ID: 1119942506

View in Genome Browser
Species Human (GRCh38)
Location 14:78656406-78656428
Sequence CAGGGTGAGCAAAGGCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1199
Summary {0: 1, 1: 1, 2: 27, 3: 137, 4: 1033}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119942503_1119942506 -10 Left 1119942503 14:78656393-78656415 CCAGGATGAGGGGCAGGGTGAGC 0: 1
1: 0
2: 2
3: 45
4: 384
Right 1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG 0: 1
1: 1
2: 27
3: 137
4: 1033

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119942506 Original CRISPR CAGGGTGAGCAAAGGCATGG AGG Intronic
900037084 1:423261-423283 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900058714 1:659002-659024 CAGCATGAGCAAATGCAAGGAGG + Intergenic
901034113 1:6326040-6326062 CAGGGTCTCCCAAGGCATGGTGG + Intronic
901304333 1:8221738-8221760 ATGGCTGAGCAGAGGCATGGAGG + Intergenic
901752135 1:11416826-11416848 CAGCATGGGCAAAGGCTTGGAGG - Intergenic
902074809 1:13775860-13775882 CAGGGTGGGTGAAGGGATGGGGG - Intronic
902292589 1:15445119-15445141 CTGGTGGAGCAAATGCATGGAGG - Intronic
902302277 1:15510682-15510704 CGGCATGAGCAAAGGCAGGGAGG + Intronic
902330942 1:15731024-15731046 CAGGGTGAAGAAGGGCCTGGGGG - Intronic
902449636 1:16488701-16488723 AGGCATGAGCAAAGGCATGGAGG - Intergenic
902504846 1:16932641-16932663 AGGCATGAGCAAAGGCATGGAGG + Intronic
902626017 1:17676805-17676827 CAGTGGGTGCAAAGGCCTGGGGG - Intronic
902639408 1:17756975-17756997 CAGGCCGGGCACAGGCATGGTGG + Intronic
902794567 1:18792860-18792882 CGGCATGTGCAAAGGCATGGAGG + Intergenic
902965170 1:19995849-19995871 GAGGGTGAGCAAAAGCAGGGTGG - Intergenic
902965213 1:19996072-19996094 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
903217572 1:21851842-21851864 CCGGGCCAGCAACGGCATGGAGG - Exonic
903281934 1:22255039-22255061 CACGGTGAGCAAAGGCAGGGAGG + Intergenic
903994878 1:27299526-27299548 TGGTGTGAACAAAGGCATGGGGG + Intronic
904071341 1:27800185-27800207 TAGTGTGAGCAAAGGCATGGTGG - Intronic
904301497 1:29557452-29557474 CAGTGTGAGCAAAGGCACCTGGG + Intergenic
904355922 1:29939820-29939842 CAGCATAAGCAAAGGCCTGGAGG - Intergenic
904521779 1:31101350-31101372 CAGGGTGTGCAAAGGCCTCTGGG + Intergenic
904787731 1:32995310-32995332 CAGCTTGTACAAAGGCATGGAGG - Intergenic
904962787 1:34347838-34347860 CATGGTGGGCAAGGCCATGGGGG + Intergenic
905227245 1:36487251-36487273 CAGCCTGAGCAAAGGCCAGGAGG - Intergenic
905227367 1:36488055-36488077 CAGTGAGAACAAAGACATGGAGG + Intergenic
905335123 1:37239761-37239783 CAGCATGAGTAAAGGCCTGGAGG - Intergenic
905575733 1:39043177-39043199 CAGTATGAGCAAAAGCATGGAGG + Intergenic
905872119 1:41410716-41410738 CAGTGTGAGCAAAGGCACAGAGG + Intergenic
905897347 1:41557514-41557536 TAGAGTGTGCAAAGGCATTGGGG + Intronic
906579634 1:46925692-46925714 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
906604089 1:47153196-47153218 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
906718192 1:47985937-47985959 CAACATGAGCAAATGCATGGAGG + Intronic
906732908 1:48098579-48098601 CAGTATGAGCAAAGGCGTGCAGG - Intergenic
906815034 1:48870003-48870025 TAGCATAAGCAAAGGCATGGAGG - Intronic
906856282 1:49308723-49308745 CAGAATGAGAAAAGGCAGGGTGG + Intronic
907048365 1:51313667-51313689 CAGGCTGGGCAAAGGCCTGGAGG - Intronic
907074275 1:51564553-51564575 CAGGCAGAGCAAAGCCTTGGAGG - Intergenic
907238770 1:53069281-53069303 CAGCATGTGCAAAGGCCTGGAGG + Intronic
907388404 1:54140520-54140542 CAGCATGTGCAAAGGCCTGGAGG - Intronic
907519480 1:55013867-55013889 CAGCATGAGCCAAGGCAGGGTGG - Intergenic
907718472 1:56950029-56950051 CAGCTTAAGCAAAAGCATGGAGG + Intronic
907768909 1:57440050-57440072 CAGTATGAGCAAAGTAATGGAGG - Intronic
908180693 1:61602254-61602276 CATCATGAGCAAAGGCACGGAGG + Intergenic
908232797 1:62122413-62122435 CATGGTGAGTAAATGCTTGGAGG - Intronic
908256488 1:62308005-62308027 CGGGGTGAGCAAAGGCACAGGGG - Intronic
908333625 1:63097401-63097423 CAGTATGAGCAAAGACATCGAGG + Intergenic
908592788 1:65651826-65651848 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
908737419 1:67291104-67291126 CTGGGGGAGAAAAGGCAGGGTGG - Intergenic
909153453 1:72039095-72039117 CAGAATGAGTCAAGGCATGGAGG + Intronic
909384159 1:75036509-75036531 GAGGGTGAGCACAAGCAGGGTGG + Intergenic
909500454 1:76329497-76329519 CAGTTTGAGCTAAGGCATGAAGG - Intronic
909782254 1:79561624-79561646 CAGGGGGAGCTTGGGCATGGTGG + Intergenic
910342590 1:86204566-86204588 CAGCTTGTACAAAGGCATGGAGG + Intergenic
910626852 1:89316477-89316499 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
910827916 1:91428731-91428753 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
910938359 1:92505665-92505687 CAGGTTGAGCAGAGACCTGGTGG + Intergenic
911069591 1:93822101-93822123 CAGTGTGGGCAAAGGCATTGAGG + Intronic
911327413 1:96484376-96484398 CAGGATGTGCAATGGCATGAAGG - Intergenic
911543019 1:99182039-99182061 GAGGTTGACCAAAGGCATGCTGG - Intergenic
911689766 1:100820102-100820124 GAGGGTGAGCCAAAGCAGGGCGG + Intergenic
912315783 1:108666674-108666696 GAGGGGGAGCAAAAGCAGGGAGG - Intergenic
912447619 1:109750025-109750047 GAGGGAGACCAAAGGCAGGGAGG - Intronic
912471409 1:109909731-109909753 CAGTCTGAGCAAAGGCATTCGGG + Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912636155 1:111295731-111295753 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
912748041 1:112262234-112262256 CAGAGTAAGCAAAGGCATAGAGG + Intergenic
912861775 1:113219841-113219863 CAGAGTGACCACAGGCCTGGTGG + Intergenic
912894948 1:113576453-113576475 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
912976492 1:114335692-114335714 TAGCATGAGCAAAGGCATGAAGG + Intergenic
913102815 1:115584819-115584841 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
913111777 1:115663735-115663757 CAGGATCAGCAAGGACATGGAGG + Exonic
914946699 1:152073194-152073216 CAGCATTAACAAAGGCATGGAGG - Intergenic
915018959 1:152761623-152761645 AAGAGTGAGCAGAGGCTTGGAGG - Exonic
915061443 1:153188947-153188969 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
915067602 1:153239491-153239513 CAGGGTTTGCAGAGGCATGAGGG - Intergenic
915457292 1:156049332-156049354 CAGGCAGAGCAAAGACTTGGGGG - Intronic
915771858 1:158433341-158433363 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
916469559 1:165109539-165109561 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
916731678 1:167572196-167572218 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
917041550 1:170810893-170810915 GAGGGTGAGCCAAAGCAGGGCGG + Intergenic
917091645 1:171359368-171359390 GAGGGTGAGCCAAAGCATGGTGG + Intergenic
917192377 1:172431760-172431782 GAGGGTGAGCCAAAGCAGGGCGG + Intronic
917230188 1:172828130-172828152 TTGGATGAGCAAAGGCACGGAGG + Intergenic
917529785 1:175824300-175824322 CAGGATGAATAAGGGCATGGAGG - Intergenic
917585058 1:176417440-176417462 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
917640394 1:176978124-176978146 TAGTATGACCAAAGGCATGGAGG + Intronic
918010656 1:180583526-180583548 CAGCATGTGCAAAGTCATGGAGG - Intergenic
918163278 1:181920580-181920602 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG + Intronic
918185380 1:182122200-182122222 GAGGGTGAGCAAGGGCGTGGAGG - Intergenic
918322263 1:183375445-183375467 CAGCCTGGGCAAAGGCATAGGGG - Intronic
919406924 1:197196813-197196835 CAGCATGTGCAAAGGCATTGAGG - Intronic
919656827 1:200205148-200205170 CAGTGTGCACAAAGTCATGGAGG + Intergenic
919782629 1:201230703-201230725 CACCATGAGCAAAGGCAAGGAGG + Intergenic
919866453 1:201786631-201786653 CAGGGTGAGGCAAGGCAGGTGGG + Intronic
920092946 1:203467073-203467095 CAGACTGGGCAAAGGCATAGAGG + Intergenic
920558318 1:206920510-206920532 CAGCATGGGCAAAGACATGGTGG + Intronic
920686872 1:208116094-208116116 ATGTATGAGCAAAGGCATGGAGG - Intronic
920985508 1:210885255-210885277 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921054194 1:211531796-211531818 TGGGGTGAGCAAAGGCCTGGAGG + Intergenic
921216964 1:212946085-212946107 CAGTTTGAGCAAGGACATGGTGG - Intergenic
921257263 1:213353917-213353939 CAGCCTGAGCAAAGGCACAGAGG + Intergenic
921631261 1:217437077-217437099 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
922006000 1:221531257-221531279 TAGGATGTGCAAAGGCCTGGAGG - Intergenic
922050348 1:221983426-221983448 CAGCATGAGCAAAGGCATGGAGG - Intergenic
922066129 1:222145642-222145664 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922684065 1:227625674-227625696 CCGGGTGAGTATAGGTATGGAGG + Intronic
922715928 1:227872034-227872056 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922743562 1:228030468-228030490 CTGGGTCAGCATATGCATGGTGG - Intronic
923194501 1:231652061-231652083 CAGGGTGAGCCGAAGCAGGGCGG - Intronic
923239088 1:232063012-232063034 CGGGGAGAGAAAAGGCAAGGTGG + Intergenic
923262151 1:232277574-232277596 CAAGGTGACAAAAGGCCTGGTGG + Intergenic
923511541 1:234657850-234657872 CAGGGTGATCTGAGACATGGTGG + Intergenic
923853345 1:237820368-237820390 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
924371338 1:243353582-243353604 CAGCTTGAGCAAAGGAATGGGGG + Intronic
924737211 1:246768990-246769012 CAGGGCCAGCAAAGGCATCACGG - Intergenic
1062785091 10:257973-257995 CAGGGTGAGCAGAGGCTGGCTGG + Intergenic
1064193329 10:13226046-13226068 AAGGATGAGCAAATGCATAGAGG - Intronic
1064233078 10:13547089-13547111 CAGTATGTGCAAAGGAATGGAGG + Intergenic
