ID: 1119936837

View in Genome Browser
Species Human (GRCh38)
Location 14:78599847-78599869
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 236}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119936837_1119936846 16 Left 1119936837 14:78599847-78599869 CCCATGAAAAGCTTGCTGCCTGG 0: 1
1: 0
2: 1
3: 21
4: 236
Right 1119936846 14:78599886-78599908 GTACCACCAGCTATCATTATAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1119936837_1119936844 -8 Left 1119936837 14:78599847-78599869 CCCATGAAAAGCTTGCTGCCTGG 0: 1
1: 0
2: 1
3: 21
4: 236
Right 1119936844 14:78599862-78599884 CTGCCTGGTGGTGGGGAAGATGG 0: 1
1: 0
2: 6
3: 77
4: 662
1119936837_1119936849 21 Left 1119936837 14:78599847-78599869 CCCATGAAAAGCTTGCTGCCTGG 0: 1
1: 0
2: 1
3: 21
4: 236
Right 1119936849 14:78599891-78599913 ACCAGCTATCATTATAGGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1119936837_1119936851 26 Left 1119936837 14:78599847-78599869 CCCATGAAAAGCTTGCTGCCTGG 0: 1
1: 0
2: 1
3: 21
4: 236
Right 1119936851 14:78599896-78599918 CTATCATTATAGGCTGGGCCAGG 0: 1
1: 0
2: 2
3: 19
4: 268
1119936837_1119936848 20 Left 1119936837 14:78599847-78599869 CCCATGAAAAGCTTGCTGCCTGG 0: 1
1: 0
2: 1
3: 21
4: 236
Right 1119936848 14:78599890-78599912 CACCAGCTATCATTATAGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119936837 Original CRISPR CCAGGCAGCAAGCTTTTCAT GGG (reversed) Intronic