATTTATTTAGTTTTAAAGG - Intronic
1107141716 13:37005548-37005570 ATGGATTACTGAAGTGTTAAAGG - Intronic
1107161437 13:37233416-37233438 ATGGATTAATGAGTTATTATGGG + Intergenic
1108290068 13:48950353-48950375 ATGTATTTATTAGGTTTGTATGG - Intergenic
1108503446 13:51088175-51088197 AGGGATTTGTGAGGTTTCAAAGG + Intergenic
1109018007 13:57044739-57044761 TTGGATCTATTAGGTATTAATGG + Intergenic
1109093592 13:58081527-58081549 AAGGATTTAAGAGCTTTTCAAGG + Intergenic
1109244255 13:59933916-59933938 ATGGAATTATGATTTTTAAATGG - Intronic
1109367490 13:61375052-61375074 ATGGATTTCTGATATTTGAATGG + Intergenic
1109589315 13:64456982-64457004 ATTTATTTCAGAGGTTTTAAGGG + Intergenic
1109636606 13:65126701-65126723 ATGGAAATATAAGGTTTTTATGG - Intergenic
1110835407 13:80076254-80076276 ACAGATTTATGAAGATTTAAAGG + Intergenic
1111105047 13:83634186-83634208 ATGGAGTAATGTGTTTTTAAAGG + Intergenic
1111255484 13:85662043-85662065 ATTAATTTCTGAGATTTTAATGG - Intergenic
1111266282 13:85819066-85819088 ATGTAATTATAAAGTTTTAATGG - Intergenic
1111304573 13:86390534-86390556 AAGGTTTTATGAGTTTTTATTGG + Intergenic
1111361112 13:87178305-87178327 ATCTATTTATTAGATTTTAAGGG + Intergenic
1111490272 13:88963137-88963159 ATGGACTAATTACGTTTTAAAGG + Intergenic
1111976586 13:94972676-94972698 ATACATTTATAAGGTGTTAAAGG + Intergenic
1112171309 13:96975585-96975607 ATGCATTTCAGAGGTTTTAGAGG - Intergenic
1112926232 13:104678600-104678622 ATGGATTTATTATTTTTAAATGG + Intergenic
1114332982 14:21656954-21656976 ATGGAGTCTTGAGGTTGTAAGGG + Intergenic
1114444066 14:22774566-22774588 ATGGATTTCTGGGGTATAAAGGG - Intronic
1114901667 14:27068114-27068136 ATGGATTCATGTTGTTTTCAGGG - Intergenic
1115229505 14:31144642-31144664 ATGGCTTTATGAGGTAAGAATGG - Intronic
1116680318 14:47960466-47960488 GTGGATTTGTAATGTTTTAAAGG + Intergenic
1118860668 14:69660459-69660481 ATGGTTATATGAGGTTTCAAAGG + Intronic
1118873292 14:69761242-69761264 ATGGATTAATGCCGTTATAATGG + Intronic
1118942570 14:70351209-70351231 ATGGATTGATGATTTTTTGAAGG - Intronic
1119817155 14:77580046-77580068 TTGGAATTATGTGGTTTTTATGG - Intronic
1119913064 14:78368803-78368825 ATGGATTTATGAGGTTTTAAGGG + Intronic
1120375141 14:83695298-83695320 ATGGATTAATGAGTTATTATAGG - Intergenic
1120756541 14:88249991-88250013 ATGGAATAATGAGATTTTGATGG - Intronic
1121723420 14:96128242-96128264 ATGGAATTATTAGCTTTAAAGGG + Intergenic
1121872495 14:97421280-97421302 ATGAATTTATGAAGCTTTAAAGG - Intergenic
1122513263 14:102287170-102287192 ATGGATTTATGAGGGTTCAGTGG + Intronic
1122685938 14:103506420-103506442 TTGGCTTTATGATGCTTTAATGG - Intergenic
1124040684 15:26100106-26100128 CTGGATTTATGTGTTTTTAATGG + Intergenic
