ID: 1119941235

View in Genome Browser
Species Human (GRCh38)
Location 14:78643839-78643861
Sequence GCCTTTAGAAAGATGGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119941229_1119941235 16 Left 1119941229 14:78643800-78643822 CCCACGGCTACTCCTCAGACCTT 0: 1
1: 0
2: 0
3: 5
4: 120
Right 1119941235 14:78643839-78643861 GCCTTTAGAAAGATGGATCAAGG 0: 1
1: 0
2: 0
3: 6
4: 165
1119941233_1119941235 -3 Left 1119941233 14:78643819-78643841 CCTTGCAATATGTATGGTTTGCC 0: 1
1: 0
2: 0
3: 16
4: 159
Right 1119941235 14:78643839-78643861 GCCTTTAGAAAGATGGATCAAGG 0: 1
1: 0
2: 0
3: 6
4: 165
1119941231_1119941235 4 Left 1119941231 14:78643812-78643834 CCTCAGACCTTGCAATATGTATG 0: 1
1: 0
2: 1
3: 12
4: 153
Right 1119941235 14:78643839-78643861 GCCTTTAGAAAGATGGATCAAGG 0: 1
1: 0
2: 0
3: 6
4: 165
1119941230_1119941235 15 Left 1119941230 14:78643801-78643823 CCACGGCTACTCCTCAGACCTTG 0: 1
1: 0
2: 0
3: 13
4: 150
Right 1119941235 14:78643839-78643861 GCCTTTAGAAAGATGGATCAAGG 0: 1
1: 0
2: 0
3: 6
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119941235 Original CRISPR GCCTTTAGAAAGATGGATCA AGG Intronic
902081987 1:13827453-13827475 GGCTTTAGAAAGATTCATGAAGG + Intergenic
902974160 1:20076822-20076844 CCCTGTGGAAAGAAGGATCATGG + Intronic
904236410 1:29120442-29120464 GCCTCTGGGAAGATGGACCACGG - Exonic
905441634 1:37999860-37999882 GACTTTAGGAATATGGATAAAGG + Intronic
908995747 1:70151317-70151339 GCCTTTATAAAGTCAGATCAAGG - Intronic
910820798 1:91343450-91343472 GACTTAATAAAGATGGATGAAGG - Exonic
911363266 1:96905930-96905952 GCCATTACAAAGAGGGATTATGG + Intergenic
912496995 1:110098238-110098260 GCCTTTGGAATGAGGGATGATGG - Intergenic
912863502 1:113236413-113236435 TCCTTTAAAAAAATGCATCATGG - Intergenic
914426427 1:147581407-147581429 GCTTCTAGAAAAATGCATCAAGG + Intronic
914805457 1:150988052-150988074 GCAGTTAGAAAGATGGATGGGGG - Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
923270624 1:232352235-232352257 GTTCTTAGAAATATGGATCAGGG + Intergenic
923341124 1:233007977-233007999 GCCTTTAAGAAGATGACTCAGGG - Intronic
923739670 1:236643758-236643780 GCATCTAGAAACATGGCTCATGG + Intergenic
1064915492 10:20452244-20452266 GCCTTTAGGAAGAAGCTTCAGGG + Intergenic
1066050307 10:31628529-31628551 ACCTTTACATAGATGGATCGTGG - Intergenic
1068245067 10:54354651-54354673 TGGTTTAGAAACATGGATCATGG - Intronic
1071613306 10:87051740-87051762 ACCTTCACATAGATGGATCATGG - Exonic
1071719510 10:88129356-88129378 GCCTTCAGAAAGATAAACCATGG - Intergenic
1072588387 10:96803324-96803346 GCCTTCAGGGAGATTGATCAGGG + Intergenic
1075466572 10:122655846-122655868 GCCTGAAGAAAGATGAATGAGGG + Intergenic
