ID: 1119936844

View in Genome Browser
Species Human (GRCh38)
Location 14:78599862-78599884
Sequence CTGCCTGGTGGTGGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 746
Summary {0: 1, 1: 0, 2: 6, 3: 77, 4: 662}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119936837_1119936844 -8 Left 1119936837 14:78599847-78599869 CCCATGAAAAGCTTGCTGCCTGG 0: 1
1: 0
2: 1
3: 21
4: 236
Right 1119936844 14:78599862-78599884 CTGCCTGGTGGTGGGGAAGATGG 0: 1
1: 0
2: 6
3: 77
4: 662
1119936839_1119936844 -9 Left 1119936839 14:78599848-78599870 CCATGAAAAGCTTGCTGCCTGGT 0: 1
1: 0
2: 2
3: 18
4: 186
Right 1119936844 14:78599862-78599884 CTGCCTGGTGGTGGGGAAGATGG 0: 1
1: 0
2: 6
3: 77
4: 662

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119936844 Original CRISPR CTGCCTGGTGGTGGGGAAGA TGG Intronic