1125996945 15:44171039-44171061 ATGGATATTTTAGATTTTAATGG - Intronic
1126169243 15:45680714-45680736 ATGGATTTATTAGAAATTAATGG - Intronic
1126812358 15:52420356-52420378 ATGGATTTATGCAGTCATAATGG + Intronic
1127587417 15:60391748-60391770 ATGGATTTATGAGTTTTATACGG - Intronic
1128348377 15:66870632-66870654 ATTGTTTGATGAGGTTTTCAAGG + Intergenic
1128589486 15:68882280-68882302 ATGAATTGATAGGGTTTTAATGG - Intronic
1128693465 15:69743071-69743093 ATGGAGTTGTGAGGTTTCGAAGG - Intergenic
1129433342 15:75517756-75517778 AAAGATTTATGGGGCTTTAAGGG - Intronic
1129570164 15:76673911-76673933 ATGGATTTAAATGTTTTTAATGG - Intronic
1129706251 15:77796160-77796182 GGGGATGTATGAGTTTTTAATGG - Intronic
1129899897 15:79138912-79138934 ATGGGTTTATTATCTTTTAATGG - Intergenic
1133782036 16:8946894-8946916 ATGGATTCATCAAGTTTTACAGG - Intronic
1135886198 16:26310460-26310482 TGGGATTTAAGATGTTTTAAAGG - Intergenic
1139024873 16:62804340-62804362 ATATATTTCTGTGGTTTTAATGG + Intergenic
1139078883 16:63490051-63490073 ATGGTTAAATGAGGTTATAAGGG - Intergenic
1139628791 16:68214059-68214081 ATGGTTTTCAGTGGTTTTAAGGG - Intronic
1140539585 16:75744444-75744466 GTGGATGTGTGAGATTTTAAGGG + Intronic
1141507991 16:84492132-84492154 GTGGATGTATGAGATTGTAAGGG + Intronic
1143718515 17:8793746-8793768 ATGGATCTAAAAGATTTTAAGGG - Intergenic
1144407954 17:14971093-14971115 ATGTATTTGTGTGGTTTTGAAGG - Intergenic
1147027702 17:37602687-37602709 AGTGATTTATAAGGTTTTTAAGG + Intronic
1147798480 17:43063822-43063844 ATGCAATTCTGAGGTGTTAAAGG + Intronic
1148539591 17:48469567-48469589 TTGGACTTGTGTGGTTTTAAGGG + Intergenic
1152892919 17:82892611-82892633 ATGAAGGTGTGAGGTTTTAATGG + Intronic
1154092008 18:11373881-11373903 ATGGATTCATGAGTTACTAAGGG - Intergenic
1155822893 18:30400429-30400451 ATGGTTTCATAAGATTTTAATGG + Intergenic
1156135007 18:34027019-34027041 TTAGATTTATGAGGAATTAATGG + Intronic
1156196360 18:34778069-34778091 ATGGATTTGTGAGGTTTTACAGG + Intronic
1156383874 18:36588470-36588492 ATATATTTATGATGTTTTAGTGG + Intronic
1156626982 18:38920782-38920804 AAGGATTTATTAGTTCTTAAGGG + Intergenic
1156729802 18:40178486-40178508 CTGAATTTATGAGATTGTAAAGG + Intergenic
1158549977 18:58427391-58427413 ATAGTATTATGAGGATTTAATGG + Intergenic
1159204066 18:65227464-65227486 ATCAGTTTATGAGGCTTTAAGGG + Intergenic
1161760803 19:6170534-6170556 ATGTATTTGTGTGGTTTTGAGGG + Intronic
1165524655 19:36343860-36343882 ATGGATTAATGAGTTATTATGGG - Intronic
1165843103 19:38801204-38801226 ATGGATTGATGAGGTCTAGATGG + Intergenic
927409859 2:22812475-22812497 ATGTATTTATGACCTTTGAATGG + Intergenic
928178021 2:29048156-29048178 ATGGTTTTAAAAGGTTATAAGGG - Intronic
928423287 2:31156635-31156657 ATGGATTTGTGAGATATTACAGG + Intergenic
