ID: 1119936848

View in Genome Browser
Species Human (GRCh38)
Location 14:78599890-78599912
Sequence CACCAGCTATCATTATAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119936839_1119936848 19 Left 1119936839 14:78599848-78599870 CCATGAAAAGCTTGCTGCCTGGT 0: 1
1: 0
2: 2
3: 18
4: 186
Right 1119936848 14:78599890-78599912 CACCAGCTATCATTATAGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 52
1119936845_1119936848 2 Left 1119936845 14:78599865-78599887 CCTGGTGGTGGGGAAGATGGAGT 0: 1
1: 0
2: 2
3: 54
4: 357
Right 1119936848 14:78599890-78599912 CACCAGCTATCATTATAGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 52
1119936837_1119936848 20 Left 1119936837 14:78599847-78599869 CCCATGAAAAGCTTGCTGCCTGG 0: 1
1: 0
2: 1
3: 21
4: 236
Right 1119936848 14:78599890-78599912 CACCAGCTATCATTATAGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119936848 Original CRISPR CACCAGCTATCATTATAGGC TGG Intronic