ID: 1119924979

View in Genome Browser
Species Human (GRCh38)
Location 14:78484963-78484985
Sequence CCTTGCCAGCACACTCCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119924979 Original CRISPR CCTTGCCAGCACACTCCTTT GGG Intronic
902537790 1:17131237-17131259 CCTTGTGAGCCCACTCCTTGTGG + Intergenic
908203747 1:61823841-61823863 CCTTCCCATTATACTCCTTTAGG - Intronic
914250426 1:145917816-145917838 CCTTGCCTGCCCTCTCCTCTAGG - Exonic
915586316 1:156845706-156845728 CCTTGCCAGCACCCACCTCCTGG - Exonic
915888237 1:159746446-159746468 GCTTGCCAGCACAATACATTTGG - Intergenic
920539072 1:206763864-206763886 CCTTGCCAGCACCTTGATTTTGG - Intergenic
921275197 1:213512261-213512283 CCTTGCCAGGATCTTCCTTTGGG - Intergenic
921850217 1:219926523-219926545 CCTCACCAGAACACTCCCTTTGG + Intronic
923282839 1:232461243-232461265 CCATGCCAGCCCTCTCCCTTGGG + Intronic
1064436067 10:15312347-15312369 CCATAGCAGCAGACTCCTTTTGG - Intronic
1064481586 10:15745847-15745869 ACTGGCCAGAACACTCCCTTTGG + Intergenic
1064733574 10:18357867-18357889 CCTTTCTGGAACACTCCTTTTGG + Intronic
1066048410 10:31614242-31614264 CCATGGCACCACGCTCCTTTGGG - Intergenic
1071829797 10:89360438-89360460 CCTTGCCAGGACACTTATCTTGG - Intronic
1077257679 11:1595694-1595716 CTTTTCCAGCACACACCTGTTGG + Intergenic
1077579614 11:3408400-3408422 CCCTGCGAGCACCCTCCTCTTGG - Intergenic
1078528468 11:12118555-12118577 CTTTGCCAGCTCTCTCCTTTAGG + Intronic
1081370957 11:42302446-42302468 CCCTGCCAACACACTGATTTTGG + Intergenic
1082267305 11:50132826-50132848 CCTGGCCAGCATCCTGCTTTTGG + Intergenic
1082288782 11:50345742-50345764 CCTGGCCAGCATCCTGCTTTTGG - Intergenic
1084051827 11:66605169-66605191 CCTTGCCTGCCCAGTCCTTGGGG + Intronic
1084236633 11:67791937-67791959 CCCTGCGAGCACCCTCCTCTTGG - Intergenic
1084804300 11:71568197-71568219 CTTTTCCAGCACACACCTGTTGG - Intronic
1084995079 11:72968639-72968661 CCATGCCAGCACTATCATTTTGG - Intronic
1086164741 11:83764451-83764473 CCTTCCCTGCACACCCCTTTGGG - Intronic
1090391723 11:126393282-126393304 CCTTGCCAGCCCACGCAGTTGGG - Intronic
1090872611 11:130761808-130761830 CCTTGACAGCACAAACCCTTAGG + Intergenic
1098197207 12:68014649-68014671 GTTTGCCAGCAGACTGCTTTTGG + Intergenic
1109003101 13:56832968-56832990 CCTTGCCAGCACCCTAATTTTGG + Intergenic
1112829236 13:103428229-103428251 CCCTGCCAGCACCCAGCTTTTGG + Intergenic
1116176170 14:41473190-41473212 CCTTGCCAGCCCAGTCTTTGGGG + Intergenic
1118990689 14:70794473-70794495 TCTTGCCTGCACACTCCTGTTGG - Intronic
1119334210 14:73818969-73818991 CCTTGCCAACACCCTGATTTTGG - Intergenic
1119924979 14:78484963-78484985 CCTTGCCAGCACACTCCTTTGGG + Intronic
1122648886 14:103214267-103214289 CCTGGCCACCACTCTTCTTTAGG + Intergenic
1125539161 15:40459743-40459765 CCTTTCCAGCACCCTCCCTGGGG + Exonic
1126601345 15:50431037-50431059 CCTTGCCATCACTCACATTTTGG - Intronic
1127451055 15:59116883-59116905 CCTTGCCACTACACTTCTTAAGG + Exonic
1128787194 15:70406561-70406583 TCTTGCCAGCACACTTATGTGGG - Intergenic
1130672267 15:85923134-85923156 CCTTCCCAGCACAGGCCTTTGGG - Intergenic
1130904099 15:88227856-88227878 CCTTGCTAGCTCACTCCCGTGGG + Intronic
1134351506 16:13441889-13441911 CCTTTTCAGCACATCCCTTTGGG - Intergenic
1135765800 16:25176855-25176877 CCTGGCCTTCACATTCCTTTTGG + Intronic
1138229123 16:55324800-55324822 CCTCGCCACCACGCGCCTTTGGG + Exonic
1138686131 16:58727429-58727451 CCTTGCCAGAACACTTTTCTAGG + Intronic
1140217502 16:73020255-73020277 CATTGGCAGAACACTCCCTTAGG + Intronic
1144071662 17:11679281-11679303 CATTGCCAGCAAACACCTCTTGG + Intronic
1145275917 17:21430396-21430418 CCTTGCCAGCACACTCAAGCAGG + Intergenic
1145313764 17:21716309-21716331 CCTTGCCAGCACACTCAAGCAGG + Intergenic
1145712205 17:26988283-26988305 CCTTGCCAGCACACTCAAGCAGG + Intergenic
1145935139 17:28710963-28710985 CCTTCCCACCCTACTCCTTTCGG - Intronic
1146103468 17:30008901-30008923 CCCTGCCAGCACCTTCATTTTGG - Intronic
1148131299 17:45264091-45264113 CCTGGCCAGCTCACCCCTTTTGG - Exonic
1151142883 17:72011919-72011941 CATTGCCAGCATTATCCTTTTGG + Intergenic
1153321304 18:3776631-3776653 CAGTGCCAGCACATTTCTTTAGG + Intronic
1155403630 18:25464696-25464718 CTTTGCCATCTCACTCGTTTTGG - Intergenic
1157479505 18:48044461-48044483 GCATGCCAGCAGGCTCCTTTGGG + Intronic
1159184786 18:64955567-64955589 CCTTGCCAGCACGTTCATCTTGG - Intergenic
1159624836 18:70680622-70680644 CCCTGCCAGCACCTTCATTTTGG + Intergenic
1160843194 19:1155524-1155546 CCTTGCCAGAACGGCCCTTTAGG + Intronic
1160920973 19:1520397-1520419 CCTCCCCAGCACCCTCCTTCCGG - Intergenic
1161999064 19:7731691-7731713 CCTGGTCACCACAGTCCTTTGGG - Exonic
1164460180 19:28440298-28440320 CATTGCCAGTACACTCCCTAAGG - Intergenic
1164763158 19:30743354-30743376 TCTTCCCAGAACCCTCCTTTGGG - Intergenic
1167296181 19:48651428-48651450 CCTTGCCAACACCTTCATTTTGG + Intergenic
1168068814 19:53937418-53937440 GCTTCACAGCACACTCTTTTGGG - Intronic
925755585 2:7128468-7128490 CCCAGGCAGCACTCTCCTTTTGG + Intergenic
926152234 2:10431824-10431846 CCTTGCCAGCGGCCTCCTTCAGG + Intergenic
927906437 2:26861892-26861914 TCTTGCTAGCAAACTCCTTTTGG + Intronic
927959955 2:27234971-27234993 CCTTCCCAGATCACCCCTTTTGG - Intronic
930854465 2:55997776-55997798 TCTTGCCTCCCCACTCCTTTTGG - Intergenic
934109569 2:88729519-88729541 CCTTTCCACCACATTCCTTGTGG + Intronic
934517311 2:94996816-94996838 CTCTCCCAGCACCCTCCTTTTGG - Intergenic
935355268 2:102192776-102192798 GCCTGCCAGCACACCCCTCTGGG + Intronic
935390912 2:102551863-102551885 CCTTCCAAGCACATTCTTTTTGG - Intergenic
936901509 2:117486264-117486286 CCCTGGCACCACACTCCTTGAGG + Intergenic
937271346 2:120654901-120654923 CCTGGCCAGGAGGCTCCTTTGGG - Intergenic
943631076 2:190253235-190253257 AATTACCAGCACACTCCTTTGGG + Intronic
946288956 2:218728652-218728674 CATTGCCAGGATATTCCTTTTGG - Intronic
946979415 2:225191849-225191871 CCTGGCCAGTCCACTCCTTTGGG - Intergenic
947973377 2:234343446-234343468 CATTGTCAGCAGTCTCCTTTGGG + Intergenic
1169475776 20:5930020-5930042 CCTTGCCAGCACCTTGATTTTGG - Intergenic
1170336380 20:15274936-15274958 CCTCGCCACCCCACTCCTATAGG - Intronic
1172116272 20:32575233-32575255 TCTTGCCAGCTCACCCCTTCAGG + Intronic
1174728877 20:52894597-52894619 CCTTGCCAGCACCTTGATTTTGG + Intergenic
1175464799 20:59183271-59183293 ACTTGCCAGCACCTCCCTTTGGG + Intergenic
1175771834 20:61628876-61628898 CCTGGCTTGCACATTCCTTTAGG + Intronic
1175803173 20:61812680-61812702 CCTTGCCAGCCAACGCCCTTTGG + Intronic
1176154645 20:63612462-63612484 CCTTCCCAGCTCACCCCTTGTGG - Intronic
1178192897 21:30306561-30306583 CCTGGCCAGCACAGTCCCTCAGG - Intergenic
1178477456 21:32949897-32949919 CCTTGTCACCACCCTCCTCTGGG + Intergenic
1182258334 22:29054247-29054269 CCTCTCCAGCCCACGCCTTTAGG + Exonic
1184745058 22:46451261-46451283 CCTTCCCAGCTCCCTCCTTGTGG - Intronic
949333582 3:2949288-2949310 ACTTTCCATCACACTCGTTTTGG - Intronic
951899777 3:27645497-27645519 CCTGGCCAGCTCACTTCTTAGGG + Intergenic
953411391 3:42692288-42692310 CTTTGCCAGCACACTCAGCTAGG - Exonic
955132275 3:56182439-56182461 CCTTCACAGCAGACTCCTTTTGG - Intronic
956309119 3:67859581-67859603 CCCTGCCAGCACCTTCATTTTGG - Intergenic
956909059 3:73797952-73797974 CCTGGCCAGCATCCTGCTTTTGG + Intergenic
957183222 3:76908322-76908344 ACTTGGCAGCACACACATTTTGG + Intronic
959766524 3:110037021-110037043 TCATGCCAGCACATTCTTTTGGG + Intergenic
961302260 3:125929832-125929854 CCCTGCGAGCACCCTCCTCTTGG + Intronic
961542115 3:127607112-127607134 TCTTGCCAGGTCACTCCTTCAGG + Intronic
963303819 3:143627626-143627648 CCTGTACAGCACAGTCCTTTGGG - Intronic
963622934 3:147634966-147634988 CCTTGCCTGCCCACACCTTCAGG - Intergenic
965700909 3:171458985-171459007 CGATCCCAACACACTCCTTTGGG - Intronic
968449131 4:666927-666949 CGTGGCCAGCACACTGTTTTGGG + Intronic
968684377 4:1947164-1947186 CCTCCCCAGCACACTCCCTGTGG + Intronic
968949851 4:3684792-3684814 CATTTCCAGTACACTCCATTGGG - Intergenic
968995390 4:3942104-3942126 CCCTGCGAGCACCCTCCTCTTGG - Intergenic
970717221 4:18940485-18940507 CCTTGCCAGCACCCTGATCTTGG - Intergenic
971447601 4:26767643-26767665 CCTTGCCAGCACATTCATCTTGG + Intergenic
971934835 4:33134297-33134319 TCTTGCCAGCAGACTGCCTTTGG + Intergenic
972696280 4:41449841-41449863 CCCTGCCAACACTCTGCTTTTGG - Intronic
974375016 4:61064768-61064790 CCCTGTCATCACACTCCTTTTGG - Intergenic
976527798 4:86114593-86114615 GCTGGCCAGAACACTCCTGTAGG + Intronic
976775753 4:88704179-88704201 CTTTGCCACCACACACCTTTAGG - Exonic
983326008 4:166257986-166258008 CCTTGGCATCACACTTCTCTCGG - Intergenic
983795540 4:171857469-171857491 CCTTATCAGCCCACTCCTTATGG - Intronic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
987076412 5:14386257-14386279 CCAGGCCAGCACCCTCCTTGGGG - Intronic
988220114 5:28333769-28333791 CCATGCCTGCACACACTTTTCGG - Intergenic
988361759 5:30245324-30245346 CCATGCCAGAACATTTCTTTTGG + Intergenic
988680867 5:33482487-33482509 CATTGCAAGCACAGTCCTTAAGG + Intergenic
990816925 5:59796017-59796039 CCTTGACAACACATTACTTTTGG + Intronic
991355998 5:65769071-65769093 CCTTGCCGGAACACTCATGTTGG - Intronic
995918029 5:117274625-117274647 CCTGGTCAGCACACTCCTTTTGG - Intergenic
998149249 5:139747571-139747593 CCTCGCCAGCACAAGCCTTCAGG - Intergenic
998957103 5:147450066-147450088 CCTCACCATCACACTCTTTTTGG - Intronic
999067795 5:148710085-148710107 CCTTGCCAGCACCTTGATTTTGG - Intergenic
1004188309 6:13441263-13441285 CGCTGCCAGCACACACCTATGGG + Intronic
1004737813 6:18425434-18425456 CCCTGGCAAAACACTCCTTTTGG + Intronic
1011073079 6:83406826-83406848 TTTTGCCAGCACACTGCCTTTGG + Intronic
1015106143 6:129539299-129539321 GCTTTCCAGCACTCTCGTTTTGG + Intergenic
1015828586 6:137343015-137343037 ACTTGCGAGCACACTGCCTTTGG + Intergenic
1018427690 6:163698378-163698400 CCTTGCCAGCTGCCTCCATTAGG - Intergenic
1020319663 7:6930421-6930443 CCCTGCAAGCACCCTCCTTTTGG - Intergenic
1020412601 7:7909680-7909702 CCTTGCCACTACACTTCTTAAGG - Intronic
1021549559 7:21855324-21855346 CCTGGCCAGCAGACTCTTTAAGG + Intronic
1024879895 7:54072901-54072923 CCTTGTCAGCACTTTCCTTCTGG + Intergenic
1025829613 7:65038180-65038202 CCCGTCCAGCTCACTCCTTTCGG + Intergenic
1032192986 7:129775065-129775087 CCTAGCCTGCCCACTCCCTTGGG + Intergenic
1032246500 7:130218048-130218070 CCTTGCCAGCCCTCTCCTCTGGG - Intergenic
1033484902 7:141779078-141779100 CCTTGCTAATACACTCCTTGAGG + Exonic
1034950529 7:155293822-155293844 CCTTGCAAGAACAGTCCTTTGGG - Intergenic
1037677926 8:21067902-21067924 CCTGGTCAGCAAACTCCTCTTGG - Intergenic
1041206267 8:55500941-55500963 GCTTGCCAGCACATATCTTTTGG - Intronic
1041694517 8:60721400-60721422 CCTTGCCAGCACCTTCGTCTTGG + Intronic
1042516394 8:69663428-69663450 CGTTGCCAGCACAGTACCTTGGG + Intergenic
1042967274 8:74368025-74368047 CCTTGTCATAAAACTCCTTTGGG + Intronic
1045153183 8:99433313-99433335 GCTTACCAGCACACCCATTTTGG + Intronic
1045769052 8:105712702-105712724 CTTTCCCTGCACTCTCCTTTTGG + Intronic
1049786024 8:144451271-144451293 CCCTGCCTGCACAGTCCTCTTGG + Intronic
1051364564 9:16312294-16312316 CCTTGGCACCACACTTCTCTTGG - Intergenic
1051600620 9:18869218-18869240 CCTTGCCAGCACTTTCATCTCGG + Intronic
1053048921 9:34942295-34942317 CAGTGCCAGCAGACTTCTTTGGG - Intergenic
1055648173 9:78380417-78380439 CTTTCCCAGCAGCCTCCTTTTGG + Intergenic
1058005826 9:99912858-99912880 CCTTGCTATTCCACTCCTTTGGG + Intronic
1061614822 9:131772865-131772887 CCATGCCAGCACCCTTCCTTGGG + Intergenic
1186023273 X:5280997-5281019 ATTTTCCACCACACTCCTTTAGG - Intergenic
1188897710 X:35689285-35689307 CCTTGCCAGCAAATTCCTTTGGG + Intergenic
1188969063 X:36590768-36590790 CATCAGCAGCACACTCCTTTTGG - Intergenic
1191685498 X:63885333-63885355 CATTGCCACCACACCCCTTCTGG + Intergenic
1194380521 X:93185370-93185392 CCTGGCCAACACACTGATTTTGG - Intergenic
1196963851 X:121033723-121033745 CCCTGCCAGCACCTTCATTTTGG + Intergenic
1199025573 X:142933162-142933184 CTGTGCCAGCACAGTCCTTTAGG + Intergenic
1199696529 X:150346493-150346515 CCTGACCATCACACTCATTTTGG - Intergenic
1200049839 X:153422917-153422939 GCTTGCCACCACACTCATCTGGG - Intergenic
1201472104 Y:14344828-14344850 TCTTGCCAGCACACACTCTTTGG - Intergenic