ID: 1119936839

View in Genome Browser
Species Human (GRCh38)
Location 14:78599848-78599870
Sequence ACCAGGCAGCAAGCTTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119936839_1119936846 15 Left 1119936839 14:78599848-78599870 CCATGAAAAGCTTGCTGCCTGGT 0: 1
1: 0
2: 2
3: 18
4: 186
Right 1119936846 14:78599886-78599908 GTACCACCAGCTATCATTATAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1119936839_1119936848 19 Left 1119936839 14:78599848-78599870 CCATGAAAAGCTTGCTGCCTGGT 0: 1
1: 0
2: 2
3: 18
4: 186
Right 1119936848 14:78599890-78599912 CACCAGCTATCATTATAGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 52
1119936839_1119936849 20 Left 1119936839 14:78599848-78599870 CCATGAAAAGCTTGCTGCCTGGT 0: 1
1: 0
2: 2
3: 18
4: 186
Right 1119936849 14:78599891-78599913 ACCAGCTATCATTATAGGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1119936839_1119936844 -9 Left 1119936839 14:78599848-78599870 CCATGAAAAGCTTGCTGCCTGGT 0: 1
1: 0
2: 2
3: 18
4: 186
Right 1119936844 14:78599862-78599884 CTGCCTGGTGGTGGGGAAGATGG 0: 1
1: 0
2: 6
3: 77
4: 662
1119936839_1119936851 25 Left 1119936839 14:78599848-78599870 CCATGAAAAGCTTGCTGCCTGGT 0: 1
1: 0
2: 2
3: 18
4: 186
Right 1119936851 14:78599896-78599918 CTATCATTATAGGCTGGGCCAGG 0: 1
1: 0
2: 2
3: 19
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119936839 Original CRISPR ACCAGGCAGCAAGCTTTTCA TGG (reversed) Intronic