1065102707 10:22346155-22346177 GAAGGTGATCAAAGGCAGGGTGG - Intronic
1065164184 10:22957500-22957522 CAGGATGAGGACAGTCATGGCGG + Intronic
1065963866 10:30755048-30755070 CAGGAGGAGCACAGGGATGGAGG - Intergenic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1067125520 10:43512253-43512275 CTGGGGGAGAGAAGGCATGGTGG + Intergenic
1067462395 10:46467337-46467359 GATGGTGAGCAGAGGCCTGGGGG - Intergenic
1067624802 10:47917300-47917322 GATGGTGAGCAGAGGCCTGGGGG + Intergenic
1067760383 10:49040571-49040593 AAGGGTGAGGCCAGGCATGGTGG - Intronic
1068275691 10:54792853-54792875 CAGGTTGAGCACTGGCAGGGTGG + Intronic
1068357188 10:55923806-55923828 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1068651560 10:59528342-59528364 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1068789200 10:61008873-61008895 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1068892774 10:62165048-62165070 CAGCATGAGCAAAGGCCTGGGGG - Intergenic
1069095167 10:64250230-64250252 AAGGAGGAGCAAAGGCATGAAGG + Intergenic
1069349056 10:67503263-67503285 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1069563792 10:69450168-69450190 CAGGCTGAGAAAAGGCCAGGTGG + Intergenic
1069736251 10:70656630-70656652 CAGCCTGTGCAAAGGCCTGGGGG + Intergenic
1069912161 10:71766248-71766270 CAGGGTGGCCAAAAGCATGTGGG + Intronic
1069988431 10:72299293-72299315 CAGAGGGAGCAAAGGCCTAGAGG + Intergenic
1070213086 10:74347277-74347299 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1070310942 10:75273354-75273376 CAGCTTGAGCAAAGGCCAGGAGG - Intergenic
1070545238 10:77446872-77446894 CAGTGTGAACAAAGGTATGGAGG - Intronic
1070661093 10:78305782-78305804 CAGCTTGGGCAAAGGCATGGAGG - Intergenic
1070836718 10:79452021-79452043 CAGCAAGTGCAAAGGCATGGAGG - Intergenic
1070843649 10:79505200-79505222 CAGCGTGAGCAGGAGCATGGAGG - Intergenic
1070930017 10:80254400-80254422 CAGCGTGAGCAGGAGCATGGAGG + Intergenic
1071528559 10:86372490-86372512 CAGCGAGAGGAAAGGTATGGAGG + Intergenic
1072343250 10:94476808-94476830 TAACATGAGCAAAGGCATGGAGG - Intronic
1072493788 10:95934683-95934705 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1072548847 10:96461600-96461622 GAGGCTAAACAAAGGCATGGAGG - Intronic
1072628693 10:97131092-97131114 CAGGCCGAGCAAGGGCATTGTGG + Intronic
1072783675 10:98266720-98266742 CAGTGAGAGCAAAGGCTTGGAGG - Intronic
1073176822 10:101561880-101561902 CTGGGTGCGCATAGGCATGTGGG - Intergenic
1073580638 10:104662729-104662751 CAAGATGAGTAAAGGCTTGGAGG + Intronic
1074015463 10:109529867-109529889 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1074017248 10:109546441-109546463 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1074320486 10:112397539-112397561 CAGCCTGAGCAAAGGCATGGAGG - Intronic
1074448459 10:113539504-113539526 CAACATGAGCAAAGGCTTGGAGG - Intergenic
1074671676 10:115798615-115798637 CAGGATGAGCAAAGGCATGGAGG - Intronic
1075105652 10:119538498-119538520 CTGGGGGAGCAAAGGCACAGAGG + Intronic
1075734354 10:124654834-124654856 CAGGGCGAGCAGAGGCACGCCGG - Intronic
1075921784 10:126219364-126219386 CACGGGGAGAAAAGGCATGGGGG - Intronic
1075985321 10:126780049-126780071 CTGTGTGAGCAAAGGCCTAGAGG - Intergenic
1076192674 10:128493897-128493919 CAGTGTGAGCACAGGCCTGAAGG + Intergenic
1076963810 11:61183-61205 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1077211436 11:1372552-1372574 TAGGGTGAGCTCAGGTATGGGGG - Intergenic
1077391981 11:2304442-2304464 CAGGGTGAGGTAGGGCCTGGTGG - Intronic
1077469034 11:2748280-2748302 CAGGGTGAGCTAGGGGGTGGGGG - Intronic
1077599973 11:3567766-3567788 CAGGATGTGCAAAGGCCTTGAGG + Intergenic
1077785786 11:5382256-5382278 TAGTGTAAGCAAGGGCATGGAGG - Intronic
1078481824 11:11683378-11683400 AAGGAGAAGCAAAGGCATGGTGG - Intergenic
1078532682 11:12149155-12149177 CAGCATCAGCAAAGGCATGTGGG + Intronic
1078542135 11:12221263-12221285 TGGTGTGGGCAAAGGCATGGTGG - Intronic
1078657155 11:13252349-13252371 TAGCTTGAGCAAAAGCATGGAGG + Intergenic
1078966592 11:16351647-16351669 CAGGCAGAGCAAAGGCTAGGAGG - Intronic
1079080549 11:17410681-17410703 GAGGGTAGGGAAAGGCATGGTGG + Intronic
1079165158 11:18033980-18034002 CAGGGTGAGGGAAGGCTTTGCGG - Intronic
1079361134 11:19771462-19771484 CAGCCTGAGCAAAGGCATGGAGG + Intronic
1079419269 11:20270907-20270929 TAGCGTGAGCAAAGGCTTAGGGG - Intergenic
1079474837 11:20819315-20819337 CAGTGAGAGGAAAGGCTTGGTGG + Intronic
1079517789 11:21289357-21289379 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1079629930 11:22661667-22661689 TAGCATGAGGAAAGGCATGGAGG + Intronic
1079867821 11:25758137-25758159 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080033697 11:27688705-27688727 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1080354681 11:31429152-31429174 TATGGAGAGCAAAGGCATTGTGG + Intronic
1080427357 11:32168449-32168471 CAGGCTGAGCAAAGCCAGGCTGG + Intergenic
1080682316 11:34488338-34488360 TAAGGGGAGCAAAGGCATGAAGG + Intronic
1080709982 11:34737670-34737692 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080774125 11:35370021-35370043 CAGTGTGGGCAAAGGCATGAAGG + Intronic
1081118198 11:39231917-39231939 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081545850 11:44071109-44071131 CACCTTGAGCAAAGGCAAGGAGG + Intronic
1081632526 11:44699579-44699601 CTGCATGAGCAAAGGCATGGAGG + Intergenic
1082798066 11:57392847-57392869 CAGCTTGAGCAAAGGTGTGGAGG + Intronic
1082867161 11:57910713-57910735 CAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1082876400 11:57992971-57992993 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1083896870 11:65624459-65624481 CAGGGTGAACACTGGCAGGGAGG - Exonic
1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG + Exonic
1084218169 11:67662815-67662837 AGGGGAGAGCAAAGGCCTGGAGG + Exonic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084440014 11:69167445-69167467 CGGTGTGAGCAAAGGCCTGGAGG + Intergenic
1084495557 11:69501161-69501183 GAGGGAGAGCAGATGCATGGAGG + Intergenic
1084547569 11:69822095-69822117 GTGGGTGAGCAAGGGCCTGGAGG - Intergenic
1084589780 11:70084028-70084050 CAGTGTCTGCAAAGGCAAGGAGG + Intronic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1084947557 11:72646759-72646781 CAGGTTGGGCAAAGGCAAAGAGG - Intronic
1084965840 11:72744010-72744032 CCGGGTAAGCAAAGGCTTGGTGG - Intronic
1085125911 11:74002224-74002246 CAAGAGGAGCAAAGGCATGGAGG - Intronic
1085352842 11:75811280-75811302 CAGCATGAGCAAAGGCACAGGGG - Intergenic
1085394207 11:76198509-76198531 AAGCTTGGGCAAAGGCATGGTGG - Intronic
1085404404 11:76253361-76253383 CAGCATAAGCAAAGACATGGAGG + Intergenic
1085433718 11:76480762-76480784 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1085465784 11:76722357-76722379 CAGCTTGTGCAAAGGCGTGGAGG - Intergenic
1085717148 11:78882358-78882380 CAGCATGGGCAAAAGCATGGTGG - Intronic
1085827575 11:79864549-79864571 GAGGGTGAGCCAAAGCAGGGAGG + Intergenic
1086074859 11:82839742-82839764 CAGGGTGAGAAAGGGCAAAGGGG - Intronic
1086612913 11:88778425-88778447 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1086907403 11:92433528-92433550 GAGGGTGAGCAAAAGTAGGGTGG - Intronic
1087776275 11:102259829-102259851 GAGGTTAGGCAAAGGCATGGTGG - Intergenic
1088078379 11:105879186-105879208 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1088853170 11:113722074-113722096 CAGCCTAAGCAAAGGCATGGAGG - Intergenic
1089129552 11:116201008-116201030 CCGGGAGAGCAGAAGCATGGAGG + Intergenic
1089133751 11:116232998-116233020 CAGCATGTGCAAAGGTATGGAGG - Intergenic
1089618819 11:119710677-119710699 CAGGAACAGCAAAGGCATGGTGG + Intronic
1089620566 11:119719973-119719995 CAGCATGTGCAAAGGCACGGAGG + Intronic
1089770100 11:120796624-120796646 CAGCATTGGCAAAGGCATGGAGG + Intronic
1089954311 11:122556146-122556168 GAGGGTGGCCAGAGGCATGGGGG - Intergenic
1090103822 11:123830192-123830214 CAGGGCGAGCCAAAGCAGGGCGG - Intergenic
1090246353 11:125218521-125218543 TAGGCTGAGCAAAAGCACGGAGG + Intronic
1090321049 11:125844258-125844280 GAGAGTGAGCAAAAGCAGGGTGG + Intergenic
1090422815 11:126587277-126587299 CAGCGTGTGCAAAGGCTGGGAGG + Intronic
1090718525 11:129451900-129451922 GAGGGTGGGCAAAAACATGGGGG + Exonic
1090811620 11:130249640-130249662 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1090888570 11:130901536-130901558 GAAGATGAGCAAAGGCCTGGGGG + Intronic
1091778510 12:3199844-3199866 CCACGTGTGCAAAGGCATGGAGG + Intronic
1091804183 12:3344063-3344085 CAGTGTGAGCAAAGGCCTGGCGG + Intergenic
1092064601 12:5579466-5579488 CAGTGTGAGCAAAAGCATGGTGG + Intronic
1092398876 12:8154208-8154230 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1092440320 12:8495749-8495771 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1092637479 12:10467195-10467217 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1092890972 12:12969024-12969046 CAGTGTGAGTGAAGGCATGAAGG + Intergenic
1093677592 12:21962348-21962370 GAGGGTGAGCCAAAGCAGGGCGG + Intergenic
1093909238 12:24726963-24726985 CTGGTTGAGCAAAGCCATAGAGG - Intergenic
1094069496 12:26397307-26397329 CAGGATAAGCAAAGTCATGGAGG - Intronic
1094070065 12:26403163-26403185 CAGGATGAGCAAAGGCAAACAGG + Intronic
1094156001 12:27337498-27337520 CAGCCTGAGGAAAGGCCTGGAGG - Intronic
1094488657 12:30945063-30945085 CAGTGTGAGCAAAGGCCTGGGGG - Intronic
1095488407 12:42708037-42708059 GAGGGTGAGCTGAGGCAGGGTGG + Intergenic