1082216900 11:49582384-49582406 TTCTTTAGTAAGTTGGATCATGG + Intergenic
1083325332 11:61870162-61870184 GCCTTTACCAAGCTGGACCAGGG + Intergenic
1084391132 11:68877857-68877879 GCCTTTAGGAAAATGGATTCTGG - Intergenic
1085237252 11:75024787-75024809 GCCTTTATAAAGATGGGAGAGGG + Intergenic
1086155422 11:83660364-83660386 GTCTTCAGAAATATGAATCAAGG + Intronic
1088710921 11:112507746-112507768 TCCTTTAGAAAGATCTATAATGG + Intergenic
1094207817 12:27859322-27859344 GCCGATAGAAAGATGGAACAAGG + Intergenic
1095608765 12:44102465-44102487 GCATTTAGAGAGATGGATAGAGG - Intronic
1096873949 12:54612842-54612864 GCCTTTTCAAAGATGGCTCCTGG + Intergenic
1097365832 12:58711322-58711344 GCCATTGGCAAGATGGATGATGG + Intronic
1098569120 12:71968979-71969001 GCCCATAGAAAGATGCATAACGG + Intronic
1098955479 12:76685241-76685263 GCTTTTTGAAAAATGGATGAAGG + Intergenic
1104717044 12:131022758-131022780 GCGTTTAGAAAGCAGGATTAGGG + Intronic
1105612433 13:21980761-21980783 GCTTTCAGAAAGATTGATGATGG + Intergenic
1105719855 13:23102372-23102394 GCCTTGGGAAAGCTGGCTCAAGG - Intergenic
1111236076 13:85410001-85410023 TTCTTTAGAAAGAAGGATAAAGG - Intergenic
1114324880 14:21578635-21578657 GCCATTTGAAAGATGGGTTAGGG - Intergenic
1118778895 14:68992953-68992975 GCCTTTAGAAAGTTAATTCAGGG - Intergenic
1119000376 14:70876347-70876369 GCCCTTAGAAAAATTAATCATGG - Intergenic
1119941235 14:78643839-78643861 GCCTTTAGAAAGATGGATCAAGG + Intronic
1122850948 14:104530686-104530708 CCCTTTAAAAAGAAGAATCATGG - Intronic
1124097948 15:26666863-26666885 GCGTTGAGCAAGAAGGATCAGGG + Intronic
1124154571 15:27214394-27214416 GCCTTTAGGAAAAGGGACCAGGG - Intronic
1126034614 15:44535363-44535385 CCATTTATAAAGGTGGATCAGGG - Intergenic
1128623556 15:69174841-69174863 GACTTTAAAAAAATGGATCAGGG - Intronic
1129810061 15:78503194-78503216 CCCTTTAGAAAGACTAATCAAGG - Intergenic
1130718647 15:86363734-86363756 GCATTTGGAAATATGAATCAGGG - Intronic
1135464576 16:22674312-22674334 GACTGGAGAAAGATGGATCTGGG - Intergenic
1141168792 16:81678199-81678221 GCCTTTAGTCTGATGGGTCATGG + Intronic
1143975693 17:10827944-10827966 GACATTTGAAAGATGAATCAGGG - Intronic
1147503281 17:40987190-40987212 GCCTTAAGAAATTTGGCTCAGGG + Intergenic
1151501565 17:74493358-74493380 CCTTTTAGAAAGATGACTCAGGG + Intergenic
1152502248 17:80719998-80720020 TTCTGTTGAAAGATGGATCATGG + Intronic
1153113534 18:1624674-1624696 ATCTTTAGCGAGATGGATCAAGG - Intergenic
1153899081 18:9599725-9599747 GCCTTTATAAAGGTGCTTCAAGG - Intronic
1154220767 18:12451710-12451732 GCCTTAAGAAAGATGGAAGGAGG - Intronic
1157168110 18:45377081-45377103 ACCTTTAGAAAGTAGCATCAGGG - Intronic
