ID: 1119941606

View in Genome Browser
Species Human (GRCh38)
Location 14:78647287-78647309
Sequence TAGAACATGAAGGGCAGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 410}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119941606_1119941615 4 Left 1119941606 14:78647287-78647309 CCGCCCCTGCCCTTCATGTTCTA 0: 1
1: 0
2: 3
3: 29
4: 410
Right 1119941615 14:78647314-78647336 CCAACTCTGCTCTGTGCCCTTGG 0: 1
1: 1
2: 8
3: 60
4: 513
1119941606_1119941616 5 Left 1119941606 14:78647287-78647309 CCGCCCCTGCCCTTCATGTTCTA 0: 1
1: 0
2: 3
3: 29
4: 410
Right 1119941616 14:78647315-78647337 CAACTCTGCTCTGTGCCCTTGGG 0: 1
1: 0
2: 3
3: 44
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119941606 Original CRISPR TAGAACATGAAGGGCAGGGG CGG (reversed) Intronic
900795840 1:4707893-4707915 GAGAACATGAAGTGCTGGCGAGG - Intronic
901625044 1:10619213-10619235 TAGAAAATGCAGGCCAGGGTAGG + Intronic
902625702 1:17675113-17675135 CAGAACAGGTAGGGCTGGGGAGG - Intronic
902664364 1:17927282-17927304 CAGAAAAGGAAGGACAGGGGTGG - Intergenic
903776758 1:25798869-25798891 AAGAACAGGATGGGCAGTGGAGG + Intergenic
904197369 1:28795824-28795846 GAGAATATGAATGGCAGCGGGGG - Intergenic
904232032 1:29082596-29082618 TACACTATGAAGGGTAGGGGTGG - Intronic
904323691 1:29713140-29713162 TAGGAAATGAAGGGGAGAGGAGG + Intergenic
904440734 1:30527874-30527896 TGGAAGATGAAGGACAGGGAGGG - Intergenic
904459696 1:30668926-30668948 GAGGACATGGAGGGCTGGGGAGG + Intergenic
905675434 1:39821458-39821480 AAGAAAAAGAAGGGAAGGGGAGG + Intergenic
905821344 1:40994067-40994089 AAGAAAATGAAGGCCAGGTGCGG - Intronic
906646719 1:47480361-47480383 TTCAACATGAAAGGTAGGGGAGG - Intergenic
907418237 1:54329187-54329209 TAGACCATCAAAGGCAGGGAGGG + Intronic
908448360 1:64224007-64224029 TAGAAGAGGAAAGGGAGGGGAGG + Intronic
908790665 1:67777890-67777912 CATAACTTGAAGGGCAGAGGAGG + Intronic
909044807 1:70697053-70697075 AAGAACATGAAGGATATGGGAGG + Intergenic
909170411 1:72286132-72286154 TAGGGCATGAAAGGCAGGAGTGG - Intergenic
911837971 1:102645476-102645498 GAGAAGATGAAGTGGAGGGGAGG + Intergenic
911837984 1:102645543-102645565 GAGAAGATGAAGTGGAGGGGAGG + Intergenic
912188831 1:107314112-107314134 TAAAAAATGAAGGCCAGGTGTGG + Intronic
914700953 1:150133257-150133279 TAAAAGATGAAGGCCAGGCGTGG + Intronic
914906662 1:151751849-151751871 AAGAACATGCAGGCCAGGTGCGG + Intergenic
915850549 1:159317154-159317176 AAGAAGATCAGGGGCAGGGGTGG + Intergenic
916073336 1:161185033-161185055 AAGAAAAAGAAAGGCAGGGGGGG + Exonic
917679717 1:177353495-177353517 TAGACCTAGAAGGGCAGGGGAGG + Intergenic
918790498 1:188820769-188820791 TAGAAAATGTATGGCAGTGGAGG - Intergenic
920210457 1:204324415-204324437 TAGGATACGAAGGGCAGGGCTGG + Intronic
920809819 1:209272980-209273002 TAGACCATCAAGGCCAGGTGTGG - Intergenic
921330716 1:214033011-214033033 TAGAACATCAGCAGCAGGGGAGG - Intronic
923078964 1:230635745-230635767 TAGAACAAGAAGGCCAGATGCGG - Intergenic
1063888987 10:10609566-10609588 GAGAATAAGAAGTGCAGGGGTGG + Intergenic
1064905429 10:20340613-20340635 TATAATATAAAGGCCAGGGGTGG + Intergenic
1065794318 10:29292175-29292197 AAGGAAATGAGGGGCAGGGGAGG - Intronic
1065948241 10:30626586-30626608 AAGGAAATGAGGGGCAGGGGAGG + Intronic
1066308345 10:34169882-34169904 TACATCCTGCAGGGCAGGGGAGG - Intronic
1066347135 10:34598916-34598938 TGGACCATCAAGGGCAGGGTGGG - Intronic
1066533710 10:36367463-36367485 TAGAACAGTAAGGGAAGGGCAGG + Intergenic
1067495041 10:46754085-46754107 GGGAACATGAAGGGTAAGGGAGG + Intergenic
1067552360 10:47244850-47244872 GAGAACATGAGTGGCAGGTGAGG - Intergenic
1067599614 10:47586311-47586333 GGGAACATGAAGGGTAAGGGAGG - Intergenic
1068801021 10:61139715-61139737 TAAAACAGGAAGGAGAGGGGCGG + Intergenic
1069316418 10:67109552-67109574 AAGAAAATGAAGGCCAGGCGTGG + Intronic
1070300806 10:75202433-75202455 CAAAACATGAGGGCCAGGGGAGG - Intergenic
1070450060 10:76549099-76549121 TAGAAGAAGAAGGGGAGGTGGGG - Intronic
1070593740 10:77818305-77818327 AAGAAAATGAAGGGCAGAGCAGG + Intronic
1071335838 10:84599936-84599958 TAAAATGTGGAGGGCAGGGGTGG - Intergenic
1072247775 10:93558546-93558568 TAAAACATGGGGGGGAGGGGAGG + Intergenic
1073185772 10:101614270-101614292 TAGAAGATGAAAGGCAGTGGGGG + Intronic
1073816504 10:107213784-107213806 TAGAGCATGAAGCCCAGGAGTGG - Intergenic
1075186510 10:120263835-120263857 TAGAACATGTAGGGAGGGGATGG + Intergenic
1075209068 10:120475726-120475748 TGGAACCTGAAGTTCAGGGGTGG + Intronic
1075225645 10:120626348-120626370 GAGAAAATGAAGGGATGGGGTGG + Intergenic
1076365020 10:129916103-129916125 TGGAACAGGATGGGCAGGGCCGG + Intronic
1076387928 10:130071912-130071934 TAGAATATGACGGCCAGGCGCGG - Intergenic
1076854469 10:133109081-133109103 GAGGATATGAGGGGCAGGGGTGG - Intronic
1077896619 11:6457914-6457936 TAGAAGGTGAGGGGCAGGGAGGG - Intronic
1078352012 11:10602491-10602513 TACAACATGGGGGGCCGGGGCGG + Intronic
1078406462 11:11074331-11074353 GAGAACCTGGAGGGCTGGGGTGG + Intergenic
1080172870 11:29327320-29327342 TAGAACTTGAAAGGCCAGGGTGG + Intergenic
1080533549 11:33199667-33199689 AAGAACATGAAGGCCAGGCACGG - Intergenic
1081286275 11:41274183-41274205 TAGAACATATAGGGCTTGGGAGG + Intronic
1081977303 11:47243838-47243860 AAGAACATGAATGGCAGGGCTGG + Intronic
1082170347 11:48997041-48997063 TAGAACATGAAGTGCATTGGAGG - Intergenic
1082216227 11:49573162-49573184 TACAACATGAAGAACATGGGAGG - Intergenic
1083065689 11:59921796-59921818 TATAACAAGAAGTGCAGGGCAGG - Intergenic
1083529709 11:63408761-63408783 TAGATGATCCAGGGCAGGGGTGG - Exonic
1084374036 11:68763974-68763996 TAGAAAAGGGAGGGCAGGGAGGG + Intronic
1084383449 11:68828104-68828126 TAGAGCAGGCAGGGCAGGGCAGG - Intronic
1084963054 11:72727286-72727308 TAGCACATGGAGCACAGGGGAGG - Intronic
1085047305 11:73360981-73361003 GAGACCCTGAGGGGCAGGGGAGG + Intronic
1085082639 11:73647053-73647075 TAGAACATAAAGCGCAGGGGTGG - Intronic
1085225411 11:74915662-74915684 TAGAACATTGTGGGCAGGGAAGG - Intronic
1085604570 11:77885520-77885542 TAGAAAATGAAGGGGAGGGCCGG + Intronic
1085604616 11:77885838-77885860 AAGAAAAAGAAGGGCAGAGGGGG + Intronic
1086121287 11:83306839-83306861 TAGAACAGGATAGGCAGGAGAGG - Intergenic
1086415895 11:86588710-86588732 TGAAGTATGAAGGGCAGGGGAGG + Intronic
1086633360 11:89051318-89051340 TACAACATGAAGAACATGGGAGG + Intronic
1086695469 11:89839323-89839345 TAGAACATGAAGTGCATTGGAGG + Intergenic
1086710684 11:90005162-90005184 TAGAACATGAAGTGCATTGGAGG - Intergenic
1086915150 11:92521843-92521865 TAGAACCAGAAGGGGATGGGAGG - Intronic
1087647018 11:100819822-100819844 TAGAACATGAATGGCTTGTGAGG + Intronic
1088615396 11:111621955-111621977 AAGAACATAAAGGCCAGGAGGGG - Intronic
1089001144 11:115053494-115053516 TAGAAAGTGAAGGGTAGGGCTGG - Intergenic
1089407372 11:118209391-118209413 AAGAACATGAAGGGTAAGAGCGG - Intronic
1089494659 11:118902082-118902104 CAGGACATGATGGGCATGGGGGG - Exonic
1089811204 11:121133243-121133265 TCTCACATGAAGGGCAGGGAGGG - Intronic
1090767350 11:129887745-129887767 TTGAACATGAAGGCCGGGTGCGG + Intronic
1090792063 11:130099006-130099028 TAGTACGTGCAGAGCAGGGGTGG - Intronic
1091230817 11:133986880-133986902 AAGAAAATGAAGGGCCAGGGAGG - Intergenic
1091808812 12:3377709-3377731 TAGAGCATGAGGGTCAGGGTAGG - Intergenic
1092151807 12:6254168-6254190 TATAAAATGAAGGGCAGGCTGGG + Intergenic
1092522182 12:9286523-9286545 TAACACATGAAGGAAAGGGGAGG - Intergenic
1092545099 12:9445333-9445355 TAACACATGAAGGAAAGGGGAGG + Intergenic
1092947619 12:13471674-13471696 GAGAACTTGAAAGGCAGGAGGGG + Intergenic
1093402903 12:18768042-18768064 TAGAAAATGGAGGGCTTGGGTGG - Intergenic
1094484341 12:30912351-30912373 TAGATCATGAGGGTCAGGGTAGG - Intergenic
1095200599 12:39379643-39379665 TAGGACATTAAGGGGAGGAGAGG + Intronic
1096196076 12:49649605-49649627 AAGGACTGGAAGGGCAGGGGAGG + Intronic
1097745740 12:63301095-63301117 TAAAGCATGATGGGTAGGGGTGG - Intergenic
1098280069 12:68853773-68853795 AAGAAAAGGAAGGGAAGGGGAGG + Exonic
1098662957 12:73122039-73122061 GAGAAAAAGAGGGGCAGGGGTGG + Intergenic
1098676781 12:73299506-73299528 AAGAAAATGAAAGGAAGGGGAGG - Intergenic
1099779041 12:87171211-87171233 TAAAAAAGGAAGGGAAGGGGAGG + Intergenic
1099909006 12:88806712-88806734 TTGAATATTAAGGCCAGGGGTGG - Intergenic
1100494710 12:95113524-95113546 TACGACTTGAAGGGCAGGTGCGG - Intronic
1101126510 12:101640764-101640786 TAAAATATGCAGGGGAGGGGAGG - Intronic
1101322553 12:103685913-103685935 GAGACCAGGAAGGGAAGGGGAGG - Intronic
1102607792 12:114082791-114082813 GAGTCCCTGAAGGGCAGGGGAGG - Intergenic
1102618371 12:114174262-114174284 TAGAACAGGCAGGGAAGGGATGG + Intergenic
1103499078 12:121386865-121386887 AAGAAGATGAAGGCCAGGTGTGG + Intronic
1104138730 12:125965573-125965595 TGGAACATGCAGGACAGGTGTGG - Intergenic
1104726037 12:131076390-131076412 TAGAACAGGTAGGGAAGGGAAGG + Intronic
1105783284 13:23723038-23723060 TACCACATGGAGGGCAGGGCTGG - Intergenic
1105860457 13:24406088-24406110 GAGAGAATGAAGGACAGGGGTGG + Intergenic
1106642445 13:31598422-31598444 CAGAACATGAAGCGCAGGTGTGG + Intergenic
1108682859 13:52794291-52794313 TGGAAAGTGGAGGGCAGGGGAGG - Intergenic
1109161919 13:58986036-58986058 TAGGTGATGAAGGGCAGGGTGGG - Intergenic
1109811939 13:67524896-67524918 CAGATCATGAAGGGTAGTGGGGG + Intergenic
1112123733 13:96441326-96441348 AAGAAAATGAATGGCAGGGATGG + Intronic
1112811794 13:103226592-103226614 TAGAACCTGCTGGGCTGGGGAGG + Intergenic
1114238102 14:20840136-20840158 TAAAACATGAAGGCCGGGCGCGG - Intergenic
1115595042 14:34901245-34901267 TAGAAGATGCAGGCCAGGCGCGG + Intergenic
1116786327 14:49293035-49293057 TAGAACATGAAGGTCATGAAAGG + Intergenic
1116915888 14:50525396-50525418 TAGAAGATGAAAGGAAGGGATGG - Intronic
1117074806 14:52091215-52091237 AAGGAAATGGAGGGCAGGGGAGG - Intergenic
1119193910 14:72702881-72702903 TCGAACTTCAAGGGCAGGGGAGG - Intronic
1119366524 14:74096813-74096835 TAGAATATGAGGGGTAGGGAAGG - Intronic
1119446678 14:74670297-74670319 TAGAAGATAAAGGGCAAAGGTGG + Intronic
1119477235 14:74937921-74937943 TGGAGCATGATGGGCAGGGAGGG - Intergenic
1119941606 14:78647287-78647309 TAGAACATGAAGGGCAGGGGCGG - Intronic
1121245468 14:92458513-92458535 TGGGACATGAAGAGCAGGAGGGG + Intronic
1121333883 14:93064955-93064977 TAGTTCATTATGGGCAGGGGAGG - Intronic
1122275278 14:100587652-100587674 TAGAGCATGCGGGGCTGGGGGGG + Intergenic
1122374064 14:101247089-101247111 CAGAGGATGAGGGGCAGGGGCGG - Intergenic
1123676552 15:22715005-22715027 TAGAACATAGAGGGCAGCAGCGG - Intergenic
1124328770 15:28789265-28789287 TAGAACATAGAGGGCAGCAGCGG - Intergenic
1124422102 15:29531481-29531503 CAGAACATGAAGGGCAGCCCTGG + Intronic
1125465882 15:39952036-39952058 TGGAAGATGAAGGGATGGGGAGG - Intronic
1127511901 15:59650735-59650757 TAGAACTTGAAGGGCAAGTTGGG + Exonic
1127521603 15:59748202-59748224 GAGGACATGGAGGGCAGGAGGGG - Intergenic
1127573931 15:60271975-60271997 TAAAAAATGAAGGCCAGGGCTGG - Intergenic
1127763906 15:62166102-62166124 CAGAAAATGAAGGTCGGGGGTGG - Intergenic
1127861583 15:62998231-62998253 TAGAGCATGCTGGGCAGGTGGGG + Intergenic
1128096609 15:64961036-64961058 TAGAAGAGGAAGGGCAGGTTTGG + Intergenic
1128665883 15:69538158-69538180 TAGAACAAGTAGGGGAGGGGAGG + Intergenic
1130323615 15:82860644-82860666 TACAAAATGAAGGCCAGGTGTGG + Intronic
1130509880 15:84580734-84580756 AAGAAAATAAAGGGGAGGGGAGG - Intergenic
1130706979 15:86242572-86242594 TAGGACATGCAAGGCAGGGAGGG + Intronic
1130758495 15:86792274-86792296 TAGAACATGAAAGGAAGAAGGGG - Intronic
1131876452 15:96811915-96811937 TATAACAAGAAGGGCAGGATTGG + Intergenic
1131938496 15:97534402-97534424 AAGATAATGAAGGGCAGAGGAGG + Intergenic
1132157837 15:99509046-99509068 TACTACATGAGGGGCAGGTGTGG - Intergenic
1132184565 15:99792133-99792155 TGGGCCAAGAAGGGCAGGGGTGG + Intergenic
1132432415 15:101772526-101772548 TGGACCAAGAAGGGCAGGGGTGG - Intergenic
1132435167 15:101794581-101794603 TTGAACAAGAAAGGCAGGGGAGG - Intergenic
1132772138 16:1569567-1569589 GAGAAAAGGAAGGGGAGGGGAGG - Intronic
1134024150 16:10941917-10941939 TAGAACATAGAGGGCAGCAGCGG + Exonic
1134373495 16:13647945-13647967 TGGAAAATGAAGGGAAGGGAAGG - Intergenic
1134431055 16:14206992-14207014 AAGAACATGAATGGAAGGGGAGG - Intronic
1134459571 16:14419795-14419817 TGGAACAGGAAGGGATGGGGTGG + Intergenic
1135314410 16:21432375-21432397 TAGGCCATGATGGGAAGGGGAGG - Intronic
1135367332 16:21864651-21864673 TAGGCCATGATGGGAAGGGGAGG - Intronic
1135444481 16:22506507-22506529 TAGGCCATGATGGGAAGGGGAGG + Intronic
1136311078 16:29411070-29411092 TAGGTCATGATGGGAAGGGGAGG - Intergenic
1136324523 16:29512861-29512883 TAGGCCATGATGGGAAGGGGAGG - Intergenic
1136439208 16:30252842-30252864 TAGGCCATGATGGGAAGGGGAGG - Intronic
1137341112 16:47606727-47606749 GAGAACATGCAGGGGAGGGGTGG - Intronic
1138064292 16:53924595-53924617 TAGACTATGAAGGGCGGGGGAGG + Intronic
1138279403 16:55761500-55761522 TAGAAGAGGAAAGGCAGGGCAGG + Intergenic
1138289126 16:55832177-55832199 TAGAAGAGGAAAGGCAGGGCAGG - Intronic
1138351565 16:56348763-56348785 GAGATCCTGCAGGGCAGGGGAGG - Intronic
1138456990 16:57126757-57126779 TACAACATGCAGAGCAAGGGAGG + Intronic
1140765340 16:78151898-78151920 TATAACATGGAGGCCAGGCGCGG + Intronic
1141965635 16:87440909-87440931 CTGAAAATGAAGGGCAGGGCTGG - Intronic
1142405834 16:89889089-89889111 TAGAGGAGGAAGAGCAGGGGGGG + Intronic
1145875366 17:28315123-28315145 TGGAACATGAAGAGCTGGGAGGG - Intergenic
1146074739 17:29717729-29717751 AAGAACATTAAAGGCAGTGGGGG + Intronic
1148367210 17:47064514-47064536 TAGCACTTGAAGGCCAGGTGTGG + Intergenic
1149702249 17:58664957-58664979 TAGATGAAGAAGGGCAGGGCAGG + Intronic
1150011787 17:61511586-61511608 TAGAACATCAAGTGCTGGTGGGG + Intergenic
1150157799 17:62868758-62868780 GAGAACATGAAAGCCAGGAGGGG - Intergenic
1150901905 17:69288576-69288598 TAAAACATGGAGGCCAGGCGTGG + Intronic
1151155813 17:72122467-72122489 TAGAAATAGAAGGGGAGGGGAGG + Intronic
1151176259 17:72290748-72290770 AAGAAGATGAAGGGCAGGGAGGG - Intergenic
1151589988 17:75036910-75036932 TTGAAGATGAAAGGCAGCGGAGG - Intronic
1151651215 17:75470946-75470968 AAGAAAATGAAGGTCAGGCGCGG + Intronic
1151688483 17:75664614-75664636 TAGAAAATAAGAGGCAGGGGCGG + Intronic
1151727701 17:75894229-75894251 TGGGACAGGAAGGGAAGGGGTGG - Intronic
1152885016 17:82844638-82844660 TAGAAGAGGAAGGGCAGGGAAGG - Intronic
1154965863 18:21355480-21355502 TTGAACAAGAAGGCCAGGTGTGG - Intronic
1156183149 18:34629729-34629751 GAGAAAATGAAGGACTGGGGAGG - Intronic
1157790701 18:50528556-50528578 TAGAACATGGAGGCCAGGCGTGG - Intergenic
1160925588 19:1543500-1543522 TAGAAAATTAAGGCCAGGCGCGG + Intergenic
1161408392 19:4102890-4102912 CAGCACACGAAGGGAAGGGGAGG + Intronic
1161635835 19:5388572-5388594 TGGAAAAGGAAGGGAAGGGGAGG + Intergenic
1162084146 19:8238323-8238345 TAGCATAGGAAGAGCAGGGGAGG + Intronic
1162242552 19:9366545-9366567 TAGAAAATGAAGGCCAGGCATGG - Intronic
1163728020 19:18933326-18933348 TAGAACCTGTAAGGTAGGGGAGG + Intronic
1163787889 19:19286010-19286032 TACAACAAGAAGGCCAGGGCAGG + Intronic
1164942347 19:32260977-32260999 AAGAACCTAAAGGGCAGGCGCGG + Intergenic
1165324852 19:35108640-35108662 CAGAACAGGATGGGGAGGGGCGG + Intergenic
1165673684 19:37702755-37702777 TATAACATGAAGGGTAAAGGTGG + Intronic
1165944529 19:39433849-39433871 TAGTACTTGAAGGCCAGTGGTGG - Intronic
1166502150 19:43349676-43349698 AAGAAAATGAAAGGCAGGTGGGG + Intergenic
1167271368 19:48508409-48508431 GAGACCAAGAAGGGCAGGGATGG + Intronic
1167647138 19:50711912-50711934 CAGGCCATGAAGGGCTGGGGTGG - Intronic
1167734742 19:51286946-51286968 TAGAAAATGAAATGCAGAGGAGG - Intergenic
1167856205 19:52242524-52242546 GAGAACATGAAGTGTAGGTGAGG + Intergenic
925489755 2:4377942-4377964 TAGAACAAGAAGGCCATGGATGG - Intergenic
926702600 2:15813742-15813764 CAGACCATGAGGGGCAGTGGGGG + Intergenic
927570455 2:24154646-24154668 TAGAACATGAGAGGAAAGGGTGG - Intronic
927832029 2:26359697-26359719 TAGATGATATAGGGCAGGGGAGG + Intronic
928372210 2:30748422-30748444 TAGAAAATGCAGTGCAGAGGTGG + Intronic
929925082 2:46201159-46201181 TAGAAAATGAAGGGCATAGAAGG - Intergenic
930640213 2:53846672-53846694 AACAACATGAAGGCCAGGCGCGG - Intergenic
930801829 2:55450760-55450782 GAGAACAGGAAGGGCAGAGGGGG + Intergenic
930802325 2:55455862-55455884 GAGAACAGGAAGGGCAGAGGGGG + Intergenic
930866455 2:56126713-56126735 TAGAACATGAAAGAGAGGGGAGG + Intergenic
932402373 2:71489771-71489793 CAGAGCTTGCAGGGCAGGGGTGG + Intronic
932858456 2:75263778-75263800 TAGAGCATGAGGGGGAGGTGGGG - Intergenic
933595564 2:84279724-84279746 AACAACATGACAGGCAGGGGTGG + Intergenic
933617581 2:84498694-84498716 TAGCACATGAATAGCAGGGCAGG - Intergenic
934094348 2:88585303-88585325 TAGAACAGGCTGGGGAGGGGAGG + Intronic
934553139 2:95274399-95274421 GAGCATAGGAAGGGCAGGGGTGG - Intergenic
934909859 2:98241683-98241705 TAGAACACAAAGCCCAGGGGAGG + Intronic
935527322 2:104186786-104186808 TAGCACATGAAGGTCAAAGGGGG + Intergenic
936678586 2:114744489-114744511 TAGAACATGAAGATCAGAGAGGG + Intronic
936805488 2:116326929-116326951 TAGAAGTTGAAGGGTAGAGGAGG - Intergenic
937251743 2:120528276-120528298 TAGAACAGGGAGTGCTGGGGTGG + Intergenic
937814103 2:126232027-126232049 GAGGACATGAAGGGGAGGGAGGG - Intergenic
937863770 2:126732895-126732917 GAGAAAATGTGGGGCAGGGGTGG + Intergenic
939270435 2:139931913-139931935 AAGGACAGGAAGGGAAGGGGAGG - Intergenic
939468388 2:142587074-142587096 TAGAACATTATGGGGGGGGGGGG + Intergenic
940807485 2:158204634-158204656 GAGGACTTGAATGGCAGGGGAGG - Intronic
941161853 2:162044534-162044556 TAGAAAAGGAAGATCAGGGGTGG + Intronic
941218875 2:162749144-162749166 TGGAAAATGGAGGGGAGGGGAGG - Intronic
941262998 2:163320638-163320660 TAATACATGAAGGCCAGGCGTGG + Intergenic
941418565 2:165253118-165253140 TAGAACATGAAAGGATAGGGGGG + Intronic
941422245 2:165297063-165297085 TAAAATGTAAAGGGCAGGGGTGG - Exonic
941665413 2:168239843-168239865 CAGAGCCTGAAGGGCAAGGGGGG + Intronic
942612256 2:177754591-177754613 TTGGACTTGAAGGTCAGGGGAGG - Intronic
943551759 2:189349232-189349254 ATAAACATAAAGGGCAGGGGAGG + Intergenic
944752033 2:202718846-202718868 CAGAATTTGAAGGACAGGGGAGG - Intronic
946118291 2:217483558-217483580 GAGAATATGAAGGGCACAGGGGG + Intronic
946412286 2:219521426-219521448 AAGAAGCAGAAGGGCAGGGGTGG - Intronic
946510932 2:220355459-220355481 CAGAACATACAGGGCAGGAGAGG - Intergenic
946597383 2:221321170-221321192 ATGAACATGATGGGCACGGGTGG + Intergenic
947182458 2:227423600-227423622 TAGAGAATGACAGGCAGGGGTGG + Intergenic
947988161 2:234466206-234466228 TTGAGCAAGAAGGGCAGGGAGGG + Intergenic
948415148 2:237797667-237797689 CAAAACATGGGGGGCAGGGGAGG + Intronic
948686267 2:239671598-239671620 AAGAACATGACTGGCAGGGGAGG + Intergenic
948855225 2:240727240-240727262 GAGAACAAGAAGGGCAGAGAGGG + Intronic
1169269409 20:4187712-4187734 GAGAAGCTGAGGGGCAGGGGAGG - Exonic
1170267606 20:14485409-14485431 AAGAACATGGAGGCCAGGCGTGG + Intronic
1172901117 20:38335541-38335563 AAGAAAGAGAAGGGCAGGGGAGG - Intronic
1173006244 20:39141812-39141834 CAGAGCATGAAGGGCTGGTGCGG + Intergenic
1174340750 20:49893480-49893502 TGAGACATGAAGGGCAGTGGGGG + Intergenic
1174722014 20:52822887-52822909 AAGCACATAAAGGGCTGGGGTGG - Intergenic
1174869422 20:54169191-54169213 AAGAACATGAAAGGCAGGCATGG - Intronic
1175586624 20:60146277-60146299 CAGCACATGAATTGCAGGGGTGG - Intergenic
1177220350 21:18184714-18184736 TAGTACATCAGGGGCAGAGGTGG + Intronic
1177547371 21:22576226-22576248 TAGAAGATGGAGGGAAGGGCCGG + Intergenic
1177957421 21:27616469-27616491 TAGAACAGAAAGGCCAGGCGCGG - Intergenic
1178301699 21:31458739-31458761 CGGAACAGGAAGGGGAGGGGAGG + Intronic
1179983827 21:44910437-44910459 TAGAGCAGGAAGGTCAGAGGAGG + Intronic
1180320992 22:11321307-11321329 TAGAAGCTAAAGGGCAGGAGTGG - Intergenic
1180334051 22:11559438-11559460 TAGAAGCTAAAGGGCAGGAGTGG + Intergenic
1180867649 22:19128625-19128647 TCGAAAAGGAAGGGGAGGGGAGG + Intergenic
1181628254 22:24135746-24135768 GAGAAACTGAAGGGCAGAGGTGG + Intronic
1182710013 22:32315870-32315892 TAGAAAAGGATGGGCAGGGCCGG + Intergenic
1183157236 22:36084930-36084952 TCGAGAATGAAAGGCAGGGGTGG - Intergenic
1183227154 22:36558414-36558436 CAGCCCATGATGGGCAGGGGAGG + Intergenic
1184397571 22:44252696-44252718 TAGAAAAGGATGGGCAGGGCCGG + Intronic
1184427799 22:44423399-44423421 AAGAACATGGAGGGAGGGGGAGG - Intergenic
1184581930 22:45423787-45423809 TGTAAAATGAAGGGCAGGGATGG - Intronic
1184632496 22:45794169-45794191 TAAAACAGGTAGGTCAGGGGTGG - Intronic
1184643840 22:45885685-45885707 ATGAACATGAAGAGCAGGGGAGG - Intergenic
1185084472 22:48732192-48732214 TAGAACTTGAACGGATGGGGAGG + Intronic
1185191394 22:49438703-49438725 CAGAAGATGAAGGGCGAGGGAGG - Intronic
950877002 3:16284956-16284978 TTGAACATGAAGGAAAGGGCTGG + Intronic
951457352 3:22907415-22907437 CTGAACTTGAAGGGCAGTGGCGG - Intergenic
952566626 3:34666940-34666962 TAGAACATGAAAGGAAAGGTGGG + Intergenic
953831492 3:46301482-46301504 TATTACAGGAAGGGCAGAGGAGG - Intergenic
954166393 3:48762127-48762149 AAGAAAATGAAGGCCAGGTGCGG + Intronic
954268298 3:49487509-49487531 GAGCACATGAAGGGCAGAAGAGG - Intronic
954734330 3:52692793-52692815 CAGAACATGAAGCTCAGGGTTGG - Intronic
954801298 3:53188648-53188670 TAGGACATGGGGGGCAGGGTTGG + Intronic
955460622 3:59179002-59179024 TAGATAATGAAGGCCAGGTGTGG + Intergenic
956341226 3:68226345-68226367 TTGAACATGAAGCACAGTGGTGG - Intronic
956428935 3:69165100-69165122 AAGAACATGATGGCCAGGTGTGG + Intergenic
956657707 3:71568100-71568122 AAGAAAAGGAAGGGAAGGGGAGG + Intronic
957163558 3:76641490-76641512 TAGATCATGAAGGACAAGGAAGG + Intronic
960739665 3:120819234-120819256 TGCAACATGAAGGGCAGTGGAGG + Intergenic
961071753 3:123936536-123936558 AAGAACATGAAGGGAACTGGAGG + Intronic
966121509 3:176526552-176526574 AAGAACATGAAGTACAGAGGTGG + Intergenic
967240339 3:187432607-187432629 TAGAAGGTGAAGGGCAAGAGAGG + Intergenic
967313084 3:188124945-188124967 TAGAAAAAGAAGGGCTGGGTTGG + Intergenic
967613843 3:191541001-191541023 TCAAATATCAAGGGCAGGGGGGG - Intergenic
967650114 3:191975116-191975138 CTGAAGATGGAGGGCAGGGGAGG + Intergenic
968267333 3:197372403-197372425 TAGAAAATGAAGGCCAGGAAGGG - Intergenic
969020259 4:4135434-4135456 TCCAACGTGCAGGGCAGGGGAGG + Intergenic
969096385 4:4735808-4735830 TAAACCAGGAAGGGCAGAGGAGG + Intergenic
971489762 4:27199101-27199123 TAGGACAGGAAGGGAAGGGAGGG - Intergenic
973763689 4:54144412-54144434 TAGAAGATGAAGGGCACAGGTGG + Intronic
974192406 4:58523075-58523097 AAGGACAGGAAGGGGAGGGGAGG - Intergenic
977768349 4:100827474-100827496 TTGAACATTAAGTGCAGTGGAGG + Intronic
978358581 4:107904337-107904359 AAGAACAAGGAGGACAGGGGAGG - Intronic
978560415 4:110028004-110028026 TAAAACATGTAGGCCAGGCGCGG - Intergenic
978857188 4:113406551-113406573 TAGAACAGAAAGGGCAGAAGAGG - Intergenic
979013382 4:115399345-115399367 TAGAAAATCAAGGCCAGGAGTGG + Intergenic
979172126 4:117613236-117613258 CATAAAATGTAGGGCAGGGGTGG + Intergenic
980084873 4:128380623-128380645 AGGAACAGGAAGGGGAGGGGGGG - Intergenic
980092961 4:128461416-128461438 TGGAACAGCAAGGGCAAGGGAGG - Intergenic
980529156 4:134028367-134028389 TAGAAAATGAAGAGCTGAGGAGG - Intergenic
982589913 4:157295201-157295223 CATAACATGAAGGTCAGGAGGGG + Intronic
982747621 4:159121335-159121357 AAGAAGAGGAAGGGGAGGGGAGG - Intronic
983197489 4:164823368-164823390 AAGAACATCAAGGGTAAGGGGGG - Intergenic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
985305130 4:188531261-188531283 TAGAAAATGAAGTCCAGGTGCGG + Intergenic
985706364 5:1403468-1403490 TAGAACATGATGGGATGGGATGG - Intronic
985750813 5:1673233-1673255 AGGAGCATGAAGGGCCGGGGAGG + Intergenic
986958993 5:13190805-13190827 TAGAAAATGCAGGCCAGGAGGGG - Intergenic
987142241 5:14958241-14958263 TAGAATAAGGAGGGGAGGGGAGG - Intergenic
987344192 5:16964268-16964290 GAGAAAGTGAAGGGGAGGGGAGG - Intergenic
988280090 5:29134257-29134279 TGGAACAGGGAGGGCAAGGGGGG + Intergenic
988426616 5:31072681-31072703 GAGAAGAAGAAGGGAAGGGGTGG - Intergenic
989761670 5:45023363-45023385 TAGAACATGAGGGCCGGGTGTGG - Intergenic
991193016 5:63897669-63897691 GATACCATGAAGGGCTGGGGTGG - Intergenic
991371698 5:65926020-65926042 GAGAACAAGCAGGGCAGCGGAGG + Intergenic
994391577 5:99197987-99198009 TATAACATCCAGGGCAGGAGAGG - Intergenic
995157659 5:108934275-108934297 GAGAAAATGAAGGTCAGAGGGGG - Intronic
995469397 5:112484549-112484571 TTGGACCTGAAGGGCATGGGAGG - Intergenic
995917269 5:117262873-117262895 CAGAAAATGAAGGGGATGGGAGG + Intergenic
997523145 5:134536059-134536081 TAGAAGTGGAAGGGCAGGAGTGG - Intronic
998444161 5:142185783-142185805 GAGAACATGATGGGCACTGGGGG + Intergenic
999430917 5:151524722-151524744 GAGAACATCATGAGCAGGGGTGG - Intronic
999804137 5:155066408-155066430 CAGAGCATGAAGTGGAGGGGAGG + Intergenic
999860901 5:155644677-155644699 TTGAACATGAGGTGAAGGGGTGG + Intergenic
1001451012 5:171824375-171824397 GAGAACCTGAAGAGCAAGGGTGG + Intergenic
1001653603 5:173331582-173331604 TAGACCATGAAGGATGGGGGAGG + Intergenic
1001787350 5:174425355-174425377 TAGAACAAGAAGTGAAGGAGTGG + Intergenic
1002414147 5:179110027-179110049 TGGAACACGAAGGCCAGGCGCGG + Intergenic
1002550120 5:179982068-179982090 TAGATCATGGAGGGATGGGGTGG - Intronic
1002807194 6:588641-588663 TAGAAAGTGAAGGGCCGGTGCGG - Intronic
1005325864 6:24700066-24700088 TAGGACTTGATGTGCAGGGGTGG - Intronic
1006165054 6:32059513-32059535 TAGAACAGGAGGGGCAGGGGTGG + Intronic
1007103157 6:39264907-39264929 TAGCACATGCAGGCCAGGCGCGG + Intergenic
1007231751 6:40352994-40353016 TAGTAAATGAAGGGTAGGTGAGG - Intergenic
1007771899 6:44199031-44199053 AAGAACATGTAGGGGAGAGGGGG - Intergenic
1008109000 6:47472338-47472360 TAGAAGAGGCTGGGCAGGGGTGG + Intergenic
1008414256 6:51221283-51221305 TATAAAAAAAAGGGCAGGGGCGG + Intergenic
1008433644 6:51449816-51449838 TAGAAGATGAATGGCAGGCTGGG + Intergenic
1008505905 6:52229626-52229648 TAGAAAATGTAGGCCAGGTGTGG + Intergenic
1010293432 6:74167166-74167188 TTGGACAGGAAGGGTAGGGGAGG + Intergenic
1010561167 6:77352512-77352534 GAGAATATGAAGGGTAGTGGGGG - Intergenic
1011186912 6:84687682-84687704 TAGAACAAGAAAGAAAGGGGAGG + Intronic
1013274466 6:108570981-108571003 AAAAAGATGAAAGGCAGGGGAGG - Intronic
1014705425 6:124740547-124740569 TAGATCTGGAAGGGCAGGGATGG + Intronic
1014938427 6:127411243-127411265 TAGAATATTAAGGCCAGGTGTGG + Intergenic
1015687047 6:135876359-135876381 TAGAACATGAAAGACAAGTGTGG - Intronic
1016598092 6:145824169-145824191 TTGAACCTGAAAGGCAGAGGAGG - Intergenic
1016944174 6:149513030-149513052 TTAAACATGATGGGCAGGTGTGG - Intronic
1017201380 6:151758468-151758490 TAGAAGAGGAAGGCCAGGGATGG + Intronic
1018414771 6:163591347-163591369 TAGAGGGTGAAGGGCAGGGTAGG - Intergenic
1018506623 6:164477043-164477065 GAAAACATGCAGGGCAGGGCAGG + Intergenic
1018759039 6:166874254-166874276 TGGAGCATGTCGGGCAGGGGTGG + Intronic
1019118843 6:169787151-169787173 TAGGTGATGAAGGGGAGGGGAGG - Intergenic
1019319404 7:408802-408824 TGGAACAGGAAGGGCGAGGGAGG + Intergenic
1019459825 7:1151676-1151698 TAGAACCTGGAAGGCAGAGGTGG + Intergenic
1019582426 7:1772054-1772076 GAGAACATGCAGGGCGGGCGCGG + Intergenic
1019641571 7:2106343-2106365 TAGAGAAGGAAGGGCAGGGTGGG - Intronic
1019780370 7:2936346-2936368 TAGAAGATGCAGGGTAGGGCTGG - Intronic
1022507108 7:30914151-30914173 TAAAAAATGAAGGCCAGGGAGGG - Intronic
1022715238 7:32892176-32892198 AAGAGCAGGAAGGGCGGGGGCGG + Intronic
1022740142 7:33112661-33112683 AAAAAAATGAAGGGAAGGGGAGG - Intergenic
1022835722 7:34112202-34112224 TAGACAATGAAGGCCAGGCGCGG + Intronic
1024343729 7:48292112-48292134 ATGAGCATGAAGGTCAGGGGAGG - Intronic
1025703656 7:63843272-63843294 TAAAACATAAAGGCCATGGGTGG + Intergenic
1026217845 7:68365256-68365278 TAGAGGATGGAGGGAAGGGGAGG + Intergenic
1026228419 7:68462827-68462849 AAGAACAGGAAGGGAAGGGGAGG - Intergenic
1027037292 7:74934069-74934091 GAGAAGGTCAAGGGCAGGGGTGG - Intergenic
1027239454 7:76317905-76317927 GAGAAACTGAAGGGCAGGCGTGG + Intergenic
1027454602 7:78373742-78373764 TAGAAGGTGAAGGGAAGGAGGGG - Intronic
1027632570 7:80624906-80624928 TTGAACATCAAAAGCAGGGGAGG - Intronic
1029392573 7:100285410-100285432 GAGAAGGTCAAGGGCAGGGGTGG + Intergenic
1029487920 7:100854421-100854443 GAGGACATGATGGGGAGGGGTGG + Intronic
1029577105 7:101411020-101411042 TAGAACAGTGAGGGCAGGTGTGG + Intronic
1029885920 7:103871590-103871612 CAGACCATGGAGGGCAGGAGTGG + Intronic
1031722997 7:125200511-125200533 AAGAAAAGGAAGGGGAGGGGAGG - Intergenic
1032848433 7:135771868-135771890 TTCACCATCAAGGGCAGGGGAGG - Intergenic
1033907129 7:146218890-146218912 GATTACAAGAAGGGCAGGGGTGG - Intronic
1037274946 8:17167940-17167962 TAGCACATTAAGGGCGGGTGGGG - Intronic
1037773450 8:21817094-21817116 TAGAACCTGAACAGCAGTGGAGG - Intergenic
1038189800 8:25309471-25309493 AAAAACATGGAGGCCAGGGGCGG - Intronic
1038270301 8:26069470-26069492 CAGAAAAGGAAGGGCAGGGCAGG + Intergenic
1038974104 8:32672332-32672354 TAGAAGATGAAGGCCAGGCATGG - Intronic
1040492499 8:47937650-47937672 TAGAGCATGATAGGCAGGAGAGG - Intronic
1041404600 8:57483901-57483923 TAGAACATGCAGTTCAGGAGCGG + Intergenic
1041458270 8:58083686-58083708 CAGAACACGAAGCCCAGGGGAGG - Intronic
1041532867 8:58891340-58891362 AAGAAAATAAAGAGCAGGGGAGG + Intronic
1042346118 8:67730011-67730033 TAGCAGATGTAGGGCGGGGGAGG + Intronic
1042368793 8:67967618-67967640 TTGAACAAGTGGGGCAGGGGTGG + Intronic
1043780890 8:84333835-84333857 TAGAATTTGAACAGCAGGGGTGG + Intronic
1045273832 8:100683968-100683990 CAGAACATTAAGGCCAGGAGCGG + Intergenic
1045861660 8:106820514-106820536 GAGAAAAGGAAGGGAAGGGGAGG - Intergenic
1049232404 8:141491325-141491347 TAGAACTGGAGGGGCAGTGGAGG + Intergenic
1049524161 8:143112543-143112565 TAGAAAAAGAAGGGGAGGGGAGG + Intergenic
1050223472 9:3423855-3423877 TAAAACAAGAAGGCCAGGCGCGG + Intronic
1050302796 9:4276305-4276327 AAGAAAATGGAGGGGAGGGGAGG + Intronic
1050538530 9:6650399-6650421 TAGAGCAGAACGGGCAGGGGAGG - Intergenic
1051098165 9:13490299-13490321 CAGAACAAGAAGGCCAGAGGAGG - Intergenic
1051319264 9:15883022-15883044 AAGAAAAGGAAGGGGAGGGGAGG - Intronic
1052155273 9:25179899-25179921 TAAAACATGAAGCGCAGGTTGGG + Intergenic
1052970966 9:34376984-34377006 TCGAACGTCAAGGGCAGGGCTGG - Intergenic
1053169060 9:35865401-35865423 AAGGACAGGAAGGGGAGGGGAGG - Intergenic
1055314777 9:75023245-75023267 TGGGGCAGGAAGGGCAGGGGAGG - Intronic
1055437498 9:76307281-76307303 AAGAAGATGAAAGGCAGGAGAGG + Intronic
1057194804 9:93111008-93111030 TAGAAAAGGAAGGGCAAGAGTGG - Intronic
1060171996 9:121469430-121469452 TAGACGATGAAAGGCATGGGAGG + Intergenic
1061075023 9:128335927-128335949 TAGCAGAGGAAGGGCAGGGGAGG + Intergenic
1061700013 9:132408909-132408931 TAGATTTTGAAGGGAAGGGGAGG - Intergenic
1061862603 9:133475685-133475707 TAGACCTTGAAGGGCAGATGAGG - Intronic
1061935043 9:133852875-133852897 TAGCACAGAAATGGCAGGGGGGG - Intronic
1185725565 X:2418922-2418944 GACAAGATGTAGGGCAGGGGGGG - Intronic
1187806151 X:23123118-23123140 TAAAACATAAAGGATAGGGGAGG - Intergenic
1187918852 X:24181462-24181484 TACAGGATGAAGGGCACGGGTGG + Intronic
1189047190 X:37605833-37605855 AAGAAAATGCAGAGCAGGGGAGG - Intronic
1189427374 X:40913106-40913128 CAGAACATGGTGGGGAGGGGTGG + Intergenic
1189491679 X:41475198-41475220 TGGAAGATGAGGGGAAGGGGAGG - Exonic
1192334401 X:70205301-70205323 AAGAACCAGAGGGGCAGGGGAGG + Exonic
1192774793 X:74232327-74232349 TACAACATGTAGGCCAGGTGTGG + Intergenic
1192780940 X:74293304-74293326 CAGAACATGGAGGGCGGCGGAGG - Intergenic
1195218211 X:102721281-102721303 TGGATCAGGAAAGGCAGGGGTGG + Intronic
1195828483 X:109029376-109029398 TAGGGCATGAAGGGCTGGTGAGG - Intergenic
1196026125 X:111042996-111043018 TAAAAGCTGAAGGCCAGGGGTGG + Intronic
1196193315 X:112815881-112815903 TAAAACATGAAGGGCAGGTGCGG + Intronic
1196884352 X:120228765-120228787 AAGAACACTCAGGGCAGGGGAGG - Intergenic
1197853401 X:130889131-130889153 TAGCACATGAAGTCCTGGGGTGG + Intronic
1198076549 X:133198789-133198811 AAGAACATCAAGGCCAGGGGTGG - Intergenic
1199303446 X:146239580-146239602 TAAAACATGAAGGACAATGGTGG - Intergenic
1199594062 X:149492999-149493021 GAGAAAAGGCAGGGCAGGGGTGG + Intronic
1199724411 X:150567020-150567042 TACAACAAGAAGGGCTGGGTGGG + Intergenic