ID: 1119931514

View in Genome Browser
Species Human (GRCh38)
Location 14:78551986-78552008
Sequence CTGGCTTTCAAATGCTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 274}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119931514_1119931523 23 Left 1119931514 14:78551986-78552008 CCTGGGCAGCATTTGAAAGCCAG 0: 1
1: 0
2: 3
3: 20
4: 274
Right 1119931523 14:78552032-78552054 GAATCAAAAGATCAGTGTAGAGG 0: 1
1: 0
2: 1
3: 20
4: 216
1119931514_1119931524 28 Left 1119931514 14:78551986-78552008 CCTGGGCAGCATTTGAAAGCCAG 0: 1
1: 0
2: 3
3: 20
4: 274
Right 1119931524 14:78552037-78552059 AAAAGATCAGTGTAGAGGCTTGG 0: 1
1: 0
2: 4
3: 36
4: 357
1119931514_1119931516 -7 Left 1119931514 14:78551986-78552008 CCTGGGCAGCATTTGAAAGCCAG 0: 1
1: 0
2: 3
3: 20
4: 274
Right 1119931516 14:78552002-78552024 AAGCCAGGCCCTGCCTCCAGTGG 0: 1
1: 0
2: 4
3: 66
4: 964
1119931514_1119931518 -4 Left 1119931514 14:78551986-78552008 CCTGGGCAGCATTTGAAAGCCAG 0: 1
1: 0
2: 3
3: 20
4: 274
Right 1119931518 14:78552005-78552027 CCAGGCCCTGCCTCCAGTGGTGG 0: 1
1: 2
2: 8
3: 147
4: 1801

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119931514 Original CRISPR CTGGCTTTCAAATGCTGCCC AGG (reversed) Intronic
900440465 1:2652527-2652549 CAGGCTTTCCAATGCTCGCCTGG - Intronic
900441196 1:2656258-2656280 CAGGCTTTCAGATGCTCACCTGG - Intronic
900441703 1:2658868-2658890 CAGGCTGTCAAATGCTCACCTGG - Intronic
900441875 1:2659750-2659772 CAGGATTTCAGATGCTCCCCTGG - Intronic
900442596 1:2663484-2663506 CAGGCTGTCAAATGCTCACCTGG - Intronic
900442768 1:2664366-2664388 CAGGATTTCAGATGCTCCCCTGG - Intronic
900443489 1:2668100-2668122 CAGGCTGTCAAATGCTCACCTGG - Intronic
900443661 1:2668982-2669004 CAGGATTTCAGATGCTCCCCTGG - Intronic
900444490 1:2673278-2673300 CAGGCTGTCAAATGCTCACCTGG - Intronic
900444663 1:2674160-2674182 CAGGATTTCAGATGCTCCCCTGG - Intronic
900446100 1:2681667-2681689 CAGGCTGTCAAATGCTCACCTGG - Intronic
900446378 1:2683113-2683135 CAGGCTGTCAAATGCTCACCTGG - Intronic
900446562 1:2684038-2684060 CAGGCTGTCAAATGCTCACCTGG - Intronic
900447055 1:2686524-2686546 CAGGCTGTCAGATGCTCCCCTGG - Intronic
900447412 1:2688251-2688273 CAGGCTGTCACATGCTCCCCTGG - Intronic
900448549 1:2693950-2693972 CAGGCTGTCAGATGCTCCCCTGG - Intronic
900449692 1:2699616-2699638 CAGGCTGTCAGATGCTGACCTGG - Intronic
900451450 1:2751972-2751994 CAGGCTGTCAAATGCTCGCCTGG - Intronic
900451509 1:2752293-2752315 CAGGCTGTCAGATGCTCCCCTGG - Intronic
900452021 1:2754902-2754924 CAGGCTGTCAGATGCTCCCCTGG - Intronic
900453153 1:2760567-2760589 CAGGCTGTCAGATGCTGACCTGG - Intronic
900453635 1:2763056-2763078 CAGGCTGTCAAATGCTCACCTGG - Intronic
900454348 1:2766641-2766663 CAGGCTGTCAAATGCTCACCTGG - Intronic