1095665106 12:44788567-44788589 GAGGGTGCCCAGAGGCATGGGGG + Intronic
1095874774 12:47068509-47068531 CAGGCTGAGCAAAGACCTGAAGG + Intergenic
1095920699 12:47526870-47526892 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1096465547 12:51846392-51846414 CAGCGGGAGCAAAGGCAGAGAGG + Intergenic
1096590267 12:52653984-52654006 TAGTGTGAGCACAGTCATGGTGG - Intergenic
1096660254 12:53119670-53119692 CAGTATGGGCAAAGGCCTGGAGG - Intronic
1096678823 12:53241633-53241655 CAGTGTGAACAAAGGACTGGAGG + Intergenic
1097253665 12:57655823-57655845 CAGGGTGGGCATGGGCTTGGTGG + Intergenic
1097364892 12:58701475-58701497 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1097365767 12:58710341-58710363 GAGGGTGAGCCAAAGCAGGGCGG - Intronic
1098176073 12:67792603-67792625 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1098438866 12:70497491-70497513 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1099071449 12:78049504-78049526 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1099183841 12:79497156-79497178 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1099253801 12:80290186-80290208 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
1099296409 12:80833492-80833514 TAGGGTGTGTGAAGGCATGGAGG - Intronic
1099554694 12:84097277-84097299 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1099740332 12:86626890-86626912 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1100492061 12:95090231-95090253 CAGCATGAGCAAAGGCAGAGAGG + Intronic
1100739962 12:97581235-97581257 GAGGGTGAGCAAAAGCAGGGTGG + Intergenic
1100793588 12:98156863-98156885 TAGTGTGTGCAAAGACATGGAGG + Intergenic
1100873708 12:98940213-98940235 CATAGAGAGCAAAGACATGGAGG - Intronic
1101347581 12:103900814-103900836 CTGCATGGGCAAAGGCATGGAGG + Intergenic
1101502319 12:105315673-105315695 CTGCATGAGCAAAGGTATGGTGG + Intronic
1101617663 12:106354067-106354089 CAGCGTGAGCAATGGCATGAGGG - Intergenic
1101876400 12:108599167-108599189 CAGCGTGGGTAAAGGTATGGTGG + Intergenic
1102028862 12:109728575-109728597 CAGTCTGAGCAAAGGCACAGAGG - Intronic
1102240824 12:111323502-111323524 GAGGCTGAGGACAGGCATGGGGG + Intronic
1102242103 12:111331027-111331049 CAGCCTGAGCAAAGACATAGGGG + Intronic
1102300148 12:111765895-111765917 CAGAGGAAGAAAAGGCATGGGGG - Intronic
1102689077 12:114746394-114746416 CAGGGCTAGCAAAGGCTTTGAGG + Intergenic
1102814989 12:115858487-115858509 CAGCATAAGCAAAGGCCTGGTGG + Intergenic
1103169238 12:118799447-118799469 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1103257953 12:119559056-119559078 CCATGTGAGCAAAGGCATGGAGG + Intergenic
1103614425 12:122143164-122143186 GAGGGTGAGGAGAGGCAGGGAGG - Exonic
1104519008 12:129455671-129455693 CAGTGTGTGCAAAGGCACGGTGG + Intronic
1104642416 12:130475919-130475941 GAGGGTGAGTAAAGGAATTGGGG + Intronic
1104876583 12:132039104-132039126 CAAGCTGAGCACAGGCAAGGAGG - Intronic
1104947303 12:132421806-132421828 CAGTGAGAGGATAGGCATGGAGG + Intergenic
1105737463 13:23285904-23285926 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1106326389 13:28694178-28694200 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1106326897 13:28700340-28700362 CAGTGTGTGAAAAGACATGGAGG + Intronic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106426676 13:29636955-29636977 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1106429339 13:29665429-29665451 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1106466812 13:30021082-30021104 CAAGGTGGGCAAGGGCTTGGGGG - Intergenic
1107012228 13:35680552-35680574 CAGGGTGGCCAAAGTCAGGGTGG + Intergenic
1107305606 13:39015007-39015029 CAGTATGAGCAAATGTATGGGGG - Intronic
1107408339 13:40136177-40136199 CAGCGAGAGCAAAGGCCAGGTGG - Intergenic
1107962141 13:45568002-45568024 CAGGGTAAGAAAAGGCTTGCAGG - Intronic
1108743402 13:53362859-53362881 CAAGGAAAGGAAAGGCATGGAGG + Intergenic
1108747735 13:53412078-53412100 CAGCTTGAGCAAAGGCATCTAGG + Intergenic
1108940488 13:55947500-55947522 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1108998236 13:56762990-56763012 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1109457570 13:62612017-62612039 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1109950994 13:69501939-69501961 CAGGGGGAGAGAAGGCAGGGTGG + Intergenic
1110824598 13:79957955-79957977 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1111627873 13:90813046-90813068 CAGGATGAGCAAAAGCAGGGTGG + Intergenic
1111791250 13:92858316-92858338 AAGGAAGAGCAAAGGGATGGTGG - Intronic
1112157129 13:96830609-96830631 CAGGTTGAGGACAGGCATGCTGG + Intronic
1112312337 13:98330114-98330136 CAGCCTGTGCAAAGGCCTGGAGG + Intronic
1113348833 13:109508280-109508302 GAGGGTGAGCCAAAGCAGGGCGG - Intergenic
1113520742 13:110938789-110938811 AAGTATGAGCAAAGCCATGGTGG + Intergenic
1113826274 13:113256531-113256553 CAGGGTGAGCGAAGGACAGGTGG - Intronic
1114416452 14:22548043-22548065 CAGTCTGAGCAAAGGCAGGCAGG - Intergenic
1114672130 14:24416965-24416987 CAGGTGCAGCAAAGGCAGGGAGG - Exonic
1114695561 14:24624010-24624032 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1114758228 14:25283610-25283632 CAGGGGGAGAGAAGGCAGGGTGG + Intergenic
1114844817 14:26308758-26308780 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1115174569 14:30547617-30547639 CAGGGGGGGCTTAGGCATGGTGG + Intergenic
1115267078 14:31511802-31511824 CACAGTGAGCAAAGGCATGGAGG + Intronic
1115277153 14:31621584-31621606 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1115357083 14:32460429-32460451 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1115511184 14:34139486-34139508 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1115537968 14:34391353-34391375 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1115584555 14:34797828-34797850 CAGGGCGAGCCAAAGCAGGGCGG + Intronic
1115743172 14:36409562-36409584 GAGGGTGAGCCAAAGCAGGGAGG + Intergenic
1115982191 14:39065643-39065665 CAGTGTGAGGAGAGGCATAGAGG - Intronic
1116272848 14:42794770-42794792 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116511964 14:45757051-45757073 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1116565323 14:46438329-46438351 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116775639 14:49178319-49178341 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1117008602 14:51447508-51447530 CAGTCTGAGCAAAGGCCTAGAGG - Intergenic
1117120976 14:52568149-52568171 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1117172312 14:53113581-53113603 GAGAGTGAGCAGAAGCATGGTGG + Intronic
1117211584 14:53506495-53506517 CAGGATGAGCAAAGCCTTGGAGG - Intergenic
1117836771 14:59815929-59815951 CACCCTGAGCAAAGGCATGAAGG - Intronic
1117850145 14:59958904-59958926 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1117973376 14:61274220-61274242 CAGCATGAGCAAAGACACGGAGG + Intronic
1118005449 14:61561264-61561286 CAGGGTGAGTGAAGAGATGGGGG - Intronic
1118570251 14:67187749-67187771 CAGTCTGAGCAAAGGCACAGAGG - Intergenic
1118735134 14:68695697-68695719 CAGGGTGACCAGAGGCTTGTGGG - Intronic
1119025084 14:71146137-71146159 TAGGTTGAGCAATGGCCTGGTGG - Intergenic
1119197548 14:72728400-72728422 CAGCGGGACCAATGGCATGGAGG + Intronic
1119399088 14:74349641-74349663 CTGGGTGGGCCAAGGGATGGAGG - Intronic
1119783596 14:77296076-77296098 CAGGATGAGCAAAGGATAGGAGG + Intronic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1119965040 14:78905175-78905197 CAGGCTGGGCAAAGGAAAGGAGG - Intronic
1120122245 14:80695426-80695448 CAGGGTGTGGCCAGGCATGGTGG + Intronic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1121737853 14:96231125-96231147 AAGGGTGAGCAAAGCCAGGCCGG + Intronic
1122053934 14:99079489-99079511 GAGGGTGAGAAAAGGGATGGTGG - Intergenic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122245199 14:100397722-100397744 CAGAGTGTGCAAAGGCAGGGAGG + Intronic
1122281296 14:100623990-100624012 CAGCTGGAGCAAAAGCATGGAGG - Intergenic
1122382260 14:101316618-101316640 CAAGGTAAGAAAAGCCATGGGGG + Intergenic
1122466689 14:101938553-101938575 CAGCGTGTGCAAAGGCACTGGGG - Intergenic
1122576531 14:102746607-102746629 CAGGCTGAGCCAGGGCTTGGAGG + Intergenic
1122774928 14:104112921-104112943 CAGCCTGGGCAAAGGCAGGGTGG - Exonic
1123006405 14:105325886-105325908 GAGAGTAAACAAAGGCATGGAGG - Intronic
1123739423 15:23221878-23221900 CAGAGTGAGAAAAGGCAAAGAGG - Intergenic
1124290643 15:28450830-28450852 CAGAGTGAGAAAAGGCAAAGAGG - Intergenic
1124292593 15:28466716-28466738 CAGAGTGAGAAAAGGCAAAGAGG + Intergenic
1124400868 15:29346172-29346194 CAGGGAGGGCAAGGGCAAGGAGG + Intronic
1124624705 15:31301204-31301226 CAAGGTGAACAAAGGCAGTGGGG - Intergenic
1124885666 15:33683655-33683677 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1124948451 15:34292986-34293008 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1125025047 15:35021167-35021189 AATGGTGTGCAAAGGCCTGGAGG - Intergenic
1125288432 15:38119567-38119589 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1125609123 15:40958938-40958960 CAGGGTGAGGAGAGCCAGGGTGG + Intergenic
1125612069 15:40978261-40978283 CAGGGTGAGCAAGGCTAGGGAGG + Intergenic
1125898137 15:43319857-43319879 CATTGTGAGTAAAGGAATGGAGG + Intergenic
1126007645 15:44273627-44273649 CAGAGTGTTCCAAGGCATGGAGG + Intergenic
1126023845 15:44427342-44427364 CAGGATGAGCAAGGGCCTGGGGG - Exonic
1126050750 15:44682937-44682959 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1126476280 15:49068697-49068719 GAGGGTGAGCCAAAGCAGGGCGG + Intergenic
1126715007 15:51506348-51506370 CAGGCTGGGCATGGGCATGGTGG - Intronic
1126793645 15:52242873-52242895 CAGCATGAGTAAAGGCATGGAGG + Intronic
1126956128 15:53935664-53935686 GAGGGTGAGGAAAAGCAGGGTGG + Intergenic
1126957272 15:53947555-53947577 CAAGGTGATCAGAGGCATGATGG - Intergenic
1127165935 15:56244540-56244562 CAGCATGAGCAAAGGCACGAAGG - Intronic
1127339505 15:58026539-58026561 GAGGGTGAGCCAACGCAGGGTGG + Intronic
1127492699 15:59480030-59480052 CAGGGAGAGGCATGGCATGGTGG + Intronic
1127848194 15:62889977-62889999 CTGTGTGAGCAGAGGCTTGGAGG + Intergenic
1128087225 15:64894625-64894647 CAGCCTGGGCAAAGGCAGGGAGG + Intronic
1128463366 15:67888276-67888298 CAGAATGAGCAAAAGCCTGGAGG + Intergenic
1128554084 15:68618503-68618525 CAGTGTGATCAAAGGCTGGGAGG + Intronic
1128699431 15:69793619-69793641 CAGAGTGAGCAAAGGCACAGAGG - Intergenic
1128719787 15:69939956-69939978 AGGAGGGAGCAAAGGCATGGAGG - Intergenic
1128857595 15:71032273-71032295 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1129169541 15:73799238-73799260 CAGAGTGAGCTAAGGTCTGGAGG + Intergenic
1129236509 15:74226853-74226875 CAGTGTGAGCAAAGGCGTGGAGG + Intergenic
1129252294 15:74315722-74315744 CTGCGTGAGCAAAGGCACAGAGG + Intronic
1129270396 15:74416556-74416578 CAGGGTGAGCAGGGGCGTGAGGG - Exonic
1129330554 15:74824897-74824919 CAGCATGAGAAAAGGCAGGGAGG + Intronic
1129685711 15:77685064-77685086 CAGCTTGAGCAAGGGCCTGGAGG + Intronic
1129713873 15:77835941-77835963 CTGTGTGAGCAAAGGCTTGGAGG - Intergenic
1129851895 15:78798256-78798278 CAGAGTGAGCAAAGGCCCAGCGG - Intronic
1130373638 15:83308857-83308879 CTTGCTGAGCAAAGGCACGGAGG - Intergenic
1130751206 15:86715024-86715046 CAGGGAGTACAGAGGCATGGTGG - Intronic
1130821635 15:87502227-87502249 CAGCCTGTGCAAAGGCATGGGGG - Intergenic
1130864242 15:87918475-87918497 TAGCATGAGCAAAGTCATGGAGG - Intronic
1131077997 15:89510345-89510367 CAGCATGTGCAAAGGCATGGAGG + Intergenic
1131857722 15:96616578-96616600 CAGGGAGACCAAAGGCCGGGAGG - Intergenic
1132177014 15:99724056-99724078 CAGTGTGAGCGAAGGCCTAGAGG - Intronic
1132235422 15:100216566-100216588 CAAGGAGAGCAAAGGTAAGGAGG - Intronic
1132444743 15:101903990-101904012 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1133410935 16:5568269-5568291 CAGCTTGGGCAAAGGCAAGGAGG - Intergenic
1134067736 16:11240057-11240079 CAGCATCAGCAAAGGCCTGGAGG - Intergenic
1134667768 16:16031625-16031647 CAGTGTGTGCAAAGGCCCGGTGG - Intronic
1135775867 16:25257446-25257468 CAGGCTGAGGAAAGGCTGGGCGG + Exonic
1135825213 16:25721168-25721190 CAGTGTGTGCAAAGGCTTGGAGG + Intronic
1135960356 16:26989904-26989926 CAGGGTGAGGAAAAGGAGGGCGG - Intergenic
1135984145 16:27171393-27171415 CAGGATGTACAAAGGCCTGGAGG + Intergenic
1136006861 16:27336736-27336758 CAGAGAGAGAAAAGGCATGGAGG + Intronic
1136053037 16:27666737-27666759 CAGAGTTAGGACAGGCATGGTGG + Intronic
1136077892 16:27829323-27829345 TAGTGTGTACAAAGGCATGGAGG + Intronic
1136096992 16:27963754-27963776 CAGCATGTGCAAAGCCATGGTGG - Intronic
1136111587 16:28066832-28066854 CAGTGTGGGGACAGGCATGGTGG + Intergenic
1136186377 16:28591098-28591120 CAGGGCTGGCAAAGGGATGGTGG - Intronic
1136289753 16:29264495-29264517 CAGGCTGTGAAAAGGCAGGGAGG - Intergenic
1137542926 16:49377296-49377318 CGGGGTGAGCAAAGGCCCAGAGG + Intronic
1137551083 16:49438052-49438074 GATGGTGAGCAGAGGCATAGAGG + Intergenic
1137558275 16:49486816-49486838 CACCATGAGCAAAGGCATGGAGG + Intergenic
1138109170 16:54309597-54309619 TAGAGTGAGGAAAGGCTTGGAGG - Intergenic
1138151468 16:54661507-54661529 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1138224080 16:55277663-55277685 GAGCATGAGCAAAGGCCTGGAGG + Intergenic
1138532651 16:57643221-57643243 CAGTGTGTGCAAAGGCTTGGAGG + Intronic
1138600188 16:58049447-58049469 CAGTGTAAGGAAAGGCATAGAGG - Intergenic
1138832754 16:60395031-60395053 CAGGGTGGGCAGAGAGATGGTGG - Intergenic
1138886830 16:61090613-61090635 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1139438035 16:66948178-66948200 CCGCTTGAGCAAAGGCAGGGAGG - Intergenic
1139449143 16:67016321-67016343 CAGCAGGAGCAAAGGCCTGGAGG + Intergenic
1139456890 16:67087021-67087043 CAGTGTATGCAAAGGCATGGAGG + Intronic
1139514462 16:67445132-67445154 CAGCATGTGCAAAGGCCTGGAGG + Intronic
1139657248 16:68396450-68396472 CAGCATGTGCAAAGGCATGGAGG - Intronic
1139946925 16:70647993-70648015 CAGTGTGAGCAAAGGTTTGGCGG + Intronic
1141621048 16:85236568-85236590 CAGTGTGTGCATAGGCCTGGGGG + Intergenic
1141765112 16:86053002-86053024 CTGCCTGAGCAAAGGCCTGGAGG + Intergenic
1141822330 16:86455153-86455175 CAGGGTGAGCAGGGCCATTGTGG - Intergenic
1141847098 16:86618300-86618322 TAGCTTGAACAAAGGCATGGAGG - Intergenic
1142095634 16:88237971-88237993 CAGGCTGTGAAAAGGCAGGGAGG - Intergenic
1142212699 16:88816051-88816073 CACCGTGAGCAGAGCCATGGGGG - Intronic
1142469852 17:157221-157243 AAGGGTGCGCAAAGGTGTGGAGG - Intronic
1142842772 17:2646942-2646964 CTGGGTGAGGCCAGGCATGGTGG + Intronic
1142956617 17:3527237-3527259 CAGCATGAGCAAAGGCTCGGAGG - Intronic
1143014773 17:3885814-3885836 CAGCCAGGGCAAAGGCATGGAGG - Intronic
1143096850 17:4482852-4482874 CAGTGTAAGCAAAGGTGTGGAGG + Intronic
1143100607 17:4502748-4502770 CAGCTTGAGCAGAGGCATGAAGG - Intronic
1143374680 17:6460234-6460256 CAGCATGTGCAAAGGCACGGAGG - Intronic
1143375751 17:6466131-6466153 CGGTGTGAGCAAAGGCCTGGAGG - Intronic
1143427225 17:6849497-6849519 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1143562334 17:7703433-7703455 CAGGGCGAGAAAGGGCAGGGAGG + Exonic
1144503385 17:15808486-15808508 CAGGATGAGCCAAGGCCTAGTGG + Intergenic
1144771546 17:17762313-17762335 CAGCATGTGCAAAGGCCTGGGGG + Intronic
1144809412 17:17989195-17989217 TGGTGTGAGCAAAGGCCTGGAGG + Intronic
1144851965 17:18248388-18248410 CAGTATGAGCAAAGGTCTGGAGG - Intronic
1145026322 17:19470622-19470644 AGGGGTGAGCAAAGCCATGGCGG + Intergenic
1145165564 17:20611193-20611215 CAGGATGAGCCAAGGCCTAGTGG + Intergenic
1146663170 17:34678703-34678725 TAGCATGAGCAAAGGTATGGGGG - Intergenic
1146679027 17:34793689-34793711 CAGACTGGGCAAAGGCATGGAGG - Intergenic
1147003449 17:37382319-37382341 AAGGGTGAGAAAAGGAAAGGAGG - Intronic
1147588720 17:41667540-41667562 CAGCCTGAGCAAAGGCACAGGGG + Intergenic
1147650768 17:42060602-42060624 CAGCCGGAGCAAAGGCATTGAGG - Intronic
1147837877 17:43347910-43347932 GAGGGTGAGGAAAGGCAGGAGGG + Intergenic
1147872355 17:43596533-43596555 CAGCATGAGCAAAGGCTTGGAGG - Intergenic
1147987130 17:44313085-44313107 CAGGCTGAGCCAGGGCAGGGAGG - Exonic
1148189512 17:45668698-45668720 TATGATGAGCAAAGGCCTGGAGG - Intergenic
1148204215 17:45769392-45769414 CATTGTGAGCAAAGGCCGGGAGG - Intergenic
1148967293 17:51446817-51446839 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1149003513 17:51780790-51780812 CAGTGTGAGCAAGAGCCTGGAGG + Intronic
1149026953 17:52037776-52037798 CAGGATGACCAAAGGCACAGAGG - Intronic
1149191975 17:54073397-54073419 GAGGGTGAGCCAAAGCATGGTGG - Intergenic
1149281358 17:55108703-55108725 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1149864935 17:60146148-60146170 CAGAATGAGAAAAGGCATGGAGG - Intergenic
1150853619 17:68729585-68729607 CAGGCTGAGGCCAGGCATGGTGG + Intergenic
1151360108 17:73583714-73583736 CAGGGTGAGCACACGGGTGGTGG + Intronic
1151491430 17:74434002-74434024 CAGGGGGCGCAGAGGCCTGGTGG - Intronic
1151518266 17:74611358-74611380 CAGGATGAGCTCAGGCCTGGGGG + Exonic
1151764552 17:76125446-76125468 GGGAGTGAGCAAAGGCATGGAGG - Intergenic
1151907007 17:77055173-77055195 GAGGCTGGGCAAAGGCAGGGAGG - Intergenic
1151908701 17:77066896-77066918 CATGGTGGGCAGAGGCAGGGCGG - Intergenic
1152044136 17:77924782-77924804 CAGGGTGGGAGAAGGAATGGAGG + Intergenic
1152239877 17:79155681-79155703 CAGGGTGGGCAAGAGAATGGAGG + Intronic
1152294843 17:79460953-79460975 CACACAGAGCAAAGGCATGGAGG - Intronic
1153115725 18:1653128-1653150 CAGGGTGAGCAGGGGCTTAGTGG - Intergenic
1153119114 18:1700113-1700135 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1155269418 18:24125177-24125199 CAGGGTGGGGCCAGGCATGGTGG - Intronic
1155304060 18:24462134-24462156 AAGAATGAGCAAAGGCATGCTGG + Intronic
1155424112 18:25688047-25688069 AAGGGAGAGAAAAGTCATGGTGG - Intergenic
1155897334 18:31346558-31346580 CAGGATAAGCAAACACATGGAGG - Intronic
1156979368 18:43266070-43266092 CAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1157198685 18:45640951-45640973 CTGGGTGAGAAGAGGCAAGGAGG - Intronic
1157556607 18:48616881-48616903 CAGTGTGAGCAAAAGCACAGAGG + Intronic
1157599496 18:48885411-48885433 CAGGAGGAGAAGAGGCATGGCGG + Intergenic
1157635426 18:49148802-49148824 CAGGGAGTGCAAAGGCTTTGAGG - Intronic
1157695190 18:49716748-49716770 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1159581237 18:70236565-70236587 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
1160640613 19:130814-130836 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1160663866 19:313778-313800 CAGGAGGAGCACAGGGATGGCGG - Intronic
1160914659 19:1490896-1490918 CAGGGCGAGGAGAGGCGTGGGGG - Exonic
1160940424 19:1618203-1618225 GAGGGTGAGAGAAGGCAGGGTGG - Intronic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161346553 19:3771305-3771327 CAGTGTGTGCAAAGACATGGAGG - Intronic
1161502605 19:4624964-4624986 CAGCTTCAGCAAAGGCTTGGGGG - Intergenic
1161503961 19:4633970-4633992 CATGGTGAGGAAAGACAGGGCGG + Intergenic
1161662883 19:5558040-5558062 CAGCATGTGCAAAGGCCTGGAGG + Intergenic
1161839706 19:6672127-6672149 CAGAGTGAGCAAAAGCACGAGGG - Intergenic
1162306888 19:9880242-9880264 CAGCATGGGCAAAGGCAGGGAGG + Intronic
1162366953 19:10255522-10255544 CAGGGTGTGCAAAGGCCCTGTGG + Intronic
1163481665 19:17560140-17560162 CAGCCTGTGCAAAGGCCTGGAGG - Intronic
1163502360 19:17684179-17684201 CAGCATGAGCAAAAGCATGGTGG - Intronic
1163506072 19:17707030-17707052 CAGCGTGTGCAAAGGCCTGCGGG - Intergenic
1163705026 19:18807556-18807578 CAGCGTGTGTAAAGGCTTGGAGG + Intergenic
1165233188 19:34400208-34400230 CAGAGGGAGCATAGACATGGAGG - Exonic
1165300090 19:34963359-34963381 CAGCGTGCGCAAAAGCTTGGGGG - Intronic
1165469935 19:35997371-35997393 CAGTGTGGGGAAAGGCCTGGAGG + Intergenic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165566980 19:36738865-36738887 GAGGCTGAGAAAAGTCATGGGGG + Intronic
1165588814 19:36947299-36947321 CAGGTTCAGCCAGGGCATGGTGG - Intronic
1166217291 19:41343940-41343962 CAGCCTGTGCAAAGGCCTGGAGG - Intronic
1166328320 19:42064873-42064895 GAGGGTCAGCAAAGGCATTCTGG - Intronic
1166388894 19:42397831-42397853 CAGCGTGACCAAAGACAGGGAGG + Intergenic
1166511242 19:43410354-43410376 CAGTGTGAGCAAAGCCAAAGAGG + Intronic
1166537880 19:43586628-43586650 CACTCCGAGCAAAGGCATGGGGG + Exonic
1166782471 19:45349676-45349698 CAGGGTGAGCAACGTGAGGGTGG + Intronic
1167619782 19:50554343-50554365 GAGGGTGACCCAGGGCATGGAGG - Intronic
1167690222 19:50980534-50980556 GAGGGTGTGCAAAGACCTGGGGG + Intronic
1167773828 19:51541901-51541923 GTGTGTGAGCAAAGGCATGAAGG - Intergenic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
925436455 2:3842426-3842448 CAGGGTGAGGAAGGGGGTGGTGG + Intronic
925729249 2:6905451-6905473 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
926044982 2:9703726-9703748 CAGGGTGAGCAGAGCCAAGTGGG - Intergenic
926207468 2:10844268-10844290 CAGCAGGAGCAAAGGCCTGGAGG + Intergenic
926553957 2:14334792-14334814 GAGCTTGAGCAAAGGCCTGGAGG + Intergenic
926630133 2:15128619-15128641 CAGGGTGTGCAATGGCATGGAGG + Intergenic
927021407 2:19020787-19020809 GAGGGTGAGCTAAAGCAGGGCGG - Intergenic
927027901 2:19089407-19089429 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
927096507 2:19751327-19751349 CAGCATGAGCAAAGGCGAGGTGG + Intergenic
927221182 2:20711558-20711580 GAGGGTGAGCCAAAGCAGGGCGG + Intronic
927241122 2:20920246-20920268 CAGTGGGAACAAAGGCATAGAGG + Intergenic
927311041 2:21631501-21631523 CAGGATGATTAAAGGCATTGGGG + Intergenic
927460553 2:23294804-23294826 CAGCATCAGCAAAGGCCTGGAGG - Intergenic
927961460 2:27242846-27242868 GAGGGTGAGGAGAGCCATGGTGG - Intronic
928079872 2:28301391-28301413 CAAGGTGAGCACAGGCTTTGGGG + Intronic
928211595 2:29327903-29327925 CCATGTGAGCAAAGCCATGGAGG + Intronic
928600648 2:32900766-32900788 CAGGGTGAGCCGAGGCATGGAGG + Intergenic
929828528 2:45329212-45329234 CAGTATTAGCAAAGGCATGGAGG - Intergenic
929875893 2:45796061-45796083 CAGCATGAGCAAAGGCACAGAGG - Intronic
929952834 2:46429276-46429298 GAAGGTGAGCAAAGTCCTGGAGG + Intronic
930028584 2:47044699-47044721 CAGGGTCAGGAAAGGCATTTTGG + Intronic
930106955 2:47647836-47647858 CAGCATGAGCAAAGGCATAGAGG + Intergenic
930476739 2:51891668-51891690 GAGGGTGAGCCAAAGCAGGGAGG - Intergenic
930692770 2:54381252-54381274 CAGCATGAACAAAGGCATAGAGG - Intronic
930951248 2:57146391-57146413 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
931004017 2:57827767-57827789 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
931204706 2:60136178-60136200 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
931384588 2:61786626-61786648 CCATCTGAGCAAAGGCATGGAGG + Intergenic
931480301 2:62633132-62633154 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
931558434 2:63530865-63530887 CAGTGTGAGCCAAAGCAAGGCGG + Intronic
931999012 2:67866578-67866600 CAGGGTGAGAAAAGGGTTGGGGG + Intergenic
932216608 2:69970187-69970209 CAGGGTGTGAAGAGGCATGGAGG - Intergenic
932418318 2:71586820-71586842 TAGGGTGAGCATAGGGAGGGAGG - Intronic
933250553 2:80024453-80024475 CAGCATGAGCAAAGGCATGAAGG + Intronic
933971955 2:87477018-87477040 CAGCATGTGCAAAGGCATGGAGG + Intergenic
934033497 2:88068215-88068237 GAAGGTGAGCAAAGGCTTCGGGG + Intronic
935532158 2:104247672-104247694 CAGGATGAGCAAAGGGAAAGAGG + Intergenic
936321771 2:111473179-111473201 CAGCATGTGCAAAGGCATGGAGG - Intergenic
936444672 2:112586218-112586240 AAGGCTGAGCACAGGCCTGGCGG - Exonic
936900037 2:117472340-117472362 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
936937769 2:117854568-117854590 GAGGGTGAGCAAATGCCTGGAGG - Intergenic
937024050 2:118682765-118682787 CAGGGTGGGGAAGGGCATTGTGG - Intergenic
937040531 2:118817247-118817269 CAGCATGTGCAAAGGCAGGGAGG - Intergenic
937800355 2:126074991-126075013 CTGGGGGAGAGAAGGCATGGTGG - Intergenic
938080472 2:128367391-128367413 AAGGCTGAGCAAAGGCAGTGGGG + Intergenic
938109678 2:128555477-128555499 CACCTTGTGCAAAGGCATGGAGG - Intergenic
938114250 2:128592429-128592451 CAGGGGGAGCAAGGGAATGAGGG + Intergenic
938144658 2:128823534-128823556 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
938224357 2:129602877-129602899 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
938291977 2:130155330-130155352 AAGGGTGAGCAAGGGCATTAGGG - Intronic
938464574 2:131517637-131517659 AAGGGTGAGCAAGGGCATTAGGG + Intergenic
938579782 2:132635598-132635620 CAGCGTGTGCAGAGGCATGGAGG + Intronic
938782952 2:134601970-134601992 CAGCTTGAACAAAGGCTTGGAGG + Intronic
938902436 2:135809322-135809344 CAGGCTGATCAATGGCTTGGTGG - Exonic
939179111 2:138783365-138783387 CAGAATGAGCAAAGGCAGAGTGG + Intergenic
939180306 2:138795794-138795816 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
939364883 2:141218936-141218958 CAGAGTGAGGAAAAGCAGGGTGG + Intronic
939738805 2:145881212-145881234 CAGGGTGGGCATGGGCTTGGCGG - Intergenic
940995069 2:160140399-160140421 CAGAGCAAGCAGAGGCATGGCGG + Intronic
940995800 2:160148620-160148642 GAGGGTGAGCAGAAGCAGGGCGG + Intronic
941682420 2:168413339-168413361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942120775 2:172774464-172774486 AAGCTTGAGTAAAGGCATGGGGG - Intronic
942431380 2:175914596-175914618 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942958755 2:181804541-181804563 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
943927424 2:193803071-193803093 CAGGGTGAGCGCAGGCAAGATGG + Intergenic
944267820 2:197748093-197748115 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
944330556 2:198461051-198461073 GAGGGTGAGGCCAGGCATGGTGG - Intronic
944472694 2:200071938-200071960 CAGTATAATCAAAGGCATGGAGG + Intergenic
945143760 2:206715061-206715083 CAGACTGGGCAAAGGCATGGAGG + Intronic
945210968 2:207381467-207381489 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
945670359 2:212795011-212795033 CAGGGTGAGCTAAGGAAGGGGGG + Intergenic
945788878 2:214278288-214278310 AAGGGTGAGCCAAAGCAGGGTGG - Intronic
946235252 2:218320737-218320759 CAGTATGTGCAAAGGCATGGGGG + Intronic
946528717 2:220548476-220548498 CAGCCTGAGCCAAGGCCTGGAGG + Intergenic
946827127 2:223690482-223690504 CAGCATGAACAAAGACATGGGGG - Intergenic
946912904 2:224484978-224485000 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
947363698 2:229372439-229372461 CAGAGTGAGCACAGGCCTGTGGG + Intronic
947440875 2:230120518-230120540 CTAGGGGAGAAAAGGCATGGTGG - Intergenic
947492041 2:230603490-230603512 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
947525006 2:230872326-230872348 AAGGGTGAGCAAGGGCCCGGGGG + Intronic
948035238 2:234853079-234853101 AAGGGTGAGCCAAGGCAGTGAGG - Intergenic
948035435 2:234854606-234854628 AAGGGTGAGCCAAGGCAGTGAGG - Intergenic
948154657 2:235771449-235771471 CAGGGTGACCTAAGGCATGTGGG + Intronic
948589398 2:239039516-239039538 CAGCCTGTGCAAAGGCCTGGAGG + Intergenic
948628322 2:239284337-239284359 CAGAGTGAGCCAACGCATGGGGG + Intronic
1168869406 20:1115677-1115699 CAGTATGTGCAAAGGCATGGTGG - Intronic
1168978251 20:1983912-1983934 CAGCATGTGCAAAGGCCTGGGGG - Intronic
1169397129 20:5242011-5242033 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1170205117 20:13789831-13789853 CAGGGTGAGGAAGGGAGTGGTGG + Intronic
1170451552 20:16489114-16489136 CAGGAGGGGCAAAGGCATGAGGG + Intronic
1170873452 20:20229573-20229595 CTGGGTAAGCAAATGGATGGAGG + Intronic
1171050453 20:21853583-21853605 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1171139676 20:22729915-22729937 CAGGGTGTGGAAAGTCATGGAGG + Intergenic
1171290543 20:23980620-23980642 CGGCGTGGGCAAAGGCCTGGGGG + Intergenic
1171514804 20:25720702-25720724 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1172486179 20:35299023-35299045 CAGGGAGGGCAAGGGCATGGGGG - Intergenic
1172634150 20:36398369-36398391 CAGCATGGGCAAAGGCATGGAGG + Intronic
1172667509 20:36610827-36610849 CACAGTGAGCAAAGCCATAGAGG + Intronic
1172754320 20:37272736-37272758 CAGCCTGAGCAAAGGCTTGGAGG + Intergenic
1172776036 20:37407596-37407618 CAGCCTGGGCAAAGGCATGGAGG - Intergenic
1172834125 20:37861963-37861985 CAGTGTGAGTGAAGGCATAGGGG + Intronic
1172834353 20:37863538-37863560 CAGAGGGAGCAGAGGCCTGGAGG + Intronic
1172847012 20:37935526-37935548 CAGCCTGTGCAAAGGCCTGGAGG - Intronic
1172972355 20:38882874-38882896 CAGTGTGTGCAAAGGCCTGGAGG + Intronic
1173361569 20:42349336-42349358 CAGTGTGAGCACAGGCATGGAGG - Intronic
1173419321 20:42886934-42886956 CAGGGTGCACAAATGCAGGGAGG + Intronic
1173471221 20:43325015-43325037 CAGCATGGGCGAAGGCATGGAGG - Intergenic
1173597045 20:44265257-44265279 CTGTGGGAGCAAAAGCATGGAGG - Intronic
1173665041 20:44757261-44757283 CAGAGTGAGCAAAGGAAGGGTGG - Intronic
1173688028 20:44937700-44937722 CTGGGTGAGGCCAGGCATGGTGG - Intronic
1173805916 20:45925308-45925330 CAGCGTGTGCCAAGGCCTGGAGG - Intergenic
1173946485 20:46954997-46955019 CAGGCTGAGAAAAGGCCTGCAGG - Intronic
1174061406 20:47835556-47835578 CAGCATGTGCAAAGGCCTGGGGG - Intergenic
1174070120 20:47893767-47893789 CAGCATGTGCAAAGGCCTGGGGG + Intergenic
1174150154 20:48480708-48480730 CAGCGTGTGCAAAGGACTGGGGG - Intergenic
1174156273 20:48517458-48517480 CAGCATGTGCAAAGGCCTGGGGG - Intergenic
1174283194 20:49454071-49454093 CAAGGTGAGGAAAGACAAGGTGG + Intronic
1174299655 20:49572273-49572295 CAGCATGAGCAAAGGTGTGGAGG - Intergenic
1174310812 20:49652586-49652608 CAGAGTGAGTAAAGTCATGCTGG - Intronic
1174515945 20:51092624-51092646 GAGGGTGAGAAAAGGCATTCAGG - Intergenic
1175220654 20:57414638-57414660 CAGGGTAAGCGAAGCGATGGAGG + Intergenic
1175572749 20:60036621-60036643 CAGAGTAAGCAAAAGCCTGGAGG - Intergenic
1175739749 20:61412320-61412342 CATGGTGAGCAAGGGCATGTTGG + Intronic
1175824527 20:61929861-61929883 CAGGGTGGGCAGGGGCATTGTGG + Intronic
1176521135 21:7825430-7825452 CACAGTGAGTAAAGGGATGGTGG + Exonic
1177044692 21:16154884-16154906 CAGGGTGAGAAAAGAAAAGGAGG + Intergenic
1177104329 21:16936047-16936069 TAGGGTGAGTAAAGGAGTGGGGG - Intergenic
1177388016 21:20432871-20432893 CAGAGTGAGGAAAAGCAGGGTGG + Intergenic
1177390967 21:20471479-20471501 GAGGGTGAGCAAAAGCATTCAGG + Intergenic
1177421424 21:20862737-20862759 CAGGTTTAGTAAAGGCATGAAGG + Intergenic
1177425809 21:20921925-20921947 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1178393482 21:32219322-32219344 GAGGGTGAGCAAAAGCAGGGTGG + Intergenic
1178655155 21:34455442-34455464 CACAGTGAGTAAAGGGATGGTGG + Intergenic
1179344143 21:40540436-40540458 CAGTGTGAGGAGGGGCATGGAGG - Intronic
1179677403 21:42993040-42993062 CTGGGTTAGAAAAGGCAAGGAGG - Intronic
1180159672 21:45993416-45993438 CAGGGAGAGCCAGGGCCTGGCGG + Intronic
1180641040 22:17299609-17299631 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1181415853 22:22758373-22758395 CAGGGTGTGCCCAGGCCTGGAGG + Intronic
1181420145 22:22792160-22792182 CAGGGTGTGCCCAGGCCTGGAGG + Intronic
1181646310 22:24233264-24233286 CAGGCTGGACAAAGGCCTGGAGG - Intronic
1181648093 22:24244593-24244615 CAGCGTGGGCAAAGGCCTGGGGG + Exonic
1181911271 22:26240181-26240203 CAGCATGAGCAAAGGTGTGGGGG - Intronic
1181998989 22:26904655-26904677 CAGCATGTGCAAAGGCCTGGTGG + Intergenic
1182060154 22:27391549-27391571 CAGTGAGTGCAAAGGCCTGGAGG + Intergenic
1182127304 22:27825383-27825405 CAGCATGTGCAAAGGCCTGGAGG - Intergenic
1182138838 22:27934029-27934051 TAGGGTGATCAAAAGCATGAAGG - Intergenic
1182396238 22:30038410-30038432 CAAGGTGAGCCAAGGCAAGTGGG + Intergenic
1182461121 22:30484798-30484820 CAGCATGAGCAAAGGCAGAGGGG + Intergenic
1182485615 22:30636872-30636894 CAGGGTGAACAGAGGTGTGGTGG - Exonic
1182898660 22:33879550-33879572 CAGGAAGAGCAAAGACAGGGAGG - Intronic
1183058212 22:35319837-35319859 CACGGTGGGGAAAGGGATGGTGG - Intronic
1183469413 22:37997676-37997698 CAGGGTGACCCAGGGCATGCAGG - Intronic
1183647470 22:39134799-39134821 CAGCATGAGCAAAGGTGTGGCGG - Intronic
1183727074 22:39596115-39596137 CAGAGTGAGCCAGGGCAGGGCGG + Intronic
1184038091 22:41928009-41928031 AAAGGGGAGCAAAGGCTTGGAGG + Intergenic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184458772 22:44625671-44625693 CAGGGAGATGAAAGGGATGGGGG + Intergenic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185379839 22:50503291-50503313 CAGGGTCAGCTAAGGCACAGTGG + Exonic
949456671 3:4246232-4246254 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
949632613 3:5944545-5944567 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
949649840 3:6144259-6144281 CAGGGTGAGAAAAGTCAAGTAGG + Intergenic
949934949 3:9109424-9109446 CAGAGCGAGCCAAGGCAAGGAGG + Intronic
949951896 3:9236149-9236171 CAGCATGTGCAAAGGTATGGGGG - Intronic
949986415 3:9544783-9544805 CAGGATGATCACAGGCATGGAGG - Intronic
950109936 3:10412496-10412518 CAGCAGGAGCAAAGGCCTGGGGG - Intronic
950157042 3:10729470-10729492 CTGGGTGAGAAAAGGTGTGGAGG - Intergenic
950299920 3:11867969-11867991 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
950387547 3:12672096-12672118 CAGTATGGGCAAAGGCATAGAGG + Intergenic
950395203 3:12728726-12728748 CAGCATGGGCAAAGGCGTGGAGG - Intergenic
950434846 3:12973284-12973306 CAGGATAAGCAAAGGCACTGGGG - Intronic
950659775 3:14460047-14460069 CAGAGTGAAGAAGGGCATGGTGG - Intronic
950707640 3:14792890-14792912 CAGGGAGAGCACAGGCATCCAGG - Intergenic
950900783 3:16495621-16495643 CAGCAAGAGCAAAGGCATGGAGG + Intronic
951434310 3:22643735-22643757 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
951439560 3:22707351-22707373 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
951741600 3:25931326-25931348 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951826584 3:26875657-26875679 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
953386662 3:42510185-42510207 CAGCGTGTGCACAGGCATGGAGG - Intronic
953555867 3:43946353-43946375 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
953606708 3:44417318-44417340 CAGCTTGAGCAAAGCTATGGAGG - Intergenic
953704180 3:45218913-45218935 CAGTGTCAGCACAGGCTTGGAGG + Intergenic
953878732 3:46680794-46680816 GAGTGTGTGCAAAGCCATGGAGG + Intronic
954080266 3:48209471-48209493 CGGCCTGAGCAAAGGCATGGTGG - Intergenic
954443123 3:50532609-50532631 CGGAGTGAGCAAAGGCTTGGAGG + Intergenic
954687862 3:52380288-52380310 CAGAGAGAGCAAGGGCATGCCGG - Intronic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
954713018 3:52514240-52514262 CAGGGAGGGCAAAGGCATAGAGG + Intronic
954793766 3:53150958-53150980 CAGCCTGAGCAAAGGCTTGAAGG - Intergenic
954856214 3:53646091-53646113 CAGGGACGGCAAAGACATGGAGG + Intronic
955514733 3:59715408-59715430 AAGGAAGATCAAAGGCATGGTGG + Intergenic
955833701 3:63030887-63030909 CAGCGTGGGCAAAGGCAGAGAGG - Intergenic
955896439 3:63705693-63705715 TGGTGTGAGCAAAGGCAAGGAGG + Intergenic
956078977 3:65537215-65537237 TAGCTTGAGCAAAGGCATGTTGG - Intronic
956126384 3:66014845-66014867 CAGTGGGAGCAAAGGCCTGGAGG - Intronic
956300306 3:67764770-67764792 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
956678893 3:71759667-71759689 CACTGTACGCAAAGGCATGGTGG - Intergenic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
956775920 3:72565528-72565550 CAGGGTGTGCAAAGCACTGGTGG + Intergenic
956870384 3:73411454-73411476 AGGTGTGAGCAAAGGCAAGGTGG + Intronic
957332277 3:78780587-78780609 CAGGGTGAGCAAACAAATTGAGG - Intronic
958793508 3:98681663-98681685 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
959120201 3:102223371-102223393 GAGGTTGAGCAAAAGCAGGGTGG - Intronic
959291812 3:104484795-104484817 GAGGGTGAGTAAAAGCAGGGTGG + Intergenic
959432603 3:106273230-106273252 CAGGCTGAGCATAGCCCTGGAGG + Intergenic
959453689 3:106533909-106533931 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
959571843 3:107893210-107893232 CTGGCTAAGCCAAGGCATGGAGG + Intergenic
959766005 3:110029196-110029218 CAGCATGATCAAAGGCATAGAGG - Intergenic
960585448 3:119316943-119316965 CAGGGAGAGCAAAGACAGGAGGG - Intronic
960773236 3:121217477-121217499 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
960916834 3:122703386-122703408 CAGCATGAACATAGGCATGGTGG - Intronic
961009713 3:123427461-123427483 CAGCAGGAGCGAAGGCATGGTGG - Intronic
961184581 3:124903419-124903441 AAGCATGAGCAAAGGAATGGAGG + Intergenic
961235884 3:125366753-125366775 TAGCGTAAGCAAAGGCTTGGAGG - Intronic
961809065 3:129511040-129511062 CAGCCTGTGCAAAGGCCTGGAGG + Intronic
962156763 3:132956549-132956571 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
962278717 3:134034506-134034528 CAGAGAGAACAATGGCATGGAGG - Intronic
962376545 3:134863101-134863123 CAGTGTGTGCACAGGCATGGGGG - Intronic
962565022 3:136649114-136649136 TAGTATAAGCAAAGGCATGGAGG - Intronic
962642438 3:137401115-137401137 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
962851307 3:139310149-139310171 TAGCATGGGCAAAGGCATGGAGG + Intronic
962887728 3:139642892-139642914 CAGCAGGATCAAAGGCATGGAGG - Intronic
963745053 3:149117423-149117445 CAGGCTGAGCAAAGGAAGGTAGG - Intergenic
964200863 3:154117736-154117758 CAGGATAAGCAAAAACATGGAGG - Intergenic
964391325 3:156201110-156201132 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG + Intergenic
964994974 3:162867946-162867968 GAGGGTGAGCCAAAGCATGGTGG + Intergenic
965006479 3:163032687-163032709 CAGGATGTGCAAAGGGATAGAGG + Intergenic
965880363 3:173381996-173382018 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
966013580 3:175112957-175112979 AAGGTTGAACAAAGACATGGAGG + Intronic
966683482 3:182668475-182668497 CAGTATAAGCAAAGGCGTGGAGG - Intergenic
967007752 3:185400243-185400265 CAGGGTGCGCAGACGCAGGGAGG - Intronic
967075158 3:185995217-185995239 CAGTGTAAACAAAGGCATAGAGG + Intergenic
967105833 3:186254440-186254462 CAGGCTGTGCAAAGGCAGGGAGG - Intronic
967257592 3:187609416-187609438 GAGGGTGGCCAGAGGCATGGGGG - Intergenic
967359686 3:188615260-188615282 CTTGGTGAGCAAAGCCATAGAGG - Intronic
967463700 3:189777482-189777504 CAGGGTGAGGCCAGGCATGGTGG - Intronic
967807416 3:193728145-193728167 CAGTGTGGGCAAAGGTATGCGGG + Intergenic
967893359 3:194378893-194378915 AGGGCTGAGCAAAGGCCTGGAGG + Intergenic
967984770 3:195086657-195086679 CTGGGTGGGCACTGGCATGGAGG + Intronic
968195780 3:196705019-196705041 CATGATGAGCAAAGGCCTGAAGG - Intronic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
969081640 4:4623413-4623435 AAGGAAGGGCAAAGGCATGGTGG - Intergenic
969172473 4:5375276-5375298 CAGGCTGTGTACAGGCATGGTGG - Intronic
969238548 4:5885178-5885200 CAGCATGGGCAAAGGCAAGGAGG - Intronic
969278240 4:6151442-6151464 CAGCTTGGGCAGAGGCATGGAGG - Intronic
969397156 4:6929533-6929555 CAGCTTGTGCAAAGTCATGGGGG + Intronic
969508773 4:7605230-7605252 AGGGGTGAAGAAAGGCATGGTGG + Intronic
969515717 4:7647127-7647149 CAGCTTGCGCAAAGGCCTGGAGG + Intronic
969707824 4:8821373-8821395 CACCTTGAGCAAAGGCCTGGAGG + Intergenic
970214605 4:13745665-13745687 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
970308247 4:14754959-14754981 CAGATTGTGCAAAGGTATGGAGG - Intergenic
970322967 4:14893730-14893752 CAGGGTGAAGAGAGACATGGTGG - Intergenic
970491529 4:16580116-16580138 CATGCTGTGCAAAGGCATGGAGG + Intronic
970573992 4:17409671-17409693 AATGGTGAGCAGAGGGATGGAGG - Intergenic
970936538 4:21577698-21577720 CAGAGTGTGCAACGGCATAGAGG - Intronic
971262356 4:25068996-25069018 AAGGGTAAGCAAAGACATGTGGG - Intergenic
971300914 4:25441800-25441822 CAGTGTGTGCAAAAGCTTGGAGG + Intergenic
971511933 4:27437127-27437149 TAGGATGAGCAAAGGCATGAAGG + Intergenic
971834703 4:31748282-31748304 CAGAGTGAGCTAAGGCATCAGGG + Intergenic
971883158 4:32409228-32409250 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
972095524 4:35342952-35342974 CTGGGGGAGAAAAGGCAGGGTGG - Intergenic
972297261 4:37752071-37752093 CAGTCTGTGCAAAGGCAGGGAGG - Intergenic
972323235 4:37991916-37991938 CTGCATGAGCAAAGGTATGGAGG + Intronic
973258585 4:48137905-48137927 CAGCTTGAGCAAAGGTAAGGAGG - Intronic
973587782 4:52410048-52410070 CCGGGTGGGCATAGGCTTGGCGG - Intergenic
974287476 4:59887916-59887938 AAAGGTGAGCTAAGGCAAGGAGG - Intergenic
974746887 4:66088642-66088664 CAGGGGGAGAGAAGGCAGGGTGG + Intergenic
974792739 4:66712512-66712534 GAGGGGGTGCACAGGCATGGCGG + Intergenic
975524168 4:75331146-75331168 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
975612302 4:76214421-76214443 AACGGTGAGCAAAGGCATTGGGG + Intronic
975638700 4:76477821-76477843 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
975695778 4:77011479-77011501 CAGCGTGAGCAAAGACACAGAGG + Intronic
975877972 4:78867016-78867038 CAGCCTGAGCAATGGCATGGTGG + Intronic
976370727 4:84285779-84285801 GAGGCTGAGCCAAGGCAGGGTGG + Intergenic
976427491 4:84922810-84922832 CAGGGGGATCACTGGCATGGTGG - Intronic
976439196 4:85054646-85054668 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
976527944 4:86115328-86115350 CAGAGTGAGGAAAAGCAGGGTGG - Intronic
976869291 4:89771378-89771400 ACAGGTGAGCAAAGGCATGCTGG - Intronic
978383099 4:108151589-108151611 AAGGTTGAGCAATGGCATGCAGG - Intronic
978601506 4:110432460-110432482 GAGGGTGAGCCGAAGCATGGTGG - Intronic
979272911 4:118783076-118783098 GAGGGTGAGCCAAAGCAGGGCGG - Intronic
979457511 4:120943915-120943937 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
979730192 4:124014379-124014401 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
979822317 4:125190091-125190113 CAGGGTGAGCTAATGCATAATGG - Intergenic
980423903 4:132600055-132600077 CAGAGTCAGCTAAGGAATGGTGG + Intergenic
980861789 4:138507785-138507807 CAGAAAGAGCAAAGGCATGAGGG + Intergenic
981228836 4:142329024-142329046 CAGCGCATGCAAAGGCATGGAGG - Intronic
981254740 4:142648340-142648362 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
981530060 4:145743812-145743834 CAGCTTGAGCAAAGGCAAGAAGG - Intronic
981655885 4:147112100-147112122 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
981931131 4:150190348-150190370 CAGTGTGAGGAAAGGCATGGTGG + Intronic
982484711 4:155953497-155953519 TTTGGTTAGCAAAGGCATGGGGG + Intronic
982815468 4:159878220-159878242 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
982915498 4:161203793-161203815 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
982962338 4:161856261-161856283 CAGCATGAGAAAAGGCATAGAGG + Intronic
983027422 4:162755549-162755571 CTGGGTGAGGGAAGGCAGGGTGG - Intergenic
983167776 4:164498017-164498039 GAGGGTGAGCGAAAGCAGGGTGG - Intergenic
983249259 4:165326555-165326577 CAGTTTGAGCAAAAGCATGGAGG + Intergenic
983840777 4:172455059-172455081 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
983899822 4:173122094-173122116 CAGTGTGTGCAAAGGCACAGAGG - Intergenic
984080591 4:175245154-175245176 CAGGATGTGCAAAAGCATGACGG + Intergenic
984742048 4:183174251-183174273 CAGGTTGGGCAAAGGCAGGCAGG + Intronic
985065560 4:186117577-186117599 CAGTGTGAGCAAAGCCGTGGAGG + Intronic
985614567 5:911668-911690 CAGCGAGAGCAAAGGCTGGGGGG + Intronic
986224293 5:5798897-5798919 CAGTGTGAGCAAAGGCACTGAGG + Intergenic
986519787 5:8602457-8602479 CAGGATGAGCAACATCATGGAGG + Intergenic
986640744 5:9869341-9869363 AAGGAAGAGCAAAGGCATGGTGG + Intergenic
987880591 5:23739776-23739798 CAAGGGGAGCAAAGGCAGTGTGG + Intergenic
988511315 5:31867034-31867056 CAGGCAGAGTCAAGGCATGGAGG - Intronic
988618130 5:32794853-32794875 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
989358114 5:40567359-40567381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
989614784 5:43328847-43328869 GAGGGTGAGCCAAAGCAGGGCGG - Intergenic
989619135 5:43367528-43367550 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
989670246 5:43908845-43908867 GAGGGTGAGCCAAAGCAGGGAGG + Intergenic
989671182 5:43918400-43918422 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
990183851 5:53191630-53191652 GAGGGTGAGCAAAAGCAGAGTGG - Intergenic
991026754 5:62037953-62037975 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
991223496 5:64242934-64242956 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
991473355 5:66993640-66993662 CAGGATGTGCAAAGGCAGTGAGG + Intronic
991627718 5:68621654-68621676 CAGCATGAGCAAAGATATGGAGG - Intergenic
992077767 5:73206913-73206935 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992205827 5:74429636-74429658 CAGTGGGTGCAAAGGAATGGGGG - Intergenic
992287207 5:75247990-75248012 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992502740 5:77358001-77358023 TGGGGAGAGTAAAGGCATGGGGG - Intronic
992506161 5:77389365-77389387 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
992642436 5:78779745-78779767 CAGAGTGAGCAATGGCTGGGGGG + Exonic
992740702 5:79770583-79770605 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
993121938 5:83785502-83785524 CTAAGTGAGCAAAGACATGGAGG - Intergenic
993460253 5:88173406-88173428 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
993982995 5:94565218-94565240 CAGGGAGAGACCAGGCATGGTGG - Intronic
994014963 5:94955109-94955131 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
994059236 5:95455786-95455808 CAGCCTGAGCAAAGGCCTGGAGG + Intergenic
994586568 5:101716247-101716269 GAGGGTGAGCCAAAGCAGGGCGG - Intergenic
995373920 5:111452161-111452183 CAGGGAGAGCAAAGTCATGGAGG + Intronic
995459724 5:112390217-112390239 GAGGGTGAGCCAAAGCAGGGCGG + Intronic
995790742 5:115883499-115883521 AAGGGTGAGCAGAAGCAGGGTGG - Intronic
996428000 5:123335642-123335664 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
996602231 5:125277653-125277675 GAGTAAGAGCAAAGGCATGGAGG - Intergenic
997115642 5:131123147-131123169 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
997809608 5:136954339-136954361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
998623761 5:143822987-143823009 CAGCATGAGCAAAGGCCTGGAGG + Intergenic
998801907 5:145877733-145877755 GAGGGTGAGCCAAAGCAGGGCGG + Intergenic
998980729 5:147699061-147699083 TAGCATGAGCAAAGGCCTGGGGG - Intronic
999448066 5:151657250-151657272 CAGCGAGTGCAAAGGCCTGGAGG + Intergenic
999488796 5:152027302-152027324 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
999688234 5:154121976-154121998 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
999694601 5:154178008-154178030 CAGCATGAGCAAAGGCATGGGGG + Intronic
999933031 5:156454678-156454700 CAGAGAGAGCATTGGCATGGTGG + Intronic
999988949 5:157031967-157031989 CAGGGAGTGCAAAGGCACTGAGG - Intronic
1000121012 5:158197917-158197939 CAGGGTGAGAAGAGGCAGAGCGG + Intergenic
1000706844 5:164523176-164523198 CAGTAGGAACAAAGGCATGGAGG + Intergenic
1000965923 5:167656445-167656467 GACAGTGAGCAAAGGCATGGTGG + Intronic
1001010476 5:168093250-168093272 CAGGGTGAGTGATGGCCTGGGGG - Intronic
1001076328 5:168630848-168630870 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1001285311 5:170418744-170418766 CAGTGTGAACAAAGGCTAGGAGG - Intronic
1001288202 5:170438708-170438730 CAGGCTGTGCAATGGCTTGGGGG - Intronic
1001315325 5:170637590-170637612 CAGCCTGAGCAAAGGCCTTGAGG - Intronic
1001407827 5:171488388-171488410 CAGCTTGAGCAAAGGCATGGAGG + Intergenic
1001542047 5:172546408-172546430 CAGAGTGAGCGAGGGCAGGGGGG + Intergenic
1001597532 5:172907652-172907674 CAGCATGTGCAAAGGCCTGGAGG - Intronic
1001769700 5:174284299-174284321 CAGCATAAGCAAAGGCATGAAGG + Intergenic
1001875198 5:175194303-175194325 CAGCATGGGCAAAGGCAGGGAGG + Intergenic
1001883878 5:175270909-175270931 CAGCATGTGCAAAGGCATGGGGG + Intergenic
1002056725 5:176602155-176602177 CAGGCAGCGCCAAGGCATGGAGG - Intronic
1002064268 5:176644256-176644278 CAGTGTAAGCAAAGGCTTGGAGG + Intronic
1002329397 5:178431076-178431098 CGGTGTGAGCAAAGACATAGAGG + Intronic
1002575776 5:180172880-180172902 GAGCATGGGCAAAGGCATGGAGG - Intronic
1002736737 5:181395605-181395627 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1002747962 6:79217-79239 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1002939962 6:1707499-1707521 CAGGGTGAGCAACCAGATGGAGG + Intronic
1003137210 6:3442983-3443005 CAAGGTGTGCAATGGCATGAAGG - Intronic
1003374983 6:5568580-5568602 AAGTGTGAGCAAAGTCCTGGAGG + Intronic
1004702334 6:18091049-18091071 CAGTGTGAGCAATGGCAAGGAGG - Intergenic
1005198483 6:23316219-23316241 CAGCATGAGCAAAGGAATGAGGG + Intergenic
1005453407 6:25995617-25995639 CAGGGTGAGCAAGGGTGTGGAGG - Intergenic
1006645957 6:35514222-35514244 CAGCCTGAGCAAAGGCATGGAGG - Intergenic
1006779960 6:36625740-36625762 CAGCATGAGCAAAGGCAGAGAGG + Intergenic
1007041504 6:38726617-38726639 GTGAGTGAGCAAAGCCATGGTGG + Intronic
1007081607 6:39109171-39109193 CAGCCTGAGCCAAGGCCTGGAGG + Intronic
1007506286 6:42337726-42337748 TAGCATAAGCAAAGGCATGGAGG + Intronic
1007746983 6:44049156-44049178 CAGCATGGACAAAGGCATGGAGG - Intergenic
1007781687 6:44258024-44258046 AAGGATGAGTAAAGGGATGGGGG - Intergenic
1007968924 6:46030711-46030733 CAACATGAGCAAAGGCATGGAGG - Intronic
1008138904 6:47809115-47809137 CAGGGTGAGTAAAGACTTGGGGG + Intronic
1008496031 6:52135420-52135442 CAGCTTGAGCAAAGACATAGTGG - Intergenic
1008982424 6:57500281-57500303 CAGGGTGAGGAACGGCTTGGAGG - Intronic
1009170486 6:60393119-60393141 CAGGGTGAGGAACGGCTTGGAGG - Intergenic
1009390085 6:63134813-63134835 CTGGGTGAGAGAAGGCAGGGTGG + Intergenic
1009570095 6:65374233-65374255 AAGGGTGAGCAGAAGCAGGGTGG + Intronic
1010101365 6:72112142-72112164 CAGGGGGAGGAAAGGCCAGGAGG - Intronic
1010142543 6:72627784-72627806 CAGCATGAGCAAACACATGGTGG - Intronic
1010177915 6:73051215-73051237 CAGTGTGAACATATGCATGGAGG + Intronic
1010574870 6:77518357-77518379 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1011120005 6:83942319-83942341 GAGGGCGAGCAGAAGCATGGTGG + Intronic
1011139310 6:84134641-84134663 GAGGGTGAGCCAAGGCAGGGTGG - Intronic
1011235656 6:85213452-85213474 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011288568 6:85751802-85751824 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1011340382 6:86307184-86307206 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1011706129 6:90003234-90003256 CAGAGTGAGCCAAGGCAGGGTGG - Intronic
1011831315 6:91374987-91375009 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011884584 6:92078431-92078453 GAGGGTGAGCCAAAGCAAGGTGG + Intergenic
1013572723 6:111445860-111445882 CAGTTTAAGCAAAGGTATGGGGG + Intronic
1013682506 6:112541095-112541117 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1013896219 6:115091621-115091643 CAGAGTGAGCAAAGGCACAATGG - Intergenic
1013920239 6:115394892-115394914 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1014527905 6:122522706-122522728 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1014890913 6:126845132-126845154 CAGAGTGAGCAAAGGCATTGAGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015211231 6:130701458-130701480 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1015433307 6:133155389-133155411 GAGGGTGAGCAGAAGCATGTTGG - Intergenic
1015633766 6:135255922-135255944 CAGCGTGTGCAAAGCCAGGGAGG - Intergenic
1015790058 6:136957613-136957635 CAGGGCCAGGAAAGGCAGGGAGG - Intergenic
1015790072 6:136957655-136957677 CAGGGCCAGGAAAGGCAGGGGGG - Intergenic
1016156771 6:140820428-140820450 GAGGGTGTGCACAGGCATGCTGG + Intergenic
1016584883 6:145673446-145673468 GAGGGTGAGCCAAAGCAGGGCGG + Intronic
1017197505 6:151717152-151717174 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1017671336 6:156772124-156772146 CAGGGTGAGGGCAGGCATGCTGG - Intergenic
1018009326 6:159655363-159655385 GAGGGTGGCCAGAGGCATGGTGG + Intergenic
1018508278 6:164494741-164494763 GACGGGGAGCAAAGGCATTGAGG - Intergenic
1018906345 6:168078551-168078573 GAGGGTGAGCAGAGCCGTGGGGG - Intronic
1018906354 6:168078587-168078609 GAGGGTGAGCAGAGCCGTGGGGG - Intronic
1018906381 6:168078669-168078691 GGGGGTGAGCAGAGCCATGGGGG - Intronic
1019131842 6:169882692-169882714 CAAGGTGTCCACAGGCATGGAGG - Intergenic
1019241836 6:170671134-170671156 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1019310151 7:356599-356621 CAGGAGGAACAAAGGCATTGAGG - Intergenic
1019698258 7:2459989-2460011 CAGCAGGAGCAAAGGCTTGGAGG + Intergenic
1020017463 7:4839496-4839518 CAGGGGAAGCCTAGGCATGGTGG + Intronic
1020608666 7:10368025-10368047 GAGGGTGAGCAGATGCAGGGTGG - Intergenic
1020795631 7:12675808-12675830 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1020823930 7:13003261-13003283 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021347751 7:19548540-19548562 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1022058930 7:26770750-26770772 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1022204498 7:28150255-28150277 CAGGGTGAGCAAAGATGTGCTGG + Intronic
1022822937 7:33979246-33979268 CAGCATGAGCAAAGGACTGGAGG - Intronic
1023119988 7:36899448-36899470 CAGCATGAGCAAAGGCAAGGAGG + Intronic
1023398485 7:39773650-39773672 CAAGGTGAGTCAAGGAATGGGGG + Intergenic
1023511707 7:40959969-40959991 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1023894230 7:44418771-44418793 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1024052989 7:45641167-45641189 CAAGGAGAGCAAAGGCTGGGAGG - Intronic
1024817534 7:53288305-53288327 GAGGGTGAGGAAAAGCAGGGTGG - Intergenic
1025134168 7:56396840-56396862 CAAGGTGAGTCAAGGAATGGGGG - Intergenic
1025909843 7:65819540-65819562 CAAGGTGAGTCAAGGAATGGGGG + Intergenic
1026359815 7:69592485-69592507 CAGCATGAGCAAAGGTGTGGGGG + Intergenic
1026447982 7:70502116-70502138 CAGGGAGAGGAAAGTCACGGAGG - Intronic
1026537943 7:71255771-71255793 CAGCATGAGTAAAGGCATAGTGG + Intronic
1027221040 7:76214133-76214155 CAGGGTGAACCACAGCATGGTGG - Intronic
1027701749 7:81478611-81478633 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1028142697 7:87290035-87290057 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1028340891 7:89718853-89718875 GAGGGTGAGCCAAAGCAGGGAGG + Intergenic
1028523557 7:91758886-91758908 AAGGGTGAGCCAAAGCAGGGTGG + Intronic
1028545756 7:91997923-91997945 TAGGGTCAGCTAAGGCATTGGGG + Intronic
1028665165 7:93334551-93334573 CAGGGTGAGCAAGGGCCTTGAGG + Intronic
1029062237 7:97810513-97810535 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1029324851 7:99797028-99797050 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1029514170 7:101015729-101015751 GAGGGTGAAGAAAGGCAGGGCGG + Intronic
1029793893 7:102873809-102873831 CAGCCTGCACAAAGGCATGGAGG - Intronic
1029952007 7:104596032-104596054 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1030047730 7:105512554-105512576 CAGCATGTGCAAAGGCATGGGGG + Intronic
1030101663 7:105952276-105952298 CAGTTTAGGCAAAGGCATGGAGG + Intronic
1030181026 7:106709549-106709571 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1030771178 7:113476204-113476226 TAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1031273341 7:119684070-119684092 CAGTGTATGCCAAGGCATGGAGG + Intergenic
1031559877 7:123225791-123225813 CGGGGTGAGCTAAGACATGAAGG + Intergenic
1031828578 7:126598079-126598101 GATGGTTAGCAAAGGCAGGGAGG - Intronic
1031833030 7:126650276-126650298 CTGGGTGAGAGAAGGCAGGGTGG - Intronic
1032238433 7:130143061-130143083 GAGAGTGAGCAAAGGCACAGTGG - Intergenic
1032659834 7:133970640-133970662 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1032800818 7:135316191-135316213 CAGGGTGACAAAAGGCACTGAGG - Intergenic
1032893225 7:136222315-136222337 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034314402 7:150116928-150116950 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034625040 7:152485964-152485986 CTGCGTGAGCAAAGGCACAGAGG - Intergenic
1034792493 7:153983841-153983863 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1035006271 7:155663458-155663480 GAGGGTGAGCAGAGGCGGGGAGG + Intronic
1035506281 8:136962-136984 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1035679733 8:1479098-1479120 CAGGGTGAGCCCAGGCAGGGGGG + Intergenic
1035793982 8:2336757-2336779 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1035798823 8:2384951-2384973 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1037109989 8:15154366-15154388 CAGGCTGAGCAAAAGCTGGGTGG - Intronic
1037285559 8:17294725-17294747 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1037628283 8:20627942-20627964 CAGTATGAACCAAGGCATGGAGG + Intergenic
1037774590 8:21825027-21825049 CAGGGTGAGCTGAGGCTCGGAGG - Intergenic
1037881946 8:22577917-22577939 CAGGGTGAGCACAGCCCCGGGGG - Intergenic
1039297559 8:36173059-36173081 CAGTGTGTACAAAGGCCTGGAGG + Intergenic
1039304485 8:36246812-36246834 CCGTGTGAGCAAAGGCACCGAGG - Intergenic
1039519053 8:38155215-38155237 TAGGGTGAGGAAAGGCACAGAGG - Intergenic
1039624384 8:39032642-39032664 GAGGGTGAGCCAAAGCAGGGCGG - Intronic
1039799259 8:40940089-40940111 ATAGGTