ID: 1119941116

View in Genome Browser
Species Human (GRCh38)
Location 14:78642675-78642697
Sequence TGACCCTGATCTAGAGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119941116_1119941119 -1 Left 1119941116 14:78642675-78642697 CCTTCTACTCTAGATCAGGGTCA 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1119941119 14:78642697-78642719 ACCTCCAGGTCTCCTGAGCAGGG 0: 1
1: 0
2: 3
3: 26
4: 197
1119941116_1119941118 -2 Left 1119941116 14:78642675-78642697 CCTTCTACTCTAGATCAGGGTCA 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1119941118 14:78642696-78642718 CACCTCCAGGTCTCCTGAGCAGG 0: 1
1: 0
2: 4
3: 30
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119941116 Original CRISPR TGACCCTGATCTAGAGTAGA AGG (reversed) Intronic