900454770 1:2768862-2768884 CGGGCTGTCAAATGCTCACCTGG - Intronic
900455077 1:2770317-2770339 CAGGCTGTCAAATGCTCACCTGG - Intronic
900455824 1:2774063-2774085 CAGGCTGTCAAATGCTCACCTGG - Intronic
900456308 1:2776606-2776628 CGGGCTGTCAAATGCTCACCTGG - Intronic
900456479 1:2777378-2777400 CAGGCTGTCAGATGCTCCCCTGG - Intronic
900999294 1:6140207-6140229 CTGGGTTTCACATGTTGGCCAGG - Intronic
901243806 1:7712509-7712531 CAGGGTTTCATATGTTGCCCAGG + Intronic
901292695 1:8136608-8136630 CAGGGTTTCACATGTTGCCCAGG - Intergenic
902421206 1:16281846-16281868 CAGGGTTTCACATGCTGGCCAGG + Intronic
902781400 1:18707288-18707310 CTGACTTTCAGATCCTGCTCTGG + Intronic
903423892 1:23238721-23238743 CTGACATTCATTTGCTGCCCTGG - Intergenic
904476562 1:30768937-30768959 CTGGAACTCAAATGCTGGCCTGG + Intergenic
904847906 1:33434474-33434496 CTGGCATATAAATGTTGCCCAGG + Intergenic
905131131 1:35758821-35758843 CAGGATTTCATATGCTGCCCAGG + Intronic
905544853 1:38789714-38789736 CTGACTTCCAAATTCTGCTCTGG - Intergenic
906110443 1:43318797-43318819 CTATCTTTAAAATGCTGGCCAGG - Intronic
907106638 1:51888918-51888940 CAGGTTTTCACATGTTGCCCAGG + Intergenic
910357324 1:86375194-86375216 CTGGCTTTAATATTCTTCCCTGG - Intronic
910952466 1:92665589-92665611 ATGAGTTTCAAATGTTGCCCTGG - Intronic
913579843 1:120215191-120215213 ATGGGTTTCACATGTTGCCCAGG + Intergenic
913628331 1:120683197-120683219 ATGGGTTTCACATGTTGCCCAGG - Intergenic
914561774 1:148826617-148826639 ATGGGTTTCACATGTTGCCCAGG + Intronic
914611057 1:149303590-149303612 ATGGGTTTCACATGTTGCCCAGG - Intergenic
915001847 1:152601119-152601141 CTGGCTTTCACAAGCTGAGCTGG + Intergenic
915536466 1:156539110-156539132 TTGGCTCTCAAAGCCTGCCCTGG + Intronic
916678295 1:167082619-167082641 CTGGCTTTCCAACTGTGCCCTGG - Intronic
917119775 1:171635240-171635262 CTGGTTTTGAGGTGCTGCCCAGG - Intergenic
917501289 1:175587746-175587768 ATTTCTTTCAAAAGCTGCCCAGG + Intronic
918026029 1:180747307-180747329 CTGGCTTTCAGAAGGTGCTCAGG + Intronic
918393245 1:184088249-184088271 CTGGCCTTCACAGCCTGCCCAGG - Intergenic
918972714 1:191440354-191440376 CTGGTTTTCAGATGCTGGCTGGG + Intergenic
922346971 1:224704397-224704419 CTGGGTTTTAAAAGCTCCCCAGG - Intronic
922863229 1:228837389-228837411 CGGGATTTCACATGTTGCCCAGG - Intergenic
1063870800 10:10415780-10415802 CTAGATTACAAATTCTGCCCAGG + Intergenic
1064707206 10:18085501-18085523 CAGGGTTTCACATGTTGCCCAGG + Intergenic
1064750032 10:18519241-18519263 CTGGCCCTCTATTGCTGCCCAGG + Intronic
1065211270 10:23405616-23405638 CTGGCTTTCAGAAGGTGTCCTGG + Intergenic
1065830822 10:29612156-29612178 CTGGCTGGCACATGCTACCCTGG - Intronic
1066206700 10:33196499-33196521 GTGGCTTTCAAAGACTGCGCAGG - Intronic
1067296915 10:44979899-44979921 GTGGCTTTCTAATGTTGCCCAGG - Intronic
1067851918 10:49759885-49759907 CTGGCTTCCAAGTACTGCCCAGG + Intronic
1071741022 10:88358305-88358327 CTGGCCTACAATTCCTGCCCAGG + Intronic
1072633554 10:97163544-97163566 CTCCCTTGCTAATGCTGCCCTGG - Intronic
1073910562 10:108338263-108338285 TTGCCTTTCAAAATCTGCCCTGG + Intergenic
1074283011 10:112070828-112070850 CTGGTTTCCAAATGTTTCCCTGG + Intergenic
1076047647 10:127307618-127307640 CTGGGTTTCCAGTCCTGCCCTGG + Intronic
1076412396 10:130261625-130261647 CTGGCTTGCAGAGGGTGCCCAGG + Intergenic
1076833293 10:133007566-133007588 CTGGCTCTCAAAGGCCACCCAGG - Intergenic
1081789401 11:45772147-45772169 CTGGCTTTCTCCTGCTCCCCAGG + Exonic
1081806048 11:45891107-45891129 CTGGGGTTGAAATTCTGCCCTGG - Intronic
1083558477 11:63652531-63652553 CTGGCTGTCAAATGCCCCCTGGG + Exonic
1083715047 11:64570361-64570383 CTGGCTATAAAATGCAGCCAGGG - Intronic
1085114820 11:73921602-73921624 CTTGCTGGAAAATGCTGCCCAGG + Intronic
1085171814 11:74456122-74456144 CAGGGTTTCACATGTTGCCCAGG - Exonic
1085803249 11:79611250-79611272 GTGACTTTCAAATGCTCCTCAGG + Intergenic
1087282073 11:96222176-96222198 GAGGCTTACAAATGCTGCTCAGG + Intronic
1088235207 11:107716013-107716035 GTGTCTCTCAGATGCTGCCCAGG + Intronic
1089348075 11:117804339-117804361 CAGTCTCTCAAATGCTGCCAGGG + Intronic
1090448013 11:126780712-126780734 GAGGCTTTCACATCCTGCCCTGG - Intronic
1091031077 11:132188382-132188404 CTTGCTTTTGAATGCTGTCCTGG + Intronic
1091679335 12:2515621-2515643 CGGGCATCCAGATGCTGCCCAGG - Intronic
1092033759 12:5312207-5312229 CTGGCTTCCATCTTCTGCCCAGG - Intergenic
1092970880 12:13693621-13693643 CTGTCTTTCAAGTGTGGCCCAGG - Intronic
1094090516 12:26644329-26644351 CTGGATTTCAAAGGATGCCCTGG + Intronic
1095313549 12:40729836-40729858 CTGGCTGTGAAATGCTAACCTGG + Intronic
1095989196 12:48022752-48022774 CAGGCTTTCAAACACTGACCAGG - Intronic
1097747286 12:63315285-63315307 GTGGCTTTCTCATGCTGCCTGGG + Intergenic
1099070234 12:78037004-78037026 CTGGTTTGGAAATGCTGCCAAGG + Intronic
1099120850 12:78687508-78687530 CAGGGTTTCACATGCTGGCCAGG + Intergenic
1099468281 12:83014528-83014550 CAGGGTTTCACATGTTGCCCAGG + Intronic
1100645253 12:96522722-96522744 CTGCCTTACAAAAGCTGCTCAGG + Intronic
1100827317 12:98487038-98487060 CTGTCTTTCAAATCCTTCCAAGG - Exonic
1101594586 12:106152886-106152908 CTGGCTTCCTAATAATGCCCAGG - Intergenic
1101694417 12:107111015-107111037 CTGGAATTCACATGCTGCCTTGG + Intergenic
1101984664 12:109436288-109436310 CTGGCTCCCAGATGCTGCCCGGG - Intronic
1102120286 12:110435101-110435123 CTTGCTGGAAAATGCTGCCCAGG + Exonic
1103221456 12:119249405-119249427 CTGGCTTGGATCTGCTGCCCAGG - Intergenic
1104140739 12:125983988-125984010 CTGGCTGTCAGACTCTGCCCAGG + Intergenic
1105785156 13:23740944-23740966 CTGGGTGTCCAAGGCTGCCCAGG + Intronic
1105873661 13:24533873-24533895 CATGCTTTGAATTGCTGCCCTGG - Intergenic
1107128509 13:36870206-36870228 CTGACTTTGAATTCCTGCCCTGG - Intronic
1107446888 13:40477696-40477718 CGGGTTTTCACATGTTGCCCAGG + Intergenic
1108478207 13:50842357-50842379 CTGGCTTTCAGATTTTGACCAGG - Intronic
1110604058 13:77410473-77410495 CTGGCTTTCTTATGTTGTCCTGG + Intergenic
1110895599 13:80748194-80748216 CTCTCTTTCTAATGCTGCTCCGG - Intergenic
1112392420 13:98997712-98997734 CTGGCTTGCAATTCCAGCCCTGG + Intronic
1112610525 13:100950726-100950748 CTGGCCTACAAGTGATGCCCTGG + Intergenic
1113135475 13:107084135-107084157 CTGGATTTACAATGCTGCCTTGG + Intergenic
1113219929 13:108088177-108088199 GTCCCTTTCAAATGCTACCCTGG - Intergenic
1113898811 13:113784383-113784405 CTGGCTTTCTCATGGTACCCAGG - Intronic
1115653029 14:35416923-35416945 TTGTCTTTCAATAGCTGCCCTGG - Intergenic
1117283997 14:54268414-54268436 CTGGCTTTCAGGTTCTTCCCTGG - Intergenic
1119020292 14:71105361-71105383 CAGGATTTCCAATGCTTCCCTGG - Exonic
1119840150 14:77786338-77786360 CTGGCTTTCCAATCCAACCCTGG - Intergenic
1119931514 14:78551986-78552008 CTGGCTTTCAAATGCTGCCCAGG - Intronic
1121382916 14:93489930-93489952 CTAGATTTCAAAGGATGCCCAGG - Intronic
1122341308 14:101030300-101030322 TTTGGTTTCAAATCCTGCCCAGG + Intergenic
1126140990 15:45438537-45438559 CAGGGTTTCACATGTTGCCCAGG - Intronic
1129987715 15:79933347-79933369 CTGGCTTTCATTTGTTTCCCTGG - Intergenic
1130678428 15:85974552-85974574 TTGCCTTACAAATGCCGCCCCGG - Intergenic
1132827725 16:1913460-1913482 CTGGCTGGCAGGTGCTGCCCGGG - Intronic
1132884085 16:2174884-2174906 CTCGCTGTCAAATGCTTTCCAGG + Intronic
1134838128 16:17379158-17379180 CAATCTTTCAAATGCTCCCCGGG + Intronic
1136531518 16:30872914-30872936 GTGGTTTTCAAATGATGACCTGG + Intronic
1136614722 16:31391128-31391150 CTGCCTTACAAAGACTGCCCAGG - Intergenic
1137951447 16:52787608-52787630 CTAGCTTTCAAATTATGACCTGG - Intergenic
1139783900 16:69374772-69374794 CAGGGTTTCACATGCTGACCAGG - Intronic
1143866402 17:9926802-9926824 CTGGCTTACAGCTGATGCCCTGG - Intronic
1144855492 17:18265109-18265131 CTGGCCTTCAGCTTCTGCCCAGG - Exonic
1145256178 17:21323689-21323711 CTGGCTTTCTCAAACTGCCCTGG - Intergenic
1145320435 17:21764262-21764284 CTGGCTTTCTCAAACTGCCCCGG + Intergenic
1146684988 17:34835559-34835581 CTGCCTCACAAATCCTGCCCAGG - Intergenic
1147872756 17:43599098-43599120 CTGCCTTTCATACCCTGCCCTGG - Intergenic
1148057370 17:44808557-44808579 CTAGGTTTCACATGTTGCCCAGG - Intronic
1148617146 17:49009516-49009538 CAGGGTTTCAAATGTTGGCCAGG - Intronic
1149493438 17:57101366-57101388 CAGGGTTTCACATGTTGCCCAGG + Intronic
1150207662 17:63420999-63421021 CTGGCTTGGACATGCTGCACCGG - Exonic
1150691975 17:67374953-67374975 CTGGCTTTAAAATGGTGTCATGG + Intergenic
1150913087 17:69409660-69409682 CGGGGTTTCACATGCTGGCCAGG - Intergenic
1151413075 17:73943846-73943868 CTGGCTTTGGAATGGTGCCTGGG + Intergenic
1152790666 17:82277266-82277288 CAGGGTTTCACATGCTGGCCAGG - Intergenic
1153723918 18:7936473-7936495 CTGGCATGTAAGTGCTGCCCTGG - Intronic
1155502085 18:26496998-26497020 ATGGCTTTTTAATGCTTCCCAGG + Intronic
1156232138 18:35164090-35164112 CAGGTTGTCCAATGCTGCCCAGG + Intergenic
1157478478 18:48037954-48037976 CTGGCTTTCACACGGTGCTCTGG + Intronic
1159605269 18:70468359-70468381 GTGGGTTTTAAATGCTCCCCAGG + Intergenic
1164616767 19:29671782-29671804 CTGGCTTTCTACTGGTGGCCAGG + Intronic
1165386797 19:35514549-35514571 CTCGCTTGCCATTGCTGCCCTGG - Intergenic
1166552615 19:43676463-43676485 GTGGCTTTCAGATCCTGGCCTGG + Intergenic
925675652 2:6358507-6358529 CCGGCAGTCACATGCTGCCCCGG - Intergenic
927231111 2:20825073-20825095 CTGCCTTTCAGATGCTACTCTGG + Intergenic
927710739 2:25324366-25324388 CTGGATTTATAATCCTGCCCTGG - Intronic
929974607 2:46620255-46620277 CAGGGTTTCACATGTTGCCCAGG - Intronic
930004168 2:46882725-46882747 CTGGACTTTAAAAGCTGCCCAGG + Intergenic
930901050 2:56508152-56508174 CCTGCTTGCAAATGATGCCCTGG - Intergenic
931607058 2:64063038-64063060 AGGACTTTCAAATTCTGCCCTGG - Intergenic
931649312 2:64454188-64454210 GAGGCCTTTAAATGCTGCCCAGG + Exonic
931761718 2:65423469-65423491 TTGGCTTTCTAATGGTGTCCTGG - Intronic
932313000 2:70759219-70759241 CTGGCCTCCAGATCCTGCCCTGG + Intronic
932962567 2:76431318-76431340 CTAGTTTTCAAAAGCTGCCCAGG + Intergenic
934969234 2:98749596-98749618 CTGGCACTCAAAGCCTGCCCTGG + Intergenic
936270339 2:111043998-111044020 CTTGCTTTGTAATTCTGCCCTGG - Intronic
936768001 2:115876969-115876991 TTGGGTTTCACATGTTGCCCAGG + Intergenic
938077633 2:128348238-128348260 CTGCCTTCCTAAAGCTGCCCTGG - Intergenic
941384463 2:164836832-164836854 CTAGTTTTAAAATGCTGCTCAGG - Intronic
941488721 2:166116089-166116111 CTGGCTTTCATGAGCTGTCCAGG - Intronic
942109231 2:172663707-172663729 CTGGGATTCAAATGCTGGGCAGG + Intergenic
943200299 2:184814628-184814650 CTGGCTTTCAAGAGCTGCCTGGG + Intronic
943815528 2:192249559-192249581 GTGTCTTTCAAAAGCTGCCCAGG - Intergenic
944137310 2:196413534-196413556 CAGGGTTTCAAATGTTGGCCAGG + Intronic
945292049 2:208136329-208136351 CTGACATTCAGATGCTGGCCTGG + Intergenic
945449171 2:209973987-209974009 GTGGCTTTCCATTGCTCCCCGGG - Intronic
946266597 2:218548532-218548554 CAGGGTTTCACATGTTGCCCAGG + Intronic
1170622789 20:18009464-18009486 CAGGGTCTCATATGCTGCCCAGG + Intronic
1170705367 20:18739452-18739474 CAGCCTTCCAAAAGCTGCCCTGG - Intronic
1173171304 20:40726257-40726279 AAGGCTTTTAAAAGCTGCCCAGG + Intergenic
1173912540 20:46681039-46681061 CTGGCTTTAAAAGGGTCCCCTGG + Intronic
1174241066 20:49135048-49135070 CTTGCTGGAAAATGCTGCCCAGG - Intronic
1174475699 20:50794581-50794603 CGGGCTTTTAAAAGCTTCCCGGG + Intergenic
1174523093 20:51148068-51148090 CAGGATCTCACATGCTGCCCAGG + Intergenic
1175190038 20:57205446-57205468 CTGGCTTTGAAAAGCTACCAAGG + Intronic
1175231366 20:57475494-57475516 CTGGCCCTGGAATGCTGCCCCGG - Intergenic
1179190375 21:39117725-39117747 CTGTCTTTGACATGCTGCACAGG - Intergenic
1180792910 22:18586610-18586632 CAGGATTTCATATGCTGGCCAGG - Intergenic
1181156866 22:20927968-20927990 ATGGGTTTCACATGCTGGCCAGG - Intronic
1181228827 22:21408710-21408732 CAGGATTTCATATGCTGGCCAGG + Intergenic
1181249823 22:21526155-21526177 CAGGATTTCATATGCTGGCCAGG - Intergenic
1184096571 22:42319382-42319404 ATGGCTTTCCATGGCTGCCCAGG - Intronic
1185328649 22:50240796-50240818 CGGGGTTTCACATGCTGGCCAGG - Intronic
949539831 3:5023674-5023696 CTTGCTTTCAAGTGCAGGCCTGG + Intergenic
949841211 3:8322117-8322139 TTGGCTTTCAAAATCTCCCCTGG + Intergenic
950550878 3:13665226-13665248 ATGACTTTAAAATGCTGCTCAGG - Intergenic
951667525 3:25143735-25143757 CTTGAGTTCAAATGCTGCCCTGG + Intergenic
954013605 3:47665151-47665173 CTGGGTTCCAACTGCTGCTCAGG + Intronic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
955025641 3:55164823-55164845 CTGGCTTTAAAATGCTTTCTTGG + Intergenic
955915339 3:63902215-63902237 CGGGGTTTCAAATGTTGCCCAGG - Intronic
957501731 3:81066640-81066662 CTGGCTTTCTCCTGCTACCCAGG + Intergenic
958075300 3:88668732-88668754 CTGGCTTTCACACTGTGCCCTGG - Intergenic
960156825 3:114305001-114305023 GTGTCTTTTAAATGCTGCCAAGG + Intronic
961111178 3:124284445-124284467 TTGTCTTTCAAGTGCTGTCCAGG + Intronic
962320844 3:134389161-134389183 CTGGGTTTCAGATGCTCCCCAGG - Intergenic
962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG + Intergenic
963146617 3:142001161-142001183 CTAGATTTCAAAAGATGCCCTGG - Intronic
963798223 3:149652428-149652450 CAGGGTTTCCTATGCTGCCCAGG - Intronic
964899971 3:161646830-161646852 ATGGCTTTCCCATGCTGACCAGG - Intergenic
968204466 3:196787013-196787035 CAGGCTCTCATATGTTGCCCAGG + Intronic
968456422 4:702871-702893 ATGGCTTTCCAAGGCTGCTCTGG - Intergenic
970504501 4:16713735-16713757 ATGGATTTCATAGGCTGCCCTGG + Intronic
972137903 4:35915798-35915820 CTGGATTTCAGATGTTGCCTGGG + Intergenic
974887202 4:67834215-67834237 CTGGCTTTTAAGTAGTGCCCTGG + Intronic
975176312 4:71293370-71293392 CTGGGTTTCACATGTTGCCCAGG - Intronic
975942745 4:79667865-79667887 TTGACTTTCAACTGCTGCCATGG - Intergenic
978491426 4:109315527-109315549 CTGGCTTCCTCATGCTGCCTGGG - Intergenic
982951087 4:161697022-161697044 CTTTCTTACAAATGCTGCCTAGG + Intronic
984716150 4:182927137-182927159 CAGGGTTTCACATGTTGCCCAGG + Intergenic
985956852 5:3272079-3272101 CTGAATTTCAAATGCAGCCAGGG - Intergenic
987033485 5:13996988-13997010 CTAGATTTCAAAGGATGCCCTGG - Intergenic
987128720 5:14840746-14840768 CTGGCTTTCTAATGATGCCCAGG + Intronic
990305416 5:54489889-54489911 CGGGGTTTCACATGTTGCCCAGG - Intergenic
994116570 5:96067930-96067952 ATGGCTTTTAAATGCAGCCCTGG + Intergenic
996155611 5:120095145-120095167 CTGTATTTAAAATGCTGCCCAGG + Intergenic
996269252 5:121582525-121582547 TTGGCTTTCAAGAGCTGCCCAGG + Intergenic
997724250 5:136106910-136106932 CTGGCTCTCACCTGCTGCCCAGG - Intergenic
1000397490 5:160791024-160791046 CCAGCTTTTAGATGCTGCCCAGG - Intronic
1002667799 5:180839272-180839294 CTTCCTCTCACATGCTGCCCTGG + Intergenic
1002830537 6:816455-816477 CTGGCTTTCACACGCTAACCAGG - Intergenic
1002879821 6:1241510-1241532 ATTGCTTTAAAATACTGCCCAGG + Intergenic
1003081644 6:3025980-3026002 TTGGCCTACAAATGCAGCCCAGG + Intergenic
1003121184 6:3320089-3320111 CTGGGTTTCAACACCTGCCCGGG - Intronic
1003249499 6:4413599-4413621 CTGGCTGTCATGTGCTGCGCTGG + Intergenic
1003490273 6:6615183-6615205 CTGGTTTTCAAATGCTCCCCAGG - Intronic
1004158773 6:13194937-13194959 GTGGTTTTCACATGCTGACCTGG + Intronic
1005509543 6:26500269-26500291 CTGGCTTTTAACTTTTGCCCCGG + Intergenic
1006026361 6:31149632-31149654 CGGGATTTCACATGTTGCCCAGG + Intronic
1006786020 6:36667853-36667875 CAGGCTTCCTAATGGTGCCCTGG + Intergenic
1006823535 6:36917264-36917286 CTGCCTATCAAATCCTTCCCAGG - Intronic
1009020327 6:57941935-57941957 AAGGTTTTGAAATGCTGCCCAGG + Intergenic
1010540748 6:77089133-77089155 CTGGCTTTGGAATGAGGCCCAGG - Intergenic
1011180828 6:84618560-84618582 CAGGCTTTCAAAGGTTGCCAAGG + Intergenic
1011204957 6:84881906-84881928 CTGGCTTTCAAATTTTCCCTGGG - Intergenic
1015304946 6:131697064-131697086 CTGGCTTTAAAAAGGTGCTCAGG - Intronic
1018324381 6:162649396-162649418 CTGGGTTAGACATGCTGCCCTGG - Intronic
1019029752 6:169000136-169000158 CTGTGTTTCCAGTGCTGCCCCGG + Intergenic
1019037916 6:169077237-169077259 CTGGCTCACAAATGCTGGCAAGG + Intergenic
1021095822 7:16535004-16535026 CAGGGTTTCATATGTTGCCCAGG - Intronic
1021416660 7:20393858-20393880 CCAGCTCTCAAATGCTGGCCAGG + Intronic
1021607736 7:22426081-22426103 GTGGCCATCAAATACTGCCCTGG + Intronic
1022446889 7:30478314-30478336 CTGGATTTTAAAAGCTCCCCAGG + Intronic
1023102422 7:36732828-36732850 CTGGATATTAAATGCTGCCCTGG + Intergenic
1027267674 7:76503263-76503285 CTGGCTTCCAACAGCTTCCCTGG - Intronic
1027319486 7:77003126-77003148 CTGGCTTCCAACAGCTTCCCTGG - Intergenic
1028238711 7:88392931-88392953 TTGGATTTCAAATTCTGCCTGGG - Intergenic
1029295634 7:99538270-99538292 CGGGCTCTCACATGTTGCCCTGG + Intergenic
1033127088 7:138715806-138715828 CTGTGTTTGAAATGCAGCCCAGG + Exonic
1033159928 7:138986210-138986232 CTGTCTTTTAAAAGCTTCCCAGG + Intergenic
1033677873 7:143561635-143561657 CAGGGTTTCACATGTTGCCCAGG - Intergenic
1033693964 7:143767802-143767824 CAGGGTTTCACATGTTGCCCAGG + Intergenic
1034500319 7:151446617-151446639 CTGTCTCTCAAACGCTACCCAGG - Intergenic
1035209494 7:157317346-157317368 CTGGCCTTGAACTCCTGCCCAGG - Intergenic
1035328643 7:158082313-158082335 CTGGGTGTCATATGCTGCCTTGG - Intronic
1036442550 8:8794238-8794260 CTGGCTTTCAACTCCAGCCGAGG - Intronic
1036476270 8:9096295-9096317 CTGGATTACAAATCCAGCCCCGG + Intronic
1037779519 8:21858231-21858253 CTGGCTCTGAAATCCTGCCATGG + Intergenic
1037939688 8:22942193-22942215 GAGGGTTTCAAATGCTTCCCAGG + Intronic
1038490995 8:27971145-27971167 CTGCCTTTCAGATGCAGCCTTGG + Intronic
1039757217 8:40536593-40536615 CTGGCTCTCACATGTTGCCATGG + Intronic
1040558356 8:48500904-48500926 CTGGCCTTGAAAAGCAGCCCAGG + Intergenic
1042120732 8:65485354-65485376 CGGGGTTTCACATGTTGCCCAGG + Intergenic
1043866948 8:85385636-85385658 ATGGCTCTCAAATATTGCCCAGG - Intronic
1043926805 8:86045890-86045912 GTCGCTTTCACATGCTGCCATGG - Intronic
1045384359 8:101657138-101657160 CTTGCTTGTAAATGCTGCCTAGG - Intronic
1046494184 8:114992928-114992950 CCTGCTTTAAAATGCTGCCTTGG - Intergenic
1047882564 8:129212544-129212566 CTGGATTTCTAATGCTGGCTGGG - Intergenic
1050895292 9:10879152-10879174 CTGGCTTTCAGATCCTTCACTGG - Intergenic
1052341579 9:27369217-27369239 CTGGCTTTCAAATTCTGGTTGGG - Intronic
1052610728 9:30770099-30770121 CTTGCTTTAAAATGTTGCCTAGG - Intergenic
1057839936 9:98478200-98478222 CTGCCATCCAAATGCTGCCCTGG - Intronic
1058541698 9:106018601-106018623 CTGCCTTTTAAATACTGCCATGG - Intergenic
1058803773 9:108569884-108569906 CTGGCCTCCCAATACTGCCCAGG - Intergenic
1059275442 9:113092754-113092776 CTGGGTTTCCCATGTTGCCCAGG - Intergenic
1060637270 9:125209273-125209295 CTGGTCTTCAAATCCTGACCTGG + Intronic
1061300591 9:129702758-129702780 CTGGCTTTAACAAGCTTCCCGGG + Intronic
1061530267 9:131206335-131206357 CGGGGTTTCACATGTTGCCCAGG + Intronic
1062469254 9:136695229-136695251 CTGGGTTTCACATGTTGGCCAGG - Intergenic
1188693188 X:33155609-33155631 CTGGATTTGAAATGCTGGCTGGG - Intronic
1189385795 X:40535981-40536003 CAGGGTTTCACATGTTGCCCAGG - Intergenic
1189863011 X:45292540-45292562 TTGGCTTTCAAAAGGTGTCCTGG - Intergenic
1190078837 X:47338998-47339020 CGGGGTTTCACGTGCTGCCCAGG + Intergenic
1194334595 X:92629799-92629821 CTGGATTTCAAAGGTTGCCCTGG - Intergenic
1194666270 X:96680964-96680986 CTGGCTTTTAAATGCTGATTGGG + Intergenic
1195254730 X:103080748-103080770 CTGGGCTCCCAATGCTGCCCAGG - Intronic
1196194375 X:112824588-112824610 CTGGCTTCCAACTGTTGCGCTGG + Intronic
1197955507 X:131943029-131943051 CAGGCTTTCACTTGGTGCCCTGG - Intergenic
1200643075 Y:5746853-5746875 CTGGATTTCAAAGGTTGCCCTGG - Intergenic