ID: 1119936845

View in Genome Browser
Species Human (GRCh38)
Location 14:78599865-78599887
Sequence ACTCCATCTTCCCCACCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 2, 3: 54, 4: 357}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119936845_1119936848 2 Left 1119936845 14:78599865-78599887 CCTGGTGGTGGGGAAGATGGAGT 0: 1
1: 0
2: 2
3: 54
4: 357
Right 1119936848 14:78599890-78599912 CACCAGCTATCATTATAGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 52
1119936845_1119936846 -2 Left 1119936845 14:78599865-78599887 CCTGGTGGTGGGGAAGATGGAGT 0: 1
1: 0
2: 2
3: 54
4: 357
Right 1119936846 14:78599886-78599908 GTACCACCAGCTATCATTATAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1119936845_1119936852 15 Left 1119936845 14:78599865-78599887 CCTGGTGGTGGGGAAGATGGAGT 0: 1
1: 0
2: 2
3: 54
4: 357
Right 1119936852 14:78599903-78599925 TATAGGCTGGGCCAGGTGATAGG 0: 1
1: 0
2: 0
3: 14
4: 222
1119936845_1119936849 3 Left 1119936845 14:78599865-78599887 CCTGGTGGTGGGGAAGATGGAGT 0: 1
1: 0
2: 2
3: 54
4: 357
Right 1119936849 14:78599891-78599913 ACCAGCTATCATTATAGGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1119936845_1119936851 8 Left 1119936845 14:78599865-78599887 CCTGGTGGTGGGGAAGATGGAGT 0: 1
1: 0
2: 2
3: 54
4: 357
Right 1119936851 14:78599896-78599918 CTATCATTATAGGCTGGGCCAGG 0: 1
1: 0
2: 2
3: 19
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119936845 Original CRISPR ACTCCATCTTCCCCACCACC AGG (reversed) Intronic