ID: 1119933193

View in Genome Browser
Species Human (GRCh38)
Location 14:78567426-78567448
Sequence GAAGATCCAGAGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 1, 2: 3, 3: 36, 4: 329}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119933193 Original CRISPR GAAGATCCAGAGATGGAGCA GGG (reversed) Intronic
900917950 1:5651438-5651460 GAGGAACCAGAGCTGGAGGAAGG + Intergenic
901037915 1:6347312-6347334 CCAGATCCGGAGAAGGAGCAAGG + Intronic
902151018 1:14443403-14443425 ACACATCCAGAGATGGAGGATGG + Intergenic
902720473 1:18300930-18300952 GAGGACCCAGAGATGAAGAAGGG - Intronic
902755903 1:18548941-18548963 CAAGATCAAGAGGTGGAGCTGGG + Intergenic
902922075 1:19672073-19672095 GCAGTTTCAGAGATGCAGCATGG + Intronic
904352659 1:29918976-29918998 GAAGAAACAGAGATGGAGAAAGG - Intergenic
904935522 1:34127219-34127241 GAAGAACCAGAGACTGAGTATGG + Intronic
905688294 1:39924728-39924750 GAGGATCCAGAGGAGGAGAATGG + Intergenic
909452912 1:75818728-75818750 GAATATACAGAGAAGGACCAGGG - Intronic
909490051 1:76216097-76216119 AAAGACCCTGAGATGGTGCATGG - Intronic
910237383 1:85048942-85048964 GAAGACCCAGGGAGGGAACAAGG - Intronic
910467908 1:87519791-87519813 GAAGTTCCAGATGTGCAGCAAGG - Intergenic
911169454 1:94755938-94755960 GGAGATCCAGTGCTGGAGCTGGG + Intergenic
911386046 1:97176818-97176840 TGAGAGCCAGAGATGGAACAAGG + Intronic
912410999 1:109480642-109480664 GAAGGACTAGAGAAGGAGCAGGG - Exonic
912542314 1:110426178-110426200 GATGATCTAGAGAGGAAGCAAGG - Intergenic
913136760 1:115898292-115898314 GAAGGTCTGGTGATGGAGCAAGG - Intergenic
913611550 1:120514204-120514226 GCAGATGCAGAGGTGGGGCAGGG - Intergenic
913983244 1:143542603-143542625 GCAGATGCAGAGGTGGGGCAGGG + Intergenic
913997517 1:143663600-143663622 GAAGTCCCTGAGAAGGAGCAGGG - Intergenic
914579642 1:149008035-149008057 GCAGATGCAGAGGTGGGGCAGGG + Intronic
914986129 1:152458645-152458667 GAAGTTTCAGAGATGGAAGACGG + Intergenic
915255986 1:154629189-154629211 GAAGATCCAGAGATTGGGGGTGG + Intergenic
915300503 1:154948704-154948726 GAAGAGCCAGGGAGGGAGAATGG - Intronic
918371633 1:183867240-183867262 GAAGATCCAGAGACTGAGCCTGG + Intronic
919400112 1:197103673-197103695 AAAGATTCAGAGATGGTACAGGG - Exonic
920092420 1:203464111-203464133 AAAGAGCCAGAGAGGGAGGAAGG + Intergenic
920596506 1:207277687-207277709 GAAGATACAGAGAGAGATCAGGG - Intergenic
920826352 1:209427233-209427255 GAAGAGGGAGAGAGGGAGCAGGG + Intergenic
920916191 1:210259932-210259954 GGAGCTCCAGAGATGGGGCAGGG + Intergenic
920944113 1:210512210-210512232 GCAGACCCAGAGATGGGACAGGG + Intronic
921320392 1:213932855-213932877 AAAGATCCAAAGAAGGAGGATGG - Intergenic
922392382 1:225158328-225158350 GAAAATCCAGAGATGGGGCAGGG + Intronic
922673194 1:227530633-227530655 AAAGATACAGAGCTGCAGCATGG - Intergenic
923342396 1:233018995-233019017 GAAGAGCCAGAGAGGGAGGGTGG - Intronic
1063227943 10:4033856-4033878 CCAGATTTAGAGATGGAGCACGG + Intergenic
1064502425 10:15988814-15988836 GAAGATCCAGTGAGGAAGTAAGG - Intergenic
1065747822 10:28858066-28858088 GAAGTCCCTGAGATGGTGCAGGG - Intronic
1066961340 10:42230621-42230643 GAGGATCCAGAGAAACAGCAGGG + Intergenic
1067103306 10:43348948-43348970 GGAGAGAGAGAGATGGAGCAAGG + Intergenic
1067184243 10:44013654-44013676 GAAGATGCAGAGATACAGAAAGG - Intergenic
1067660352 10:48232769-48232791 GAAGAGACAGAGCTGGAGCAAGG + Intronic
1067808543 10:49409698-49409720 GAAGAGCCAGGGATGCAGGAGGG - Intergenic
1067934947 10:50602225-50602247 GAAGAAGCAGAGATGGGGCAGGG - Intronic
1069795299 10:71048042-71048064 GAGAATCCAGAGATGGACCCAGG + Intergenic
1071159803 10:82732563-82732585 GAAGAAACAGAGATTGAGAAAGG - Intronic
1073855995 10:107673966-107673988 CAAGATCCAGAGTAGGAGAATGG + Intergenic
1075287827 10:121202468-121202490 GAAGATACAGAGCAGAAGCAGGG - Intergenic
1076567132 10:131406599-131406621 GAAGATACAGAGAAAGAGCTTGG - Intergenic
1079883251 11:25952901-25952923 GAAGATCCAGAGAATTGGCAGGG - Intergenic
1083387076 11:62319085-62319107 GAAGATCCAGAGAAGGAGGGAGG + Intergenic
1083714272 11:64566960-64566982 GCAGACCCTGAGATGGAGAAGGG + Intronic
1083778096 11:64903922-64903944 GAAGAACCACAAATGCAGCAGGG - Intronic
1084194765 11:67518207-67518229 GAAGATGCTGAGATGGAGTTAGG + Intergenic
1084413481 11:69017076-69017098 GAAGAACCAGACATGGGGCATGG + Intergenic
1084680845 11:70665433-70665455 GAAAATTCTCAGATGGAGCAGGG - Intronic
1084780828 11:71407273-71407295 GAAGAGCCAGAGATGGGAGACGG + Intergenic
1085332475 11:75665604-75665626 GAAGATCAAGAAATGAAGTAGGG + Intronic
1086396111 11:86416760-86416782 GATGAACCAGAGAAGGACCAGGG - Intronic
1086932962 11:92713124-92713146 GTAGACCCAGAGATGGACCCAGG + Intronic
1088650672 11:111955401-111955423 GCTGATCCAGAGCTGGAGCAGGG + Intronic
1089139140 11:116272404-116272426 GAAGACCAGGAGAGGGAGCAGGG + Intergenic
1089743213 11:120599368-120599390 GAGGCTCCAGGGATGGAGGAGGG + Intronic
1090261050 11:125320465-125320487 GAGGAGCCAGAGATGCAGAAAGG + Intronic
1090393349 11:126403674-126403696 GAAGATGGAGAGAGGGAGCAGGG + Intronic
1090604591 11:128408012-128408034 GAAGTTTCAGATTTGGAGCAAGG + Intergenic
1092206400 12:6616822-6616844 GAAAATCCAAAGATAGAGAAGGG - Intergenic
1092219242 12:6701328-6701350 GATAATCCAAAGATGGTGCAAGG - Intergenic
1092510976 12:9156359-9156381 CAAGATCCAGAGATGGAGGAAGG - Intronic
1094800261 12:34024845-34024867 GAGGATACAGAGAAGGAGCAGGG + Intronic
1095113055 12:38319145-38319167 GAGGACACAGAGAAGGAGCAGGG + Intronic
1095951193 12:47782956-47782978 GAAGATACAGACATGGAGGAGGG - Exonic
1096264557 12:50112564-50112586 GAAGAGGCAGAGTTGGAGCGTGG - Intronic
1098603846 12:72365976-72365998 GAAGATGCAAAGATGGAGAAAGG - Intronic
1099241332 12:80142849-80142871 GAAGATGTAGAGATACAGCAGGG + Intergenic
1100825873 12:98473729-98473751 GACCATCCAGGGAAGGAGCAAGG - Intergenic
1104357622 12:128101634-128101656 GACCATGCAGAGATGGAGCCAGG - Intergenic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1104990581 12:132621868-132621890 GAAGGGGCAGAGATGGGGCAAGG - Exonic
1106780795 13:33057132-33057154 GAAGGTCAAGAGATAGAACAAGG - Intronic
1107781978 13:43913137-43913159 GAACAGCCAGAGAGGGAGAAGGG + Intergenic
1108165281 13:47686710-47686732 TAAGACCAAGAGGTGGAGCATGG - Intergenic
1108485346 13:50917946-50917968 AAACATACTGAGATGGAGCATGG - Intronic
1108712397 13:53046483-53046505 GAAAAACCAGATATGTAGCAGGG + Intronic
1110154483 13:72297916-72297938 GTAGAGCCATAGATGGAGAAGGG - Intergenic
1112243895 13:97710560-97710582 CAACATGCAGTGATGGAGCAGGG - Intergenic
1113215133 13:108031104-108031126 AAAGTCCCAGAGATGAAGCATGG - Intergenic
1114668485 14:24396264-24396286 CAAGTTCCAGAGATGGGGCAGGG - Intergenic
1115161594 14:30402551-30402573 GAATATCAAGAGATGTTGCATGG + Intergenic
1115486770 14:33917856-33917878 AAAGCTACAGGGATGGAGCATGG - Intergenic
1115895868 14:38086261-38086283 GAAATTCTAGAGGTGGAGCAGGG + Intergenic
1117019764 14:51557806-51557828 GAAGGTCGAGAGAGGGAGGAGGG + Intronic
1117043670 14:51791039-51791061 GAACATCCAGAGGTCCAGCATGG + Intergenic
1118369515 14:65125535-65125557 GCATAGCCAGAGCTGGAGCAAGG + Intergenic
1118777805 14:68984487-68984509 GGAGGTCCTGAGATGGACCAAGG + Intergenic
1118945517 14:70382735-70382757 GAAGTTTCAGAGAATGAGCATGG + Intronic
1119933193 14:78567426-78567448 GAAGATCCAGAGATGGAGCAGGG - Intronic
1120554813 14:85916509-85916531 GAAGTTCCAGAGCTGGAGGGGGG + Intergenic
1122195671 14:100083166-100083188 AGAGATCCTGAGATGCAGCATGG - Intronic
1202921248 14_KI270723v1_random:31992-32014 GCAGATCCAGGGCTGGAACACGG - Intergenic
1123443684 15:20306762-20306784 GAGGATCCAGAGCAAGAGCAGGG - Intergenic
1123818870 15:24006194-24006216 GAAGATCCTGTGATAGAGCAGGG - Intergenic
1123832414 15:24154406-24154428 TAAGATCCTGTGATGGAGCAGGG + Intergenic
1123837946 15:24214870-24214892 TAAGATCCTGTGATGGAGCAGGG - Intergenic
1123847479 15:24317167-24317189 TAAGATCCTGTGATGGAACAGGG - Intergenic
1123866527 15:24524547-24524569 TAAGATCCTGTGATGGAGCAGGG - Intergenic
1123873459 15:24599220-24599242 GAAGATACTGTGATGGATCAGGG - Intergenic
1123889129 15:24757752-24757774 GAACATGCAGAGATGGTGGAGGG + Intergenic
1123893606 15:24806163-24806185 TAAGATTCAGAACTGGAGCATGG - Intergenic
1127707660 15:61562976-61562998 GAAGGTGCAGAGAAAGAGCATGG - Intergenic
1129506017 15:76082045-76082067 GAGGATGAAGAGATGAAGCATGG - Intronic
1130133205 15:81160729-81160751 GACGATGCAGGGATGGAGGAAGG - Intronic
1131292501 15:91118841-91118863 GAGGAACCAGAAATGGAGGAAGG - Intronic
1131300432 15:91194979-91195001 GAAGATGAAGGCATGGAGCAGGG + Intronic
1133203780 16:4220607-4220629 GGATATCCAGAGAGGGAGCCAGG - Intronic
1133864114 16:9625914-9625936 GAAGATCCAGGGAGGTACCATGG - Intergenic
1134058295 16:11183531-11183553 GTAGACCCAGGGCTGGAGCAGGG - Intergenic
1134233744 16:12449606-12449628 GGAGATGCACAGCTGGAGCACGG - Intronic
1135488744 16:22888678-22888700 GAAAAGCCAGAGACGGAGCCAGG - Intronic
1136722526 16:32337129-32337151 GAGGATCCAGAGAAAGGGCAGGG + Intergenic
1137319959 16:47370495-47370517 GGACAACCAGAGATTGAGCAAGG - Intronic
1138264411 16:55650271-55650293 GAAGAGCCAGGGAAGGAGAAAGG - Intergenic
1139971376 16:70777690-70777712 GAAGATGCGGAGGTGGGGCAGGG + Intronic
1141487379 16:84349742-84349764 GAGGATCCTGAGATGGAGAGAGG + Intergenic
1141743660 16:85911605-85911627 GAAGTTACAGAGATGGAGTGCGG + Exonic
1142022275 16:87791297-87791319 GAAGATCCAGCCAGGGAGCTGGG + Intergenic
1142237944 16:88931502-88931524 GACGAGCCAGAGGTGGAGAAGGG + Intronic
1142237958 16:88931543-88931565 GACGAGCCAGAGGTGGAGAAGGG + Intronic
1142237972 16:88931584-88931606 GATGAGCCAGAGGTGGAGAAGGG + Intronic
1142237986 16:88931625-88931647 GACGAGCCAGAGGTGGAGAAGGG + Intronic
1203003905 16_KI270728v1_random:180635-180657 GAGGATCCAGAGAAAGGGCAGGG - Intergenic
1203135513 16_KI270728v1_random:1717042-1717064 GAGGATCCAGAGAAAGGGCAGGG - Intergenic
1143278689 17:5733853-5733875 GAAGCTCCTTAGATGAAGCAAGG + Intergenic
1143385553 17:6527992-6528014 CAAAAGCCAAAGATGGAGCAGGG - Intronic
1143595289 17:7910362-7910384 GGAAATACAGAGATGGAGCCAGG - Intronic
1143646675 17:8234826-8234848 GAAGATCCAGGGTAGGAGCCAGG + Exonic
1144554877 17:16273348-16273370 GAAGATCAAGTGAGGGAGCCAGG + Intronic
1146567862 17:33928767-33928789 GCAGATCCACAGATGGAGGAGGG + Intronic
1148680006 17:49468207-49468229 GAAGCTTCAGAGATGGTGGAAGG + Intronic
1148682844 17:49484525-49484547 AAAGAACCAGAGAAGGAGAAAGG - Intergenic
1148740564 17:49890288-49890310 GAAGATCCAGCGAAGGTGCTGGG - Intergenic
1150753686 17:67890465-67890487 TAAAATCCAGAGATGGAGAAGGG - Intronic
1150977885 17:70109424-70109446 ACAGATCCAGATATGGAGCTGGG - Intronic
1151670262 17:75568389-75568411 GAAGCTCCAGGGTTGGAGCCAGG - Intronic
1151798400 17:76362396-76362418 GAAGAGACAGAAACGGAGCAAGG + Intronic
1151880009 17:76889165-76889187 GAAGATGCAGGGCTGGCGCAGGG + Intronic
1152597838 17:81246521-81246543 TAAGGTCCTGGGATGGAGCAGGG + Exonic
1153842022 18:9015906-9015928 GGAGAGCCAGAGCTGGAGCCAGG - Intergenic
1153961874 18:10147126-10147148 GCAGATGCTGAGATGGAGCTTGG + Intergenic
1154199480 18:12289348-12289370 AAAGATCCAGAGATGGGGAAGGG + Intergenic
1155268915 18:24120632-24120654 GAAGTTCCAGAGATGGATGCTGG - Intronic
1155424959 18:25697287-25697309 GAAAATCCAGAGCTGCAACATGG + Intergenic
1155917793 18:31573079-31573101 AAAGATACAGAAATGAAGCAGGG - Intergenic
1159090265 18:63840374-63840396 CCAGATCCAGAAATGTAGCAGGG + Intergenic
1159978513 18:74746646-74746668 CAAGATACAGAGATGGAAGATGG - Intronic
1160282287 18:77502740-77502762 GATGGGCCAGAGATGGGGCAGGG - Intergenic
1160483156 18:79261500-79261522 GCAGATCCAGAGCTGGAGAGAGG + Intronic
1160783634 19:889754-889776 GCAGATCAAGTGCTGGAGCATGG - Exonic
1160822737 19:1066090-1066112 GGAGAGCCAGACTTGGAGCAAGG + Exonic
1160983274 19:1826462-1826484 GAAGAGACAGAGATGGGGGAAGG + Intronic
1161329217 19:3678432-3678454 GAGGATGGAGAGATGGAGGATGG + Intronic
1161359715 19:3841075-3841097 GTAGAGCCAGAGATGGGGCCTGG - Intronic
1162016905 19:7851062-7851084 TGAGACCCAGAGGTGGAGCATGG - Intronic
1162530025 19:11230618-11230640 GAGGATGCAGAGGTGGAGGAGGG + Intronic
1162764331 19:12909145-12909167 GAAGATACAAAGATGAAGGATGG - Intronic
1164562741 19:29304049-29304071 GGAAATCCAGAGGTGGAGGAAGG + Intergenic
1164718170 19:30408850-30408872 GAAGATCGATGGATGGAGGATGG - Intronic
1165957714 19:39512123-39512145 AAAGAGCCTGAGATGGAGAATGG - Intergenic
1166760604 19:45221963-45221985 GAACCTCCAAAAATGGAGCAAGG + Intronic
1168072054 19:53958870-53958892 GAAGATGCGGAGAGGGAGCGGGG - Intergenic
1168434950 19:56309596-56309618 GGAGTTCCAGGGATGGATCAGGG - Intronic
925118119 2:1397654-1397676 CAAGGACCAGAGATGCAGCAGGG - Intronic
925389151 2:3483698-3483720 GAGCACCCAGAGATGGAGGAAGG + Intronic
925591488 2:5514341-5514363 GCAAATCCAGAAATGCAGCAAGG + Intergenic
925811733 2:7708016-7708038 GAAGATCTAGAGATGGGGGCGGG + Intergenic
926098445 2:10097805-10097827 TAAGAGCCAGTGATGGTGCAGGG - Intergenic
926104152 2:10139835-10139857 GAGGATCCAGGGGTGGAGGAAGG - Intergenic
926724141 2:15984404-15984426 GAGCATCCAGAAATGCAGCATGG - Intergenic
926943372 2:18161718-18161740 GAAGAGAAAGAGATGGTGCATGG - Intronic
927155122 2:20216896-20216918 GAAGATCCACAGAGAGAGCCAGG + Intronic
927305100 2:21562240-21562262 GAGAAGCCAGAGATGGAGGAAGG + Intergenic
927719980 2:25376409-25376431 GAAGAGCCAGAGAGGGGCCACGG + Intergenic
928102840 2:28449470-28449492 GAAGTTCCTGAGATGGTGAAGGG - Intergenic
929111649 2:38409989-38410011 AAAGAGCCAGAGAGGGAGAAGGG + Intergenic
929753538 2:44742404-44742426 GAATATACAGACTTGGAGCATGG - Intronic
931122800 2:59239037-59239059 GAAGAATCAGAGGTGGAGGAGGG + Intergenic
932016032 2:68027108-68027130 CAGGATCTAGAGATGGGGCAAGG - Intergenic
933793645 2:85903409-85903431 GAAGAACAAGAGACTGAGCAAGG - Intergenic
934323580 2:91986472-91986494 GAGGATCCAGAGAAACAGCAGGG - Intergenic
934555526 2:95285201-95285223 GAAGAGCCAGAGCTGGGACAAGG - Intronic
935051476 2:99528684-99528706 GAAGAGGCAGGGAGGGAGCAAGG - Intergenic
935620677 2:105127006-105127028 GCAGATGCTGAGATGGAGCTTGG + Intergenic
935839934 2:107098197-107098219 GTAGAGCCAGAGATGTAGAAAGG - Intergenic
936694695 2:114931752-114931774 GAAGATCCTGACATGCAGCTTGG - Intronic
937298575 2:120824563-120824585 TTACAGCCAGAGATGGAGCAGGG - Intronic
937326587 2:120993113-120993135 GTAGGGCCAGAGACGGAGCAGGG + Intergenic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
939194020 2:138950169-138950191 ACAGATGCAGAGATGGATCAGGG - Intergenic
939919138 2:148086895-148086917 GAAGATTGAGAGATAGAGAAGGG - Intronic
941715836 2:168762341-168762363 GAAGCTCCAGCCATTGAGCATGG - Intronic
942123092 2:172797976-172797998 CAAGATACAAAGATGGAGAAAGG - Intronic
943452035 2:188055228-188055250 GAAGGTCCAGAGATAGATAAAGG + Intergenic
944212221 2:197218382-197218404 TAAGATCCAGAAAGGTAGCAGGG - Intronic
944691097 2:202159191-202159213 CATCATCCAAAGATGGAGCAGGG + Intronic
1169404941 20:5315262-5315284 GCAGATCCAAAGTTGGAGTAGGG - Intergenic
1170363679 20:15576397-15576419 GGAGATGCAGAGATAGAGGAAGG - Intronic
1170852662 20:20018534-20018556 GAAGTTCCGGAGAAGGAGCGGGG + Intronic
1171208832 20:23301600-23301622 GAACATCTGGAGAGGGAGCAGGG + Intergenic
1172055640 20:32152521-32152543 GAAGATGCAGAGATGGGGGTGGG - Intronic
1172178233 20:32985415-32985437 TAAGGTCCAGAGAAGGATCAGGG - Intronic
1172607749 20:36225955-36225977 GAAGAGAGAGAGATGGGGCATGG - Intronic
1173228410 20:41175500-41175522 AAAGATCCAGGGATGGAGATGGG + Exonic
1175435696 20:58945991-58946013 GTGGATCCAGAGATGGAGTGGGG + Intergenic
1179191781 21:39128699-39128721 AAAGTTCCAGAGATGGATAATGG - Intergenic
1180245367 21:46543742-46543764 GCACATGCAGAGATGGGGCAAGG - Intronic
1180550347 22:16532359-16532381 GAGGATCCAGAGAAAGGGCAGGG - Intergenic
1181681792 22:24500437-24500459 GAAGAGCCAGAGATGCAGGCTGG - Intronic
1182528760 22:30939079-30939101 GAGGATCCAGACATGGAGGTGGG + Intronic
1183040904 22:35177269-35177291 GAAGAGCCAGAGAAGGAGAGTGG + Intergenic
1184016462 22:41789572-41789594 AAAGATCTAGAGATGGATGATGG - Intronic
949942382 3:9164955-9164977 GGAGACCCAGAGACGGAGCAGGG - Intronic
950611063 3:14126826-14126848 GAAGATAGCGGGATGGAGCAGGG + Intronic
950666406 3:14497933-14497955 GGAAATCCAGAGATGGAGGTGGG + Intronic
950713642 3:14832014-14832036 GCAGAACCAGAGAGGCAGCATGG + Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953578691 3:44134209-44134231 GGAAATCAAGAGATGGAGGAAGG - Intergenic
954107799 3:48418681-48418703 GCAGAGCCAGAAATGGAGTATGG + Intronic
954621545 3:51998989-51999011 GCAGATTCAGAGATGGACGATGG + Intergenic
955047006 3:55369971-55369993 GAAGGTCCAGTGAGGGAGTAGGG + Intergenic
955286654 3:57647881-57647903 GAAGAATCAGAGAGTGAGCAGGG + Intronic
955340483 3:58121556-58121578 GAAGAACCAGAGAAGGACTATGG - Intronic
955505234 3:59626171-59626193 GAAGTTCTAGAGATGGACGATGG - Intergenic
956042683 3:65162000-65162022 CAACTTCCAGAGATGAAGCAAGG + Intergenic
956251672 3:67240284-67240306 GAATATCCAGTTATGGATCAGGG - Intergenic
956719975 3:72109071-72109093 GAATCTCCAGAGATGGGACAAGG + Intergenic
957158780 3:76581365-76581387 GGAGATCCAGAGAAAGAGAAAGG + Intronic
957946481 3:87069613-87069635 GAATAGTCAGAGATGTAGCAAGG + Intergenic
958466407 3:94464876-94464898 GATATTCAAGAGATGGAGCAAGG - Intergenic
959805511 3:110548200-110548222 GAAGATCAAGAGAGAGAGAAAGG + Intergenic
959827050 3:110810415-110810437 AAAGAATCAGAGATGGAGTAGGG + Intergenic
961081472 3:124032744-124032766 GAAGATCCAGAGAAGGCGGGCGG + Intergenic
961794598 3:129400756-129400778 GAATAGCCACAGATGCAGCAGGG - Intergenic
961918344 3:130400142-130400164 AAAGAACCAGAGATGGAAGATGG - Intronic
962309814 3:134317456-134317478 GAGGACCCAGAGATGGGGCTAGG - Intergenic
963413855 3:144969062-144969084 GATGAGCCATAGATGGATCAAGG + Intergenic
963731241 3:148975280-148975302 GAAGATCCTGAGCTGCAGAAGGG - Intergenic
965751060 3:171975461-171975483 GAGCAGCCAGAGATGGAGGAGGG + Intergenic
966879369 3:184341324-184341346 GAAGACCAAGAGGAGGAGCAAGG + Intronic
967238313 3:187410881-187410903 AAAGAGCCAGAAATGGAGCCAGG + Intergenic
967582012 3:191169757-191169779 GAAGATCCTGGGAAGCAGCATGG + Intergenic
967645098 3:191913204-191913226 GAAGATTCAGAGTTGGCTCAAGG - Intergenic
968263045 3:197340347-197340369 GAAGCTCCAGGGAAGGAGGAGGG - Intergenic
968637791 4:1690982-1691004 GATAATTCAGAGATGGAGCCAGG - Intergenic
970100651 4:12517757-12517779 GAAGATCAAGAGTGGAAGCAGGG - Intergenic
973085187 4:46050052-46050074 GAAAATCCAGAGAAGATGCATGG + Intronic
976869521 4:89774190-89774212 GAATACCCAGAGGTGGAGCTGGG - Intronic
982019332 4:151188027-151188049 GAAGAGCAAGAGAGGAAGCAGGG - Intronic
982508414 4:156249985-156250007 GAAGAGCCAGAGGTGGTGCAGGG - Intergenic
984036459 4:174674096-174674118 GAAGAGGCAGAGTGGGAGCAAGG - Intronic
984262783 4:177461947-177461969 GAAAATCCAGAGCTGGGGCTGGG + Intergenic
986292975 5:6415200-6415222 GAAGATGCAGAGATGCAGAGGGG - Intergenic
988384706 5:30546881-30546903 GAAGATTCTGAGATGGAGTCTGG + Intergenic
990370665 5:55114907-55114929 GAGGTTCCAGAGATTTAGCATGG + Intronic
990992754 5:61701451-61701473 GAAGATCAAAAGAAGGAGAAGGG - Intronic
992312020 5:75511146-75511168 GAGGATCCAGAGACGGAGTCTGG - Exonic
992833066 5:80614418-80614440 GAATATGGAGAGATGGAGCAAGG - Intergenic
992938841 5:81741388-81741410 AAAGTTCTAGAGATGGAGAACGG + Intronic
993248106 5:85478106-85478128 GTTGATCCAGAGCTGGATCAAGG + Intergenic
993310714 5:86328689-86328711 GATGATCAAGAGAAGGACCAGGG - Intergenic
993397754 5:87412261-87412283 GAAGTTACAGAGATGGTGCGTGG - Intronic
994188504 5:96841479-96841501 CAAGCTGCTGAGATGGAGCAGGG + Intronic
994328073 5:98472393-98472415 GAGGACCCAGAGATGGACCTAGG + Intergenic
995061645 5:107817184-107817206 GGAGCTCCAGAGATGGAGGTGGG + Intergenic
996236397 5:121135910-121135932 CTAGATTCTGAGATGGAGCAGGG - Intergenic
996498294 5:124187289-124187311 GAAGATCAGGAGATGTAGCCTGG + Intergenic
997230492 5:132238903-132238925 GAAGAGCCAGAGAAGCAGGATGG + Intronic
997466461 5:134091225-134091247 GAAGATCAAGAAATAGAGCACGG + Intergenic
997587531 5:135052407-135052429 GATGGTCCAGGCATGGAGCATGG + Intronic
998578286 5:143341899-143341921 GAAAATACAGAGAGGGAGGAGGG + Intronic
998784962 5:145699217-145699239 TGGGACCCAGAGATGGAGCAGGG + Intronic
999409835 5:151341177-151341199 GAAGATCCCTAAATGGAGCAGGG + Intronic
999957857 5:156721714-156721736 GAAGACCCAGAGTGTGAGCAAGG + Intronic
1000075349 5:157779391-157779413 GAAGTTCTAGAGATGGAGGGTGG + Intergenic
1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG + Intronic
1000825476 5:166038687-166038709 GCAGTTCCAGAGATGGTGCAAGG + Intergenic
1001066355 5:168537883-168537905 GAAGATGCAGAGCATGAGCAGGG + Intergenic
1002108503 5:176892358-176892380 GAAGATCCAGGGGAAGAGCAAGG + Intronic
1003955175 6:11156556-11156578 GGAAATCCAGAGATGTAGGAAGG + Intergenic
1004025306 6:11812497-11812519 GAAGACCCAGAGATTTAGAATGG + Intergenic
1004508936 6:16268772-16268794 AAAGTTCCAGAGATGGATAATGG + Intronic
1005089210 6:22038682-22038704 AAAGTTCAAGAGATGGAGTATGG - Intergenic
1006742247 6:36317492-36317514 AAAGACCCAGAGATGGAGGCTGG - Intronic
1007691961 6:43708221-43708243 AAAGACCCAGGGATGGAGCAGGG + Intergenic
1007891087 6:45292522-45292544 GAAGATACAGAAATGCAGAATGG + Intronic
1009192468 6:60645955-60645977 GAAGATCCTTAGATGGATCCAGG - Intergenic
1009522026 6:64695004-64695026 GATGAACCAAAGATGCAGCATGG - Intronic
1009704349 6:67226519-67226541 GAAAATTCAGAGTTGGAGAAGGG - Intergenic
1011369207 6:86614639-86614661 GCAGAGCCAGGGATAGAGCATGG + Intergenic
1012643312 6:101649950-101649972 GAAGATCTAGAGATGGAAAAAGG - Intronic
1012715319 6:102661220-102661242 GCAGATCCAGAGATGGTGTCTGG - Intergenic
1013176293 6:107680112-107680134 GCAGATCCTGAGCTGGAGCAAGG + Intergenic
1013197942 6:107862404-107862426 GATGATACAGAGCTGGGGCAGGG - Intergenic
1013377012 6:109527095-109527117 GGAGACCCAGAGACGGAGCCAGG + Intronic
1013974719 6:116064164-116064186 GAGGATGCAGAGGTGCAGCAGGG - Intergenic
1017971256 6:159314604-159314626 GAACAAGCAGGGATGGAGCAGGG + Intergenic
1018471990 6:164105739-164105761 GAAGATACCGAGAAGGAGCAGGG + Intergenic
1018939739 6:168301247-168301269 GAAGTTCCAGAGAAGGGGCCTGG - Intronic
1019055712 6:169221792-169221814 GAAGATCCAGACATGAACCCAGG - Intronic
1019209106 6:170390547-170390569 GCAGATCAAGAAATGGAACATGG - Intronic
1021362509 7:19733518-19733540 GAAGGTCTAGGGAAGGAGCAGGG - Intronic
1021577750 7:22119841-22119863 GAATATCCAGAGAGGGTGCATGG + Exonic
1022669968 7:32446578-32446600 GAAGATGGAGGGAGGGAGCATGG + Intergenic
1022671422 7:32459803-32459825 GAATATCCAAAGATGCAGCTGGG + Intergenic
1023024958 7:36041937-36041959 GAGGATCTAGTGAAGGAGCAGGG + Intergenic
1026423794 7:70269281-70269303 GAAGAGCCAGAACTGCAGCAAGG - Intronic
1026664023 7:72326369-72326391 GAAGAAACAGAGATGTAGCCAGG - Intronic
1029039270 7:97555993-97556015 GAAGAGCCAGGGATGGATCCAGG + Intergenic
1029957775 7:104657729-104657751 GAAGCTCCAGAGATGGAAGATGG - Intronic
1031431555 7:121676796-121676818 AATGATGCAGAGAAGGAGCAGGG - Intergenic
1031894610 7:127334817-127334839 GAAGATGCAGAGAAAGAGGAAGG + Intergenic
1033987949 7:147249665-147249687 GAAGATTCAGAGCTGGAGTTGGG + Intronic
1034277907 7:149831775-149831797 GAAGATCCTAAGAAGGATCAGGG - Intergenic
1035608522 8:945538-945560 GAAGAGACAAAGATGGGGCAGGG - Intergenic
1036490627 8:9221913-9221935 TGAGATCCAGAGCTGGAGTAAGG - Intergenic
1037637307 8:20711520-20711542 GAAGAGGCAGAGGTGGGGCATGG + Intergenic
1037890206 8:22620074-22620096 GAAGAGCAAGACATGGAGCCTGG + Exonic
1039493099 8:37962464-37962486 GAATATCCAGAGATGGGGAGAGG + Intergenic
1041309908 8:56505771-56505793 GTAAAGCCAGAGATGTAGCAAGG - Intergenic
1041378454 8:57225968-57225990 GAAGAGCTAGAGATACAGCAAGG + Intergenic
1042672765 8:71282641-71282663 GAAGAGCCAGAGAAGGAGATTGG - Intronic
1043239538 8:77915674-77915696 GATGATCCCGAGATGGATGATGG - Intergenic
1043677474 8:82975032-82975054 GGAGATCCAGAGATACAGAAGGG + Intergenic
1044516809 8:93148447-93148469 AAAGATTCAGAGATGTAGCTGGG - Intronic
1044836849 8:96303993-96304015 GAAAATCCAGAGATAAGGCAGGG - Intronic
1048835097 8:138511920-138511942 GAAGCTCCAGAGGTGGAAGACGG + Intergenic
1049166596 8:141129432-141129454 GAGGGTGCAGAGATGGAGGAAGG - Intronic
1052104217 9:24492409-24492431 CAAAATCCAAAGATGGAGCGAGG + Intergenic
1054874150 9:70077718-70077740 GAACATCCAAAGAGGAAGCAAGG - Intronic
1055501879 9:76909433-76909455 AATGTTCCAGAGATGGAGCTTGG - Intergenic
1055793615 9:79949961-79949983 GCAGACCCAGGGATGGAGAAGGG + Intergenic
1056752657 9:89363435-89363457 GATGATGCAGAGCTGGAGGAAGG - Intronic
1058555327 9:106160525-106160547 GAAGAGGAACAGATGGAGCAGGG + Intergenic
1059918570 9:119132069-119132091 GAAGACCCAGACATGGTTCAGGG + Intergenic
1059990775 9:119863257-119863279 GGAGATACAGAGATTGAACAAGG + Intergenic
1060023004 9:120148494-120148516 GAAGATGAAGAGAGGGATCAGGG + Intergenic
1060548084 9:124472243-124472265 GAAGATTCAGAGATGAAGATTGG - Intronic
1061176185 9:128998782-128998804 GGATATCCTGAGATGGAGCAGGG + Intronic
1061255791 9:129453736-129453758 GAAGATGGAGAGATGGGGAATGG + Intergenic
1062461393 9:136663992-136664014 GCAGATCCAGAGATGAGGCCAGG + Intronic
1185840319 X:3383505-3383527 GAAGAGCCTGAGATGGAGCAAGG + Intergenic
1186256748 X:7730295-7730317 GAAGTTCCAGAGCTTGTGCAAGG + Intergenic
1186637283 X:11420230-11420252 GTAGATCCAGTGATGCAACAAGG - Intronic
1188079674 X:25821733-25821755 GAAGATGGAGATATGGACCAAGG + Intergenic
1188545825 X:31305591-31305613 GAAGAGCCAGAGTGGAAGCAGGG - Intronic
1190311939 X:49122892-49122914 GGAGATCCAGACATGGAGTAGGG - Intronic
1190940034 X:55031136-55031158 GAAGAGCCAGAGCTGGGGGAGGG - Intergenic
1192399143 X:70816873-70816895 GAAGAATCAGAGAATGAGCATGG + Intronic
1193170468 X:78329843-78329865 AAAGATAAAGAGATGAAGCAAGG - Intergenic
1193712592 X:84896277-84896299 AAAGATCCATAGAAGAAGCATGG + Intergenic
1194400195 X:93432240-93432262 GAGGATCCAGACAAGGAGGAAGG + Intergenic
1195677924 X:107521669-107521691 GAAGCTCTAGAGATCCAGCATGG - Intergenic
1196675564 X:118417121-118417143 AAAGATACAGAGATGCAGAATGG - Intronic
1198638022 X:138721629-138721651 AAAGATACAGAGATGGAACTAGG - Intronic
1199984262 X:152939044-152939066 GGAGGGCCACAGATGGAGCAGGG + Intronic
1200061299 X:153484971-153484993 GAACATGGAGAGAGGGAGCAGGG - Intronic
1200135797 X:153874001-153874023 GAAGGTCCAGGGAGGGAGGAGGG + Intronic
1201070618 Y:10144586-10144608 GCACAGCCAGAGATGGAGCTTGG - Intergenic
1201190992 Y:11441452-11441474 GAAGATCCAGAGAAGGAGCAGGG - Intergenic
1201235660 Y:11908415-11908437 GAAGAGCCTGAGATGGAGTAAGG - Intergenic