ID: 1119929737

View in Genome Browser
Species Human (GRCh38)
Location 14:78533502-78533524
Sequence AAATGGCAGGAGATGGATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119929737 Original CRISPR AAATGGCAGGAGATGGATCG TGG (reversed) Intronic
900369826 1:2326722-2326744 AACTGGCAGGAGATGGCGCCGGG - Intronic
900898695 1:5502397-5502419 AAATTGAAGGAGATGGATTTGGG - Intergenic
903039948 1:20521998-20522020 GAATGGCATGAAATGGTTCGTGG - Intergenic
903944634 1:26954125-26954147 AAAGGTCTGGAGATGGATGGTGG + Intronic
904213300 1:28899785-28899807 AAAAGGAAGGGGATGGATTGAGG + Intronic
904473455 1:30749873-30749895 AAATGGCAGCAGTTGGCTGGGGG + Intronic
904565430 1:31425613-31425635 AGAGGGCAGGATATGGGTCGGGG - Intronic
906820916 1:48929076-48929098 AAAGGGCAAGAGAAGGATCCAGG - Intronic
907872668 1:58457094-58457116 AAATGAGAGGAGATGGAACAGGG - Intronic
909950963 1:81719957-81719979 AAATGGCAGGGGGTGGAATGTGG - Intronic
914439909 1:147695786-147695808 AAATTTCTGGAGATGGATGGTGG - Intergenic
918998074 1:191788988-191789010 ACATGGCAAGAGATGGAACATGG - Intergenic
921218536 1:212956955-212956977 AAACGTCTGGAGATGGATGGTGG - Intronic
923094420 1:230763330-230763352 AAAGTGCTGGAGATAGATCGTGG - Intronic
924625857 1:245695989-245696011 TATTGGCAGGAGATGGAGGGTGG + Intronic
1064056158 10:12099321-12099343 AGGTGGGAGGAGATGGATCAAGG - Intronic
1065141083 10:22718752-22718774 ATAAGGCAGGAGATGGCTTGAGG - Intergenic
1067287112 10:44914716-44914738 AAATGGCAGGAAAGGGGTCCTGG + Intronic
1068618264 10:59146137-59146159 AAATGGCAAGTGATGGAGAGAGG - Intergenic
1068946490 10:62734707-62734729 AGATGGCAGGTGATGGTTTGGGG - Intergenic
1069895519 10:71678147-71678169 AGATGGCAGTGGATGGGTCGGGG - Intronic
1071338198 10:84619119-84619141 AAATGGCAGGAGTAGGAGCAAGG - Intergenic
1071529766 10:86380203-86380225 AAAGTTCAGGAGATGGATGGTGG + Intergenic
1071595891 10:86924262-86924284 AAATGGCAGCAGAGGAATCCCGG - Exonic
1071833715 10:89398002-89398024 AAATTTCTGGAGATGGATGGTGG - Intronic
1075338895 10:121629842-121629864 AAAGTGCTGGAGATGGATGGTGG - Intergenic
1076304125 10:129451469-129451491 AAAGGTCTGGAGATGGATGGTGG + Intergenic
1076738773 10:132470701-132470723 AACTGGCAGGAGATGGAGGTGGG - Intergenic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1081226191 11:40525457-40525479 AAATGGCAGGGGGTGGCTGGAGG + Intronic
1081565942 11:44261329-44261351 AAATGACAGGAGATGGGGCACGG + Exonic
1083175411 11:60946808-60946830 GAATGGCAGGTGATGGATCTCGG - Exonic
1084876375 11:72136623-72136645 AGAGGTCAGGAGATGGATGGTGG - Intronic
1084881398 11:72174007-72174029 AGAGGTCAGGAGATGGATGGTGG - Intergenic
1085148548 11:74227162-74227184 AATTGGCAGGAGTTGGATACTGG + Intronic
1085523775 11:77152899-77152921 AGATGGCAGGGGATGGAGTGTGG + Intronic
1085777949 11:79383054-79383076 GAAAGGCAGAAGATGGATGGCGG - Intronic
1085907810 11:80785720-80785742 AACTGGCAGTAGCTGGATTGGGG + Intergenic
1085930660 11:81079089-81079111 AAATGGCAGAAGTAGGATGGAGG - Intergenic
1087808081 11:102578091-102578113 AAATTGCAGGAGTTGGATGATGG + Intronic
1088824662 11:113483606-113483628 GAATGGCAGAAGATGGAGAGAGG + Intergenic
1089834850 11:121361285-121361307 AAATGGCAGCAGAGGAATCCTGG + Intergenic
1090380236 11:126321407-126321429 AAAGGGCAGCAGCTGGATGGGGG - Intronic
1091078095 11:132640154-132640176 AAATGGGAGGAGAAAGAGCGAGG + Intronic
1091556007 12:1574083-1574105 AACTGGCAGGAGATGTAGCTTGG + Intronic
1092444926 12:8546169-8546191 AAAGGGGAGGAGATAGATGGGGG - Intergenic
1095198377 12:39352121-39352143 AAATTTCTGGAGATGGATGGTGG - Intronic
1097345772 12:58490347-58490369 AAATGACAAGTGATGGATCCTGG - Intergenic
1097694567 12:62764007-62764029 AAAAGGCAGCAGCTGGATCGAGG - Intronic
1103482559 12:121260374-121260396 AATAGGCAGGAGACGGATGGCGG + Intronic
1104323524 12:127774217-127774239 AAGGGGCAGGAGATGGAGGGTGG - Intergenic
1104538130 12:129637792-129637814 ACATGGCAGGAGAAGGAGCAAGG + Intronic
1104597109 12:130127443-130127465 TGATGGCAGGAGAAGGATCTGGG + Intergenic
1106493824 13:30255540-30255562 AAATGGCAGGAGTAGGAGCCCGG - Exonic
1106626595 13:31427003-31427025 AAATGGCATGAGAGGGAAAGTGG + Intergenic
1111181824 13:84679058-84679080 CAATTGCAGGAGATGGAAGGTGG + Intergenic
1111902531 13:94217399-94217421 AAATGGCAGGAGATTGAAACAGG + Intronic
1112384975 13:98931011-98931033 AAATGACAAGAGATGGATGGTGG - Intronic
1115705446 14:35993665-35993687 CAAAGGCAGGAGATGGGTCTGGG + Intergenic
1116080558 14:40165256-40165278 ACATGGCAAGAGATAGATAGAGG - Intergenic
1117362102 14:54985837-54985859 AAATGGAAAGAGAAGAATCGAGG + Intronic
1117679827 14:58192532-58192554 AGATGGAAGGAGAGGGATCTAGG + Intronic
1119892335 14:78192180-78192202 TAAGGGCAGGAGATGGCTCCTGG + Intergenic
1119929737 14:78533502-78533524 AAATGGCAGGAGATGGATCGTGG - Intronic
1120715575 14:87837626-87837648 AAATGGCAGCAGATTGCTCAAGG - Intergenic
1121487707 14:94331310-94331332 GATTGGCAGGAGAGGGATCCAGG - Intergenic
1121720311 14:96104622-96104644 AAGAGGCAGGAGGTGGATAGGGG - Intergenic
1122468943 14:101952904-101952926 AAATGTCTGGAAATGGATGGTGG + Intergenic
1122704526 14:103611835-103611857 AAATTTCTGGAGATGGATGGTGG + Intronic
1123700419 15:22910559-22910581 AGACGGCGGGAGGTGGATCGTGG + Exonic
1125398781 15:39278173-39278195 ACATGGCAGGAGAAGGACCAAGG - Intergenic
1125639077 15:41214617-41214639 GAATGGTAGGAGATGGAAGGGGG - Intronic
1130152306 15:81320334-81320356 GAATGGCATGAGATGCATGGGGG + Intronic
1130306175 15:82713469-82713491 AGATTGCAGGAGATGGAAAGGGG - Intergenic
1139962172 16:70724323-70724345 AAGTGGCTGGAGATGGAGTGGGG - Intronic
1141818960 16:86432105-86432127 AAATGGCAGGAGAAGTTTCAGGG + Intergenic
1142515044 17:422363-422385 CAATGGGAGGAGATAGATCAAGG + Intronic
1144412907 17:15018808-15018830 AAATGGCAGGTGATGGAGGAAGG + Intergenic
1145014332 17:19386940-19386962 AAATAGCAGGAGAGGGATTCAGG - Intronic
1145035465 17:19537519-19537541 AGATGGCAGGAGCTGGACAGAGG + Intronic
1145105045 17:20108094-20108116 AAATTTCTGGAGATGGATGGTGG + Intronic
1145797573 17:27664737-27664759 AGATGGCAGGAGATGGCTCCTGG + Intergenic
1146558952 17:33851409-33851431 AAATGGCAGGGGATGTGTTGGGG + Intronic
1146819599 17:35974306-35974328 AAAAGTCTGGAGATGGATAGTGG + Intergenic
1148874933 17:50681452-50681474 GAATGACAGGAGATGGAGGGCGG - Intronic
1151581731 17:74982873-74982895 AAAAGGCTGGAAATGGATCCGGG + Intergenic
1152620434 17:81361535-81361557 AAAAGGCAAGAGATGGCTCAAGG - Intergenic
1153093320 18:1372789-1372811 ACATGGCAGGAAATGGACCCAGG + Intergenic
1153124229 18:1770696-1770718 AAATTTCTGGAGATGGATGGTGG - Intergenic
1154131632 18:11741956-11741978 AAATTTCTGGAGATGGATGGTGG - Intronic
1157162565 18:45327447-45327469 AAAGGTCTGGAGATGGATAGTGG - Intronic
1158528040 18:58232972-58232994 AAATGGCAGGTAAAGGATCGTGG - Intronic
1160198895 18:76779862-76779884 AACTGTCAGGAGATGCAGCGTGG + Intergenic
1162959296 19:14116991-14117013 AAAGGGCAGGAGAAAGATGGCGG + Intronic
1164436715 19:28236727-28236749 GAATGCCAGGGGATGGCTCGAGG - Intergenic
1164662937 19:29994354-29994376 AAATATCTGGAGATGGATGGTGG - Intronic
925229127 2:2216070-2216092 AAATGATAGGAGGTGGAACGTGG - Intronic
926596391 2:14794173-14794195 AAATGGCAGGATATTGAGAGTGG - Intergenic
927489293 2:23510214-23510236 TTATGGCAGGGGATGGATTGGGG + Intronic
929580407 2:43078658-43078680 AAAAGTCCGGAGATGGATGGGGG - Intergenic
930747322 2:54898066-54898088 GAATGGCAGGTGATGGGTTGTGG + Intronic
931010066 2:57900619-57900641 AAATGGCATGAGATGATTCTAGG - Intergenic
931010704 2:57909866-57909888 AAATGGCAAGAAAAGGATAGAGG - Intronic
932518991 2:72388051-72388073 AACTGGCAGGAGGTGGAAGGAGG + Intronic
933737861 2:85509716-85509738 AAAGGTCTGGAGATGGATAGTGG + Intergenic
933767551 2:85720400-85720422 TAATGGCAGGAGAGGGCTCAGGG + Intergenic
935855989 2:107274625-107274647 AAATGTCAGGAGAAGGAAAGGGG - Intergenic
937263116 2:120598916-120598938 AAATGGCAGGAGAGGCAAAGAGG - Intergenic
942027980 2:171929616-171929638 AAATAACATGAGATGGATCATGG - Intronic
943491541 2:188560782-188560804 ACATGGCAGGAGCAGGATGGAGG + Intronic
944168043 2:196743577-196743599 AAATGGCAGAGGATGGAGTGGGG - Intronic
945128548 2:206540592-206540614 AAATTTCAGGAGATGGAAAGTGG + Intronic
945698566 2:213141193-213141215 AAAAGGAAGGAGAAGGATCTAGG - Intronic
946363826 2:219236238-219236260 AAATGGCAGGAGGAGGGACGGGG + Intronic
946786770 2:223254769-223254791 AAATTTCTGGAGATGGATAGTGG - Intergenic
947261029 2:228222527-228222549 CAATAGCAGGAGCTGGATTGTGG + Intergenic
947732172 2:232437350-232437372 AGGTGGCAGGAGATGGGTGGAGG + Intergenic
948402486 2:237693706-237693728 AGATGGCAGGAGGAGGATGGAGG + Intronic
1169621278 20:7509134-7509156 ACATGGCAGGAGATGGAGCAGGG + Intergenic
1171139921 20:22731926-22731948 AAAGTTCTGGAGATGGATCGTGG - Intergenic
1174252654 20:49231090-49231112 AAGGGGCAGGAGATGGCTCCAGG - Intronic
1176529538 21:7947411-7947433 AAATGGCATGGAATGGATTGCGG - Intergenic
1176931474 21:14816182-14816204 AAAGTTCAGGAGATGGATAGTGG + Intergenic
1177069102 21:16480067-16480089 AAATGGTAGGAGAAGGATGAAGG - Intergenic
1178685604 21:34708285-34708307 AAGTGGGAGGAGATGGGTCCAGG + Intronic
1179790294 21:43752427-43752449 CACTGCCAGGTGATGGATCGGGG + Intronic
1181887356 22:26031878-26031900 GAATGGCAAGAGGTGGATGGTGG - Intergenic
1182270377 22:29149564-29149586 TAATGGCAGGAAATGGCTGGTGG + Intronic
1182298973 22:29327475-29327497 CAATGGCAGGAGAGGGGTCAGGG + Intergenic
1183913822 22:41100305-41100327 AAATGGCAGAAAATGAAACGGGG + Intronic
1184429890 22:44436249-44436271 AAATGGCACCAGATTGATCAGGG - Intergenic
1184846824 22:47092999-47093021 AAATGGGAGGAGGAGCATCGAGG + Intronic
949266607 3:2164024-2164046 AAAGGGTAGGAGGTGGATGGGGG + Intronic
949783118 3:7712150-7712172 AAATGGCAGAAGATGGAGCTGGG - Intronic
953095933 3:39777120-39777142 AAATGGCAGGATATGCATTTTGG + Intergenic
954290495 3:49647465-49647487 AAAGGGCAGGGGATGGATAATGG - Intronic
956198967 3:66685105-66685127 AAATAGTAGCAGATGGATTGAGG - Intergenic
957285299 3:78209958-78209980 CAATGGGAGGTGTTGGATCGTGG + Intergenic
957542776 3:81596180-81596202 AAATATCAGGAAATGGATCTAGG + Intronic
957814567 3:85277838-85277860 AAGTGGCAGGAAATGGTTCTGGG - Intronic
958959707 3:100497488-100497510 AAATGTCTGGAGATGGATGGTGG - Intronic
963295014 3:143536940-143536962 AATTGGCAGGAGGTGCAGCGTGG - Intronic
963311060 3:143710469-143710491 AAATGGCAGCACATGGGTTGTGG - Intronic
964749545 3:160041681-160041703 AAATGCCAGGAGTTTGATCTAGG + Intergenic
968163953 3:196449228-196449250 AAATGACAGCAGAGGGACCGAGG + Intergenic
970634805 4:17996942-17996964 AAAAGGCAGGAGTTAGATCAGGG - Intronic
971411376 4:26376214-26376236 AAATTTCTGGAGATGGATGGTGG - Intronic
972586608 4:40443215-40443237 AAAGGTCTGGAGATGGATGGTGG + Intronic
972739697 4:41878351-41878373 AACTGGATGGAGATGGATGGAGG - Intergenic
976459438 4:85291745-85291767 AAAGTTCTGGAGATGGATCGTGG + Intergenic
976703016 4:87991738-87991760 AACTGGCAGGAGGTGGAGTGGGG + Intergenic
979752167 4:124291981-124292003 ACATGGCAAGAGAGGGAGCGGGG - Intergenic
983981744 4:174006023-174006045 AAGTGGCTGTAGATTGATCGAGG + Intergenic
985061251 4:186081697-186081719 AAGTACCAGGAGATGGATCCTGG + Intronic
987060226 5:14235893-14235915 AAATGGAAGGAGATTGCTTGAGG - Intronic
988612750 5:32743165-32743187 AGAGGGCAAGAGATGGATAGAGG - Intronic
990844997 5:60127426-60127448 AGATGCCAGGAAATGGATCAAGG + Intronic
993553034 5:89298957-89298979 AAAGGGGAGGAGATGGATTTGGG + Intergenic
993592436 5:89810571-89810593 ACATGGCAGGGGATGGCTGGTGG + Intergenic
994557866 5:101327685-101327707 AAATGGCAGAATATGGAGCAGGG + Intergenic
995086573 5:108117978-108118000 AAAAAGCAGGAGATGGAGGGAGG + Intronic
995318288 5:110801312-110801334 ATATGGCAGGAGCTGGACCAAGG - Intergenic
995816567 5:116175929-116175951 AAAAGTCTGGAGATGGATGGTGG + Intronic
996129523 5:119764894-119764916 TACTGGCAGGAGATGGAGGGTGG - Intergenic
997622033 5:135305316-135305338 AGAGGGCAGGAGTTGGATCTTGG + Intronic
998800276 5:145862082-145862104 ATTTGGCAGGAAATGAATCGTGG - Intronic
999095017 5:148970031-148970053 AAATGGCTGGAGTTGGAGGGAGG + Intronic
1000011872 5:157240706-157240728 ACATGGCAGGAGCAGGAGCGAGG + Intronic
1001456362 5:171863419-171863441 AAATATCAGGAGATGGTTGGGGG + Exonic
1002050220 5:176566423-176566445 AGAAGGCAGGATATAGATCGGGG + Intronic
1002360969 5:178670543-178670565 AAAAAGCAGGAGATGGATATGGG - Intergenic
1002806103 6:575521-575543 GCATGGCAGGAGATGGAGCGAGG - Intronic
1003135219 6:3429953-3429975 AAATATCTGGAGATGGATGGTGG + Intronic
1003243121 6:4361618-4361640 AAATGTCTGGAGATGGGTGGTGG - Intergenic
1003859175 6:10306409-10306431 AGATTTCAGGAGATGGATGGCGG + Intergenic
1007091571 6:39187964-39187986 TGATGGCAGGAGAGGGGTCGGGG + Intergenic
1007163357 6:39810748-39810770 AAAAGGCAGGGGAGGGATCTGGG - Intronic
1007975026 6:46093001-46093023 AAAAGGCAGGAATTGGATTGGGG - Intergenic
1008517357 6:52330636-52330658 ACATGGCAGGAGCTGGAGCAAGG + Intergenic
1008674943 6:53809391-53809413 AAATGGCAGGAGGAGGAAGGGGG + Intronic
1010984778 6:82411449-82411471 CAATGGCAGGAGATGTAAGGTGG - Intergenic
1011555460 6:88567899-88567921 AAAGGTCTGGAGATGGATGGTGG - Intergenic
1012092510 6:94917608-94917630 AAATGGTAGCAGATGGATTGGGG + Intergenic
1015800533 6:137057658-137057680 AAATGGAGGGATATGGATTGTGG + Intergenic
1016305720 6:142681549-142681571 AAAAGGCTGGAGATGGACAGTGG - Intergenic
1018645210 6:165941874-165941896 AAATGGCAGGAGATGGGGGATGG - Intronic
1019465593 7:1186393-1186415 AAATGCCAGGGGAGGGATGGAGG - Intergenic
1021770725 7:23998131-23998153 AAATGGCAGGAGCAGGAGCAAGG - Intergenic
1023470267 7:40509790-40509812 AAATAGCAGCAGATGGACTGAGG - Intronic
1026585244 7:71650726-71650748 AAATGACAGTAGAAGGATGGAGG + Intronic
1026941221 7:74289226-74289248 GAAGGGAAGGAGATGGAGCGGGG + Intergenic
1027822465 7:83064415-83064437 AAATGGCAGGCTATGGATTTCGG + Intronic
1028809637 7:95069428-95069450 AAATGGAAGGAGAGGGAAGGAGG + Intronic
1028906336 7:96158108-96158130 AAATGAAAGGAAATGGATCATGG - Intronic
1028931190 7:96414851-96414873 AAATGACAGTAGATGGATGGGGG + Intergenic
1029021848 7:97372389-97372411 AAATTTCTGGAGATGGATAGTGG - Intergenic
1029034364 7:97503445-97503467 ACATGGCAGGAGCAGGACCGAGG + Intergenic
1029036180 7:97524661-97524683 AAATGGCAAGAGAGGGAGCAAGG + Intergenic
1029424371 7:100486990-100487012 GAGTGGCAGGAGAGGGAGCGTGG - Exonic
1030695865 7:112584545-112584567 AAATGGAAGCAGATGGCTCCGGG - Intergenic
1031955732 7:127940439-127940461 AAATGGCAGGACCTGGATGCAGG + Intronic
1032492991 7:132338708-132338730 AAATATCAGGAGGTGGATGGTGG + Intronic
1032916039 7:136491432-136491454 ATATGGCAGGAAAGGGATGGGGG - Intergenic
1034213447 7:149384655-149384677 AAATGTCTAGAGATGGATGGTGG + Intergenic
1040855290 8:51942776-51942798 AAATGGTAGGAGGTGGGCCGGGG + Intergenic
1041768618 8:61448337-61448359 AAAAGGAAGGAGAGAGATCGAGG - Intronic
1047951689 8:129940192-129940214 AAATGGCAGGAACTGGACCTCGG + Intronic
1049083205 8:140458155-140458177 AGATGGAGGGAGATGGAGCGAGG + Intronic
1049916577 9:323594-323616 AAATTCCTGGAGATGGATGGTGG - Intronic
1055650740 9:78404608-78404630 AGATGGTAGGGGATGGGTCGGGG - Intergenic
1060456234 9:123801246-123801268 AAATTTCTGGAGATGGATAGTGG - Intronic
1061014499 9:127974073-127974095 AAGTGCCGGGAGATGGATGGGGG - Intronic
1061501557 9:131006185-131006207 AAAGGTCTGGAGATGGATGGTGG + Intergenic
1062073254 9:134570483-134570505 GGCTGGCAGGAGATGGATCAGGG + Intergenic
1186370935 X:8946805-8946827 AAATGCCTGGAAATGGATTGTGG - Intergenic
1186831706 X:13396771-13396793 AAATGGCATGAGCTGGAAAGAGG + Intergenic
1187768333 X:22667779-22667801 ACATGGCTGGAGAAGGAGCGAGG - Intergenic
1189485666 X:41429573-41429595 AAATGCTAGGAGAAGGATCTTGG - Intergenic
1190888664 X:54550935-54550957 AAATAGCAGCAGATGGCTCAGGG - Intronic
1193730963 X:85102359-85102381 AAATGTCTGGAGATGGATAGTGG + Intronic
1193916650 X:87372752-87372774 AAATGGCAACAGATCGATCAAGG + Intergenic
1196434746 X:115664792-115664814 CAGTGGCAGGAGATGGAGCAGGG - Intergenic
1196927244 X:120645748-120645770 AATTGTCAGGAGATGGATGTAGG - Intergenic
1197419877 X:126225726-126225748 ACATGGCAGGAGCAGGATCAAGG - Intergenic
1198513225 X:137375171-137375193 AAATGGAAGCAGATCGATAGTGG - Intergenic
1198743693 X:139867740-139867762 CAAGGGCAGGAGATGGAATGGGG + Intronic