929529617 2:42740068-42740090 ATGAATTTCTGATGTTCTAATGG + Intronic
929647992 2:43648907-43648929 ATGTATTTCTGAATTTTTAAAGG + Intronic
932097554 2:68865012-68865034 ATGGACTTAAGAGGTCTTAGAGG - Intergenic
932297592 2:70640040-70640062 TTGGATTTCTGATGTTGTAAAGG - Intronic
932857615 2:75253684-75253706 ATGGAATTGTGTGGTTTTATGGG + Intergenic
933056264 2:77670900-77670922 ATGACATTATCAGGTTTTAATGG - Intergenic
933433247 2:82212340-82212362 ATGGATTTACATGGTTTTGAGGG + Intergenic
933564151 2:83929265-83929287 ATGGATTTGTGAAGTTATACTGG - Intergenic
933927818 2:87115215-87115237 ATGACATTATCAGGTTTTAATGG - Intergenic
934604633 2:95684746-95684768 ATGGATTAATGATGTTATCATGG - Intergenic
940599241 2:155836612-155836634 ATGGATTTGAGAGGTTTGAGGGG - Intergenic
940676652 2:156731642-156731664 ATGAACTTATGAGGGTTGAATGG - Intergenic
940709158 2:157141613-157141635 ATGTATTTGTGTGGTTTTGAAGG + Intergenic
941459244 2:165747877-165747899 ATGGATTTTTGACTTTGTAATGG - Exonic
942216355 2:173723165-173723187 ATTTATTTATGGGGTTTTTAAGG - Intergenic
942969688 2:181942874-181942896 ATCACTTTAGGAGGTTTTAAGGG + Intergenic
943778184 2:191791285-191791307 ATTTATTTATGAAGTTTTACTGG + Intergenic
943991344 2:194696828-194696850 GAGGATTTATGAGTTTTTTATGG + Intergenic
944624370 2:201556156-201556178 ATGGCTTTATCAACTTTTAAAGG + Intronic
945623558 2:212171670-212171692 ATGGTTTTATAAGGGTTTGATGG + Intronic
946607616 2:221422961-221422983 ATGGATTTATGAGAGTTTGGAGG - Intronic
946802084 2:223428926-223428948 ATGTATTTGTGGGGTTTTGAGGG + Intergenic
948376380 2:237523439-237523461 ATGGCTTTCTCAGCTTTTAAAGG - Intronic
1168975620 20:1963300-1963322 ATGGATTTATGAGAGATTGATGG + Intergenic
1169517205 20:6330646-6330668 ATGTATTTATGTGGTTTTGAAGG + Intergenic
1171004381 20:21449910-21449932 ATTTATTTATGTGTTTTTAAAGG + Intergenic
1172376674 20:34447833-34447855 GTTGATTGATGAGGTTTTAAAGG - Intronic
1173176322 20:40767495-40767517 ATGGAACTGAGAGGTTTTAACGG + Intergenic
1174427503 20:50442822-50442844 ATGGTTTTATGGGGTTTTATTGG + Intergenic
1175307897 20:57990221-57990243 ATGCATTTAGTAGGTTTTATTGG - Intergenic
1175662104 20:60822446-60822468 ATTGATTAATGACCTTTTAAAGG + Intergenic
1181661429 22:24352574-24352596 ATGAAGTTAGGAGGTTTTACTGG + Intronic
1182329898 22:29544062-29544084 ATGAATAAATGAGGTTTTAGGGG - Intronic
1184925565 22:47634327-47634349 ATATATTTATGAGGCTCTAAGGG + Intergenic
950172620 3:10850056-10850078 ACGGATATATTAGGTTTTATGGG - Intronic
951207986 3:19944904-19944926 ATTGAATTATAAGGTTTTTAAGG - Intronic
951843077 3:27055770-27055792 ATGAATTTGTGTGGTTTTGAGGG + Intergenic
951948874 3:28175593-28175615 TTGAATTTATCAGGTTTTGATGG - Intergenic
953421323 3:42755701-42755723 CTGGATTTAAGTGGTTTTCAGGG + Intronic
954055583 3:48021287-48021309 AAGGTTTTATGATATTTTAAAGG + Intronic
955116147 3:56004982-56005004 ATGGGTATTTGAGGTTTTTACGG + Intronic
955161106 3:56466733-56466755 ATGGATTTATAAGGTATTTTTGG - Intronic
955163754 3:56490383-56490405 ATGGACTTCTGAGGTTTTTTGGG + Intergenic
955175399 3:56608898-56608920 ATGTATTTGTGTGGTTTTGAAGG + Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
957166371 3:76678851-76678873 AATAATTTATGAGTTTTTAATGG + Intronic
958529289 3:95305541-95305563 ATAAATTTATGAATTTTTAAAGG + Intergenic
958742641 3:98093692-98093714 ATGTAGTTATGTGGTTTTGAGGG + Intergenic
959397364 3:105857545-105857567 TTGGATTAATGATATTTTAATGG - Intronic
960329628 3:116342711-116342733 CTTGATGTTTGAGGTTTTAATGG - Intronic
961967629 3:130922749-130922771 ATGTATTTATGTAGTTTTGAGGG + Intronic
962390488 3:134967471-134967493 ATGGATTAATGAGTTATCAAGGG + Intronic
962771911 3:138619460-138619482 ATGGATTTATAATTTCTTAAAGG - Intronic
963428295 3:145161368-145161390 ATGGGTTTATGAATTTTTACAGG - Intergenic
963437593 3:145290502-145290524 ATGGATTTAAGTGGTTTTTGTGG + Intergenic
964408736 3:156377077-156377099 AAGGATGTATCTGGTTTTAAGGG + Intronic
964490095 3:157227116-157227138 ATGGATGTATGAGCTGTTACTGG + Intergenic
964647270 3:158971468-158971490 TTGGATTCATGAGTTTTGAATGG + Intronic
965381638 3:167996541-167996563 ATGGATGAATGATATTTTAAGGG - Intergenic
966114156 3:176441442-176441464 ATAGATATATCAGTTTTTAATGG - Intergenic
966621351 3:181967704-181967726 ATGGCAATATGAGGTTTTCATGG + Intergenic
966708202 3:182940905-182940927 ATGTCTTTATGGAGTTTTAAAGG - Exonic
969537960 4:7768278-7768300 AAAGATTTCTGAGGTTTCAAAGG + Intronic
969862584 4:10049261-10049283 ATGGATGGATGAGGTTAAAAAGG - Intronic
970699849 4:18723122-18723144 AAGGGTTTATGAGGCTTTGATGG - Intergenic
971711937 4:30124221-30124243 ATGGATTTATTAAGTTTTGTTGG - Intergenic
972981370 4:44707089-44707111 ATGGTTTTAAGAGATTTTCAAGG - Intronic
973694850 4:53480653-53480675 ATGGATTTATGAGGCTTGGCTGG + Intronic
974993132 4:69118579-69118601 ATAGATTTCTCAGGTTTTTATGG - Intronic
976761652 4:88555534-88555556 ATGGAATTATGTTGTTTTTATGG + Intronic
977799232 4:101205851-101205873 CTGGATTTATTATTTTTTAATGG - Intronic
978203851 4:106055904-106055926 ATTCATTTATAAGCTTTTAAAGG + Intronic
978470727 4:109064514-109064536 ATGGATTTCACAGATTTTAAGGG - Intronic
978905109 4:113996315-113996337 AAGCATTTATGTGGTTATAATGG - Intergenic
980238084 4:130134383-130134405 ATGTATTTGTGTGGTTTTGAAGG - Intergenic
981290074 4:143064539-143064561 ATGCATTGATTAGGTTTTGATGG + Intergenic
981420441 4:144543585-144543607 ATGGATTAATGAGTTATTGAAGG - Intergenic
981948159 4:150374289-150374311 ATGGCCTTATCAGGTTATAAGGG - Intronic
981953773 4:150445147-150445169 ATAGATTTATTTGATTTTAATGG - Intronic
982224171 4:153150986-153151008 ATGAATTTATGACTTTTTAAAGG + Intergenic
982509169 4:156259378-156259400 ATTTATTTATGAGTTTTTGAGGG - Intergenic
983364917 4:166774323-166774345 ATGGGCCTATCAGGTTTTAAAGG + Intronic
983596033 4:169469413-169469435 ATGTAGTTGTGAGGTTTTGAGGG + Intronic
983832987 4:172353429-172353451 TTGGATTTATAAGTTTGTAAAGG + Intronic
984625154 4:181998699-181998721 ATGGGTTAATGATGATTTAATGG - Intergenic
984671958 4:182499916-182499938 AAGTATTTATGTGATTTTAAGGG + Intronic
985355972 4:189119498-189119520 ATGTATTTATATGGTTTTGATGG - Intergenic
986462945 5:7991747-7991769 AAGGAATCATCAGGTTTTAATGG - Intergenic
988952320 5:36275887-36275909 ATGGTTTTATGAGGCTTTTCTGG - Intronic
989817869 5:45758559-45758581 ATGGAATTATTAGCTTTTAATGG - Intergenic
990120451 5:52444511-52444533 ATGGATTTCTTAGGTTTTGGAGG - Intergenic
990993530 5:61708281-61708303 CTGGAATTGTGAGGTTTTCAAGG + Intronic
992597849 5:78363868-78363890 ATGGTTTTATGAAATTTGAATGG + Intronic
992599629 5:78385738-78385760 ATGTATTTTTATGGTTTTAAGGG + Intronic
993143701 5:84067756-84067778 AGGATTTTATGAGGTTTCAACGG - Intronic
994850379 5:105047534-105047556 ATAAACTTATGAGGTTTAAATGG - Intergenic
994980501 5:106869559-106869581 ATGTATTTTTAAAGTTTTAATGG + Intergenic
996025461 5:118640292-118640314 ATGTATTTGCGTGGTTTTAAAGG - Intergenic
996432069 5:123392205-123392227 ATTGATTTATTAGTTTCTAATGG - Intronic
997546141 5:134709751-134709773 ATATATTTATGAGGTATAAAGGG - Intronic
999062544 5:148652229-148652251 ATAGATTTAAGAGGTATTGAGGG + Intronic
999513832 5:152280573-152280595 TGGCATTTTTGAGGTTTTAATGG + Intergenic
1003168523 6:3701958-3701980 CTGGATTCATGAGATTTTATTGG - Intergenic
1003601301 6:7519875-7519897 ATGATTTTAAGAAGTTTTAAGGG - Intergenic
1003674656 6:8192191-8192213 AGGTATTAATGAGGTTTTACTGG + Intergenic
1005210657 6:23457077-23457099 ATGAATCTGTGAGGTTTCAAAGG + Intergenic
1005398352 6:25406601-25406623 ATGGATGTAAGAGGTATTTAGGG + Intronic
1005753125 6:28902328-28902350 ATTTATTCATCAGGTTTTAAGGG - Intergenic
1006199190 6:32271342-32271364 ATGTATTTGCGTGGTTTTAAAGG - Intergenic
1006724445 6:36187258-36187280 ATAGATATATGAGGTTTAATTGG + Intergenic
1008875969 6:56328250-56328272 ATATATTTAAGAGTTTTTAATGG - Intronic
1009273536 6:61646071-61646093 ATCTATTCATAAGGTTTTAAAGG + Intergenic
1010573545 6:77506588-77506610 AAAGATTTATGAGGTATAAATGG - Intergenic
1010630919 6:78197143-78197165 ATAAATTTATGAGGTATTACAGG - Intergenic
1010968077 6:82235196-82235218 GTGTATTTATGGGGTATTAAAGG - Intronic
1011156416 6:84338437-84338459 ATGTATTTGTAAGGTTTTGAGGG + Intergenic
1013835300 6:114327896-114327918 ATGGATTGATGATGTTGGAAAGG + Intronic
1014865658 6:126526621-126526643 ATGGATTTATGGCTTTTCAATGG - Intergenic
1015092338 6:129373768-129373790 ATGGAATTATGAGTTTTTGTGGG + Intronic
1016562768 6:145415595-145415617 ATAGACTTATGAGGTGTTCAGGG + Intergenic
1016975374 6:149802485-149802507 ATGAATTTCTGACGTTATAATGG - Intronic
1017415580 6:154216951-154216973 ATGGTTTTATGGGGTTTTTTGGG - Intronic
1018187701 6:161281418-161281440 ATGGATTAATGCTGTTTTGAGGG - Intergenic
1019875207 7:3804226-3804248 ATATATTTATGATGTTTTATGGG + Intronic
1020455624 7:8371120-8371142 ATGTATTTACGTGGTTTTGAGGG + Intergenic
1020682126 7:11250271-11250293 AGTGATTTTTGAGGTTTGAAGGG + Intergenic
1021613232 7:22477627-22477649 ATGGATTTTTGGCTTTTTAATGG + Intronic
1022170851 7:27828366-27828388 TTGGATTTGGGAGGTTTTAAGGG + Intronic
1022370355 7:29765437-29765459 TTGAATTTATGGGGATTTAAAGG - Intergenic
1023703508 7:42915388-42915410 ATGGAGTTAAAATGTTTTAAGGG + Intronic
1026395497 7:69949160-69949182 TTGGGTTTATGATGTTCTAATGG - Intronic
1027025186 7:74846676-74846698 ATTAATTTTTCAGGTTTTAAAGG + Intronic
1027062577 7:75097442-75097464 ATTAATTTTTCAGGTTTTAAAGG - Intronic
1028150816 7:87369117-87369139 TGGGATTTATGTGGTTTTCAGGG + Intronic
1028322415 7:89476679-89476701 ATGGATTACTGAAGTTTTTAAGG + Intergenic
1028503535 7:91546444-91546466 TTGGATTTATCAGGATTCAAAGG - Intergenic
1030787194 7:113676347-113676369 ATGGAATTATGTGGAATTAAGGG + Intergenic
1030824376 7:114137656-114137678 ATTTATTTATGACGTTTTAATGG + Intronic
1030837183 7:114303380-114303402 AAGAACTTATGATGTTTTAAAGG + Intronic
1031005162 7:116461251-116461273 ATGGATTTGAGAGATTTTTAAGG + Intronic
1031724221 7:125216933-125216955 ATGTATTTAGGTGGTTTTGATGG - Intergenic
1034577673 7:152015118-152015140 ATGGATTGATGAGGGGTTAGAGG - Intronic
1037501995 8:19495392-19495414 ATGGGTTAAAGAGGTTTTTATGG - Intronic
1037954927 8:23048755-23048777 ATGTATTTATGGGGATTTATAGG - Intronic
1039042481 8:33421489-33421511 ATGGATTCAAAAGGTTTTAATGG + Intronic
1040843657 8:51811519-51811541 ATGCATTTATGCAATTTTAAAGG - Intergenic
1041768523 8:61446604-61446626 ATGGATTAATGAGTTATCAAGGG - Intronic
1042666963 8:71217739-71217761 CTGGATTTATGAGTTTATTATGG + Intronic
1042979727 8:74512298-74512320 ATGGATTTGTGAGAATTGAATGG + Intergenic
1043022637 8:75023465-75023487 ATGGATTTATTATATTTAAATGG + Intronic
1043287118 8:78546642-78546664 TTTCAGTTATGAGGTTTTAACGG - Intronic
1043319719 8:78968859-78968881 ATGGATTTAGGAGGGTAAAAGGG + Intergenic
1043647527 8:82539519-82539541 ATTGATTTATGATATCTTAAAGG - Intergenic
1043813234 8:84768698-84768720 AACGATTTTTGAGTTTTTAATGG - Intronic
1044903562 8:96974712-96974734 ATGTATTTACATGGTTTTAAGGG - Intronic
1045539494 8:103069681-103069703 ATTCATTTCTGAGATTTTAAAGG - Exonic
1045796743 8:106055187-106055209 ATGGATTTCTTTGGTTTTAGGGG - Intergenic
1046472247 8:114691662-114691684 ATGAATTTATGAGTCTTCAAAGG - Intergenic
1047011832 8:120681038-120681060 ATGAATTAATGAGGTTTCACTGG - Intronic
1047559680 8:125973105-125973127 ATGGATTAATGTCATTTTAAAGG - Intergenic
1047654314 8:126960070-126960092 AAGGTTTAATGAAGTTTTAATGG - Intergenic
1047883986 8:129227835-129227857 AAGGACTTATGAGTTGTTAAGGG - Intergenic
1049934046 9:483640-483662 ATGGATCAATGAGGCTTTTAGGG - Intronic
1050098243 9:2090546-2090568 ATGGAGTTGTGAGGATTAAATGG + Intronic
1050143091 9:2537250-2537272 ATGGACTTGTGAGGTGCTAAAGG + Intergenic
1051360362 9:16276685-16276707 ATGGAATTAAGAGGGTTTAGAGG - Intergenic
1051696713 9:19775602-19775624 ATGGATTTATATGTATTTAATGG + Intronic
1055041014 9:71872589-71872611 GTGGAATAATGAAGTTTTAAAGG - Intronic
1055774905 9:79756913-79756935 ATATATTTATGGGGTTTTATGGG - Intergenic
1056920784 9:90786860-90786882 ATTGATTTACAAAGTTTTAATGG - Intergenic
1057631438 9:96722041-96722063 ATGGATTTATGAGGCTTATAAGG + Intergenic
1058193629 9:101948289-101948311 ATGTATTTATGTATTTTTAAAGG + Intergenic
1058856816 9:109070467-109070489 ACAGATTTATAAGGTCTTAAGGG - Intronic
1185824527 X:3237065-3237087 ATGGATTCAGGAGCTTTGAAGGG + Intergenic
1188639863 X:32487689-32487711 ATGTGTTTATGTGGTTATAATGG + Intronic
1188784264 X:34325038-34325060 ATTGATTTAAGAGGTTTTCAAGG - Intergenic
1189901283 X:45709327-45709349 ATGGATTAATGAGGTTGTGTTGG + Intergenic
1190472563 X:50797607-50797629 ATGTAGTTATGTGGTTTAAAAGG - Intronic
1190502614 X:51094959-51094981 ATGTATTTCTGTGGTTTTGAGGG - Intergenic
1191163730 X:57364846-57364868 ATGTAATTATGTGGTTTTGAGGG + Intronic
1192472049 X:71407568-71407590 ATGGACTTATGAGGTCTCTAAGG - Exonic
1193349764 X:80448430-80448452 ATGTATTTAGGTGCTTTTAAAGG - Intergenic
1193413590 X:81195558-81195580 AGTGACTTCTGAGGTTTTAAGGG + Intronic
1193872367 X:86815738-86815760 ATAGTCTTAGGAGGTTTTAATGG + Intronic
1193994564 X:88348822-88348844 ATGTATTTATATGGTTTTAAGGG - Intergenic
1196301671 X:114055802-114055824 ATGGGTGTATGAGATTTTAAGGG + Intergenic
1196477836 X:116109606-116109628 ATGTATTTGTGTGGCTTTAAAGG + Intergenic
1197579672 X:128265950-128265972 ATGCTTTAATGATGTTTTAATGG - Intergenic
1198162848 X:134024747-134024769 CTGCATTTATCAGCTTTTAAAGG + Intergenic
1198763459 X:140057926-140057948 ATGAAATAATGAGGTTTTGAGGG + Intergenic
1200385608 X:155887536-155887558 ATGGTTTTCTGGAGTTTTAAGGG + Intronic
1201797697 Y:17917571-17917593 ATGGATTTTTGAGATTTACATGG + Intergenic
1201803856 Y:17988386-17988408 ATGGATTTTTGAGATTTACATGG - Intergenic