1161735453 19:5989661-5989683 GGCTTTAGAAAGATGTATTCGGG - Intergenic
1164723210 19:30446901-30446923 GGCTTTGGAAATATGGATGAAGG - Intronic
1164816152 19:31204954-31204976 ACCTTTGAAAAGGTGGATCACGG + Intergenic
1164946044 19:32293940-32293962 CCCTTTAAAAATATGTATCAAGG - Intergenic
927354334 2:22156423-22156445 TCCTTTAGAAAGAAAGATCTGGG + Intergenic
928461315 2:31475676-31475698 GGCTTTAGAAACATTGATTATGG - Intergenic
928589047 2:32794684-32794706 ACCTTTAGATAGATGGACTAAGG + Intronic
929180170 2:39029828-39029850 GAATTTAGAAAGCTGGTTCAAGG + Intronic
930916416 2:56694726-56694748 ACCTTTAGCCAGATTGATCAGGG + Intergenic
931090333 2:58878957-58878979 GCCTTTAGTAAGAGTAATCAAGG + Intergenic
931157284 2:59649601-59649623 GCCTTTTGAAATATATATCAGGG + Intergenic
932836606 2:75043802-75043824 GGCTTTGGAGAGATGGATAACGG + Intergenic
933124512 2:78587533-78587555 TCCTTTAGAAGGCTGGAACACGG - Intergenic
935451382 2:103213689-103213711 GCCTATAGGAAGAGTGATCAAGG - Intergenic
935544064 2:104382137-104382159 GCCTCTAGAAAGATGACTGAAGG + Intergenic
936741070 2:115509344-115509366 GCGGTTAGAATGATGTATCAGGG + Intronic
941280518 2:163544356-163544378 GCCTTTAGATAGAGTGACCAAGG - Intergenic
941376577 2:164738677-164738699 GCCTTAAGAATGTTGGATGAGGG - Intronic
944467264 2:200015188-200015210 TCCTTTAGAAAGGTAAATCAGGG - Intergenic
1169500815 20:6158700-6158722 CCCTCCAGAAAGATGGACCAAGG + Intergenic
1173441545 20:43081512-43081534 GCCTCTAGAGAGACTGATCAAGG - Intronic
1177508767 21:22054379-22054401 GCCTTTAGAAAGGTCCTTCACGG + Intergenic
1177684599 21:24419503-24419525 GACTTGAGAAAGATGGCTTAGGG - Intergenic
1181659192 22:24329463-24329485 GCTGTTGGCAAGATGGATCATGG - Intronic
1181890941 22:26062925-26062947 GGCTTTGGAAAGATGAATTATGG - Intergenic
1182259669 22:29064325-29064347 GCCTAATGAAAGATGGATCTGGG - Intergenic
1184027025 22:41865527-41865549 GCCTTTGGGAAGATTGACCAGGG + Intronic
1184766832 22:46576723-46576745 GCCTTTCTAGAGATGGGTCAGGG - Intronic
949637714 3:6001815-6001837 GCCTTGAGAAAAATGAATCAAGG - Intergenic
949779680 3:7672037-7672059 TCCTTTAGAAAGAGGATTCAAGG - Intronic
949940560 3:9151214-9151236 GCTTCTAGAAAGATGAGTCAAGG + Intronic
950948377 3:16974462-16974484 GGCTTTAGAAAAATGGATAGTGG + Intronic
951459258 3:22931769-22931791 GCCATTACTAAGATTGATCATGG - Intergenic
953188458 3:40660803-40660825 GCCTTTAAAAGGATGGACCTGGG - Intergenic
959016692 3:101142849-101142871 ACCTTTGGAAAGTTGGATTAAGG - Intergenic
961185717 3:124913419-124913441 GACTTTAGACATATGGACCATGG - Intronic
961557823 3:127708671-127708693 GGTTTGAGAAAGATGGGTCAGGG - Intronic
964597597 3:158453894-158453916 GCCTTTAGAAAGTCTAATCAAGG - Intronic
964851679 3:161102759-161102781 GCTTTTAACAGGATGGATCATGG - Intronic
964886140 3:161485182-161485204 CCATTTAGAATCATGGATCAAGG - Intergenic
965146360 3:164910769-164910791 TGCTTAAGAAAGATGAATCAAGG - Intergenic
965818064 3:172657248-172657270 AGCTTGAGAAAGATAGATCAAGG - Intronic
966267926 3:178069246-178069268 ACCTTTAAAAAGATGACTCAGGG - Intergenic
966415743 3:179687766-179687788 GCATTTGGAAAGATGGCTCTGGG - Intronic
967540546 3:190662308-190662330 CTCTTCAGATAGATGGATCAAGG - Intergenic
970512202 4:16792596-16792618 CCTTTTCGAAAGATGCATCATGG + Intronic
970526611 4:16938912-16938934 TCCTTTAGAGAGATAGTTCAGGG + Intergenic
972896007 4:43620768-43620790 AACTTTAGAAAGATGAGTCAAGG - Intergenic
973120986 4:46520952-46520974 GCCTTTAGAATTTTGGAGCAAGG - Intergenic
974917154 4:68193169-68193191 GAATTGAGAAAGATGGATAATGG + Intergenic
980541557 4:134201983-134202005 GCCTTTCCAAATGTGGATCAGGG + Intergenic
981567659 4:146117524-146117546 GCACCTAGAAAGATGGAACAAGG + Intergenic
981638116 4:146903757-146903779 GGCATTAGAAAGATGTCTCATGG + Intronic
987868655 5:23581302-23581324 ACCTTTAGAAACATAGAGCAGGG + Intergenic
989263384 5:39444266-39444288 GGCTTTAGAAACTTTGATCAAGG + Intronic
989354533 5:40528662-40528684 GCAATTAGAAAGAAGTATCAAGG + Intergenic
990833347 5:59985634-59985656 TCTTTTTGAAAGATGGAACAAGG - Intronic
992784294 5:80155262-80155284 GCCTATAGAAAGAGCCATCAGGG + Intronic
992929201 5:81623974-81623996 GCCTTTAAAAACATGTCTCATGG + Intronic
994679950 5:102873769-102873791 GCCTCTAGAAAGAAGAATCCTGG + Intronic
994930665 5:106179067-106179089 GCCTTTAGATAGATTCATCAAGG - Intergenic
997075913 5:130676768-130676790 GCATTATGAAAGATGGATTAGGG + Intergenic
997214598 5:132100379-132100401 GCCTTCAGAAATGTGTATCATGG - Intergenic
999423269 5:151463564-151463586 GCCTTTTAACAGGTGGATCAAGG - Exonic
999518017 5:152320511-152320533 GCCTGTAGGAAAATGGCTCAGGG + Intergenic
1000428752 5:161124878-161124900 ACCTTCAGATAGATGGATAATGG + Intergenic
1003620285 6:7693483-7693505 ACCTTTAAAAGGAAGGATCATGG - Intergenic
1006549397 6:34808465-34808487 ACCTTTAGCAAGACTGATCAAGG + Intronic
1007585023 6:42984240-42984262 GCCTTTAGAAGGAAAGAGCAGGG + Intergenic
1010991251 6:82482681-82482703 GCCTTGTGTAAGATGGATTACGG + Intergenic
1015059160 6:128941399-128941421 GGCTTTTGAAAAATGGATCTGGG + Intronic
1016644993 6:146397135-146397157 GCCTCTAGAAATATGAAACATGG + Intronic
1017904236 6:158745587-158745609 TTCTTTAGAAATATGCATCAAGG + Exonic
1018912485 6:168110299-168110321 GCCTTTAGAAAAATTATTCAGGG + Intergenic
1020159952 7:5762941-5762963 TCCTTTAAAAAGAAGTATCATGG + Intronic
1020881890 7:13772706-13772728 GCCCTTAGAAAAATGGGTGACGG - Intergenic
1022960125 7:35418573-35418595 CCCTTTTAAAAGATGGATAATGG - Intergenic
1026221090 7:68398299-68398321 TCCTTTAAAAAGAAGGTTCAAGG - Intergenic
1027427857 7:78080294-78080316 GCCTTTAGAAGTATGGATTTGGG + Intronic
1027773455 7:82435335-82435357 GCCCTTAGAAATATGTATCTGGG - Intronic
1032899393 7:136290018-136290040 GCCTTTGGAAAGAGAGATTAGGG - Intergenic
1032961029 7:137034462-137034484 ACCTTTAGAAAGATGAACAAAGG + Intergenic
1033919157 7:146366886-146366908 GTCTGTCTAAAGATGGATCAGGG - Intronic
1036935565 8:12998997-12999019 GCATTAAGAAAGATTGTTCAGGG + Intronic
1036972469 8:13370143-13370165 GCCTTTAGACAAAGTGATCAAGG - Intronic
1037005248 8:13770425-13770447 GCCTTTGGAAAGAAGAATGAAGG + Intergenic
1037231477 8:16664022-16664044 GCCTTTATAAAGATGGAAAGAGG + Intergenic
1037832529 8:22197882-22197904 GCCTTCAGAAAGATGAGTCGTGG + Intronic
1038557335 8:28533175-28533197 TCCTTTAACAAGATTGATCATGG - Intronic
1039044799 8:33440051-33440073 GACTTTAGACAGAGTGATCAGGG - Intronic
1040832381 8:51691733-51691755 GCTTTTAGAAGTATGCATCATGG - Intronic
1042699446 8:71596024-71596046 GCCTTTATAAACAAGGCTCAAGG + Intergenic
1042798804 8:72694435-72694457 GTCTTTAGAATGATCGATTAAGG - Intronic
1045075102 8:98556467-98556489 CCCCTTAGAAAGCTGGATCTTGG + Intronic
1050931972 9:11340374-11340396 GCCACTAGAAAGAGGGATTATGG - Intergenic
1052468951 9:28868480-28868502 GCCTTTCGAAAGTGGCATCATGG + Intergenic
1053538802 9:38952153-38952175 GCTTTTAGGAAGGAGGATCAGGG + Intergenic
1054627338 9:67411766-67411788 GCTTTTAGGAAGGAGGATCAGGG - Intergenic
1055511902 9:77003437-77003459 GCTTTTAGAAATATTGGTCAAGG + Intergenic
1057442683 9:95093261-95093283 GTCTTTGGAAAGCTGGGTCATGG + Intergenic
1057484669 9:95473171-95473193 GCATTTAGGCAGATGGATAAAGG + Intronic
1062455401 9:136634770-136634792 GACTTTAGAAAGCTGAATCCTGG - Intergenic
1185724617 X:2409626-2409648 GCCTTTAGAAGGATGGAAAGAGG + Intronic
1186839349 X:13469600-13469622 GCCTTTGGAAAGCTAGCTCATGG + Intergenic
1187693937 X:21899334-21899356 GCTTTTAGAAAGATTTTTCATGG + Intergenic
1188696478 X:33198338-33198360 GACTTTACAAAGATAGATTAAGG + Intronic
1188812397 X:34666738-34666760 GCATTTGGAAAAATGGATCCAGG + Intergenic
1189819092 X:44852777-44852799 CCATCTGGAAAGATGGATCAAGG + Intergenic
1194221496 X:91199194-91199216 GCATTTAGAAAAATGGATAAAGG + Intergenic
1196965433 X:121049350-121049372 ACCTTCACATAGATGGATCATGG + Exonic
1199288031 X:146075508-146075530 TCTTCTAGAAAGATGGATGAAGG - Intergenic
1200558007 Y:4662947-4662969 GCATTTAGAAAAATGGATAAAGG + Intergenic
1201617909 Y:15922043-15922065 GCCTTGAGGAAGAGGGATTAAGG + Intergenic