ID: 1119936846

View in Genome Browser
Species Human (GRCh38)
Location 14:78599886-78599908
Sequence GTACCACCAGCTATCATTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 43}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119936837_1119936846 16 Left 1119936837 14:78599847-78599869 CCCATGAAAAGCTTGCTGCCTGG 0: 1
1: 0
2: 1
3: 21
4: 236
Right 1119936846 14:78599886-78599908 GTACCACCAGCTATCATTATAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1119936845_1119936846 -2 Left 1119936845 14:78599865-78599887 CCTGGTGGTGGGGAAGATGGAGT 0: 1
1: 0
2: 2
3: 54
4: 357
Right 1119936846 14:78599886-78599908 GTACCACCAGCTATCATTATAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1119936839_1119936846 15 Left 1119936839 14:78599848-78599870 CCATGAAAAGCTTGCTGCCTGGT 0: 1
1: 0
2: 2
3: 18
4: 186
Right 1119936846 14:78599886-78599908 GTACCACCAGCTATCATTATAGG 0: 1
1: 0
2: 0
3: 3
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119936846 Original CRISPR GTACCACCAGCTATCATTAT AGG Intronic