ID: 1119917486

View in Genome Browser
Species Human (GRCh38)
Location 14:78415585-78415607
Sequence CTAGTCACCATGTAAGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119917486_1119917489 18 Left 1119917486 14:78415585-78415607 CCAGATTCTTACATGGTGACTAG 0: 1
1: 0
2: 1
3: 6
4: 92
Right 1119917489 14:78415626-78415648 TGGAAGCATCCCTGCTGCTATGG 0: 1
1: 0
2: 1
3: 15
4: 167
1119917486_1119917487 -2 Left 1119917486 14:78415585-78415607 CCAGATTCTTACATGGTGACTAG 0: 1
1: 0
2: 1
3: 6
4: 92
Right 1119917487 14:78415606-78415628 AGATTTCAAGTTCTCCAAAGTGG 0: 1
1: 1
2: 1
3: 20
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119917486 Original CRISPR CTAGTCACCATGTAAGAATC TGG (reversed) Intronic
909078021 1:71076061-71076083 CTAGTCACCCTGTCAGACTTAGG - Intronic
911447379 1:98014525-98014547 ATTGTCACCATGTGAGAATGTGG - Intergenic
921740914 1:218683355-218683377 CTAGTCTCCCTGATAGAATCTGG - Intergenic
921789767 1:219276726-219276748 CTAGGCATCATGTAAAAATGGGG - Intergenic
924074499 1:240319231-240319253 CTAGTCAACATAAAAGTATCAGG + Intronic
1063483294 10:6395622-6395644 CTAGTCCCCAGGTAAGAAGGAGG + Intergenic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1064628930 10:17289498-17289520 CAAGTCACCATTTAGCAATCTGG + Intergenic
1071692516 10:87837184-87837206 CTAGTCAGCATACAAGAACCAGG - Intronic
1074211945 10:111343284-111343306 CGAGGCACCATTTAAGAAACTGG - Intergenic
1074684736 10:115950105-115950127 CGAGGAAGCATGTAAGAATCTGG - Intergenic
1075077712 10:119362133-119362155 GTAGTAACCCTGTAACAATCTGG + Intronic
1075230104 10:120669008-120669030 CTTGTAACCATGTAAGAATCTGG + Intergenic
1077752521 11:4988330-4988352 ATGGTCACCATGTAATAATGTGG - Intronic
1081041046 11:38213312-38213334 CTATTAAAAATGTAAGAATCTGG + Intergenic
1081765152 11:45605253-45605275 CTAGACACCATTTAAACATCTGG - Intergenic
1091561462 12:1617251-1617273 ATAGTCACCATTTATAAATCTGG - Intronic
1091880396 12:3972614-3972636 GAAGTCGCCATGTAAGCATCTGG + Intergenic
1094709596 12:32948318-32948340 CTAGGCACCATGCCAGACTCCGG - Intergenic
1095273703 12:40253896-40253918 CTATTCACCATTTTAAAATCTGG + Intronic
1095319385 12:40807335-40807357 CTACTCACCATGTAGGGATGGGG - Intronic
1099707047 12:86169187-86169209 CTTGACACCATGAAAGAATGAGG + Intronic
1104265688 12:127230755-127230777 CTAGTCCCCAGGTAAGAAGGGGG - Intergenic
1116274971 14:42821704-42821726 CATGTCACCATGTGAGAATTAGG - Intergenic
1117523368 14:56573373-56573395 CTAGCTACCATGGAACAATCTGG - Intronic
1119476679 14:74934570-74934592 CAAGTCCCCATGTCAGAACCTGG - Intergenic
1119917486 14:78415585-78415607 CTAGTCACCATGTAAGAATCTGG - Intronic
1123842949 15:24267977-24267999 CTAGTCTCCAGGTAAGAAAGAGG - Intergenic
1123857986 15:24434049-24434071 CTAGTCTCCAGGTAAGAAAGAGG - Intergenic
1124663361 15:31569087-31569109 CTACTCACCATGTGTGAAACCGG - Intronic
1125847961 15:42875595-42875617 CTAGCTACCATGTAAGAAATGGG + Intronic
1131778105 15:95823911-95823933 CTGGTCTCCATGTTAGAAGCAGG + Intergenic
1136598681 16:31269373-31269395 CTAGTCCCCAGGTAAGAAGGAGG + Intronic
1150882177 17:69042650-69042672 CTAGTGACCAAGTAATCATCTGG + Intronic
1153607792 18:6852695-6852717 CTAGCCATCCTGTAAGAATAAGG - Intronic
1158352497 18:56577253-56577275 CTAATCACTATCTCAGAATCAGG + Intergenic
1158761188 18:60388959-60388981 CTAGTCAATATATAAGAATGGGG - Intergenic
1161238511 19:3209365-3209387 CTTGTCACCATGAGAGAATTTGG + Exonic
1166820741 19:45578181-45578203 CTAGTCACCAGGCAAGAAGGAGG - Intronic
925508799 2:4601082-4601104 CTGGTCACCATGGAAAAAGCAGG + Intergenic
926809135 2:16740963-16740985 CTTTTCACCATGTGAGAATGTGG - Intergenic
929404718 2:41628770-41628792 CTAGTCACCATGTTACATACTGG + Intergenic
930579364 2:53191348-53191370 CTTGTCACCTTATAAGGATCTGG - Intergenic
932472492 2:71969810-71969832 CTTTTCACCATGTGAGGATCTGG + Intergenic
940039997 2:149350218-149350240 CTAGAATCTATGTAAGAATCAGG + Intronic
943337757 2:186639518-186639540 CTGGTGACCATGTATGAGTCTGG + Intronic
947304638 2:228730608-228730630 CTAGTCACCAGGCAAGAAGGGGG - Intergenic
1169049652 20:2564996-2565018 CTACACACCTTGTAAGACTCGGG + Intronic
1181995664 22:26879754-26879776 ATAATAACCATGTAACAATCAGG + Intergenic
1184810720 22:46829942-46829964 CTAGGCACCATGAAAGGAGCAGG + Intronic
950833666 3:15899479-15899501 CCAGCAACCATGTAAGAATTTGG - Intergenic
955487021 3:59445439-59445461 CTAGCCACCAGGCAAGTATCTGG + Intergenic
956832725 3:73069354-73069376 TTTGTCACCATGTAAGAAACAGG - Intergenic
957536163 3:81506636-81506658 CTATTCACAATGGAAAAATCAGG + Intronic
958490721 3:94768708-94768730 CTATTCTGCATGTAAGAAGCTGG + Intergenic
961315464 3:126032499-126032521 GTTGTCACCATGTCAGAATGTGG - Intronic
962472863 3:135728729-135728751 CTAGTCACCATGCAAGAAGGAGG + Intergenic
963368108 3:144364311-144364333 CAAGTCATCATCTAAGAATAGGG - Intergenic
965101144 3:164299689-164299711 CAACTCACCATGTATTAATCAGG + Intergenic
967085846 3:186094278-186094300 CAGGTCACCATCTATGAATCAGG - Intronic
967227966 3:187311585-187311607 ACAGTCACCATGTATGAATGGGG + Intergenic
970435040 4:16025264-16025286 CAAATCACCAGGTAAGAACCCGG - Exonic
978193503 4:105943504-105943526 CTAGTCACCTGCTAAGAATCTGG - Intronic
979612526 4:122704269-122704291 CTAGTTTACATGTAAGAATGGGG - Intergenic
983058523 4:163128161-163128183 CTAGTCTGCATGTGAGGATCTGG + Intronic
985924826 5:3007527-3007549 CTGGTCACCATCTCAGAATGAGG + Intergenic
990447323 5:55904783-55904805 CTAGGCCACATGTAGGAATCTGG - Intronic
993422763 5:87721905-87721927 CTAGTCCCCAGGTAAGAAGGAGG + Intergenic
993974959 5:94468038-94468060 CTACTGACCATGTAAGTATATGG + Intronic
996382018 5:122871870-122871892 CTAGTCACGATGCCAGAATGTGG - Intronic
1001867078 5:175115020-175115042 CCAGTCACCATGTCAGGGTCTGG + Intergenic
1003122789 6:3331437-3331459 ATAGTCACCATGGAAGAGACTGG + Intronic
1003706026 6:8530885-8530907 CTAATCTCCAAATAAGAATCTGG - Intergenic
1004852466 6:19714269-19714291 CTAGTCACCAAGAAAGCATTAGG - Intergenic
1010163959 6:72893532-72893554 CCAGGCACCATGTTAAAATCTGG + Intronic
1015011693 6:128357063-128357085 CTAGACACAATTTAAGAATGAGG + Intronic
1017146484 6:151240162-151240184 CTAGTCGCCCTGTTAGAAACGGG + Intronic
1020356258 7:7278901-7278923 CAAGTCACCATGTTAGGCTCAGG - Intergenic
1020381791 7:7555647-7555669 CTAGTCTCCATTTTAGAATCTGG + Intergenic
1028453134 7:91008077-91008099 CTAGGCACCCTGTAAGGCTCTGG - Intronic
1030147704 7:106373138-106373160 CCAGTCACCGTGTAAGAAATAGG + Intergenic
1034042765 7:147896806-147896828 CTAGTCACCAGGCAAGAAGGAGG + Intronic
1034625150 7:152486895-152486917 TAAGTTACCATGTAATAATCTGG - Intergenic
1035992873 8:4511473-4511495 CTGTTCAGCATGTAAGAAGCTGG + Intronic
1036658772 8:10694233-10694255 CTCGGCACTATGTAAGATTCTGG - Intronic
1041390842 8:57346364-57346386 CTATTCTCCATGAAAGAAACTGG - Intergenic
1043250698 8:78069604-78069626 CTAGTCCCCATGCAAGAAGGAGG - Intergenic
1044937955 8:97311092-97311114 CTAGGCACCATGGAGGAATTAGG + Intergenic
1049937006 9:508813-508835 CTACTTACCATGTAAGAAACTGG - Intronic
1050153624 9:2642592-2642614 ATAATCACCATTTAACAATCAGG - Intronic
1055566031 9:77569262-77569284 CTAGTTACCATGTCACAACCAGG - Intronic
1055931346 9:81562770-81562792 CTTTTCACCAAGTAAGAAGCAGG - Intergenic
1056885391 9:90437970-90437992 ATAATCAACATATAAGAATCTGG - Intergenic
1057983693 9:99687763-99687785 CTAGTCACCTTGAATGAATTTGG - Intergenic
1186166439 X:6831351-6831373 CTAGTCCCCAGGTAAGAAAGGGG + Intergenic
1189295333 X:39913756-39913778 CAAGTCACCATGTGAGAAGCTGG - Intergenic
1189974253 X:46446578-46446600 CTAGACACCCTGGGAGAATCTGG - Intergenic
1190142407 X:47859795-47859817 CACGTCACCCTGTAGGAATCAGG - Intronic
1195292860 X:103445864-103445886 CTAGCAACCTTGTAAGAATATGG - Intergenic
1196685588 X:118507648-118507670 CTTGTCACCATTTAAAAAACGGG - Intronic