ID: 1119936851

View in Genome Browser
Species Human (GRCh38)
Location 14:78599896-78599918
Sequence CTATCATTATAGGCTGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119936837_1119936851 26 Left 1119936837 14:78599847-78599869 CCCATGAAAAGCTTGCTGCCTGG 0: 1
1: 0
2: 1
3: 21
4: 236
Right 1119936851 14:78599896-78599918 CTATCATTATAGGCTGGGCCAGG 0: 1
1: 0
2: 2
3: 19
4: 268
1119936845_1119936851 8 Left 1119936845 14:78599865-78599887 CCTGGTGGTGGGGAAGATGGAGT 0: 1
1: 0
2: 2
3: 54
4: 357
Right 1119936851 14:78599896-78599918 CTATCATTATAGGCTGGGCCAGG 0: 1
1: 0
2: 2
3: 19
4: 268
1119936839_1119936851 25 Left 1119936839 14:78599848-78599870 CCATGAAAAGCTTGCTGCCTGGT 0: 1
1: 0
2: 2
3: 18
4: 186
Right 1119936851 14:78599896-78599918 CTATCATTATAGGCTGGGCCAGG 0: 1
1: 0
2: 2
3: 19
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119936851 Original CRISPR CTATCATTATAGGCTGGGCC AGG Intronic