ID: 1119929376

View in Genome Browser
Species Human (GRCh38)
Location 14:78530178-78530200
Sequence TCACAGCCCTGGTGTCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 7, 3: 35, 4: 329}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119929376_1119929380 -3 Left 1119929376 14:78530178-78530200 CCCTCCAGACACCAGGGCTGTGA 0: 1
1: 0
2: 7
3: 35
4: 329
Right 1119929380 14:78530198-78530220 TGAATTCCGCCTTTTTAAACAGG 0: 1
1: 0
2: 0
3: 7
4: 130
1119929376_1119929383 17 Left 1119929376 14:78530178-78530200 CCCTCCAGACACCAGGGCTGTGA 0: 1
1: 0
2: 7
3: 35
4: 329
Right 1119929383 14:78530218-78530240 AGGCCCAGAGTCAGCTTATTTGG 0: 1
1: 0
2: 0
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119929376 Original CRISPR TCACAGCCCTGGTGTCTGGA GGG (reversed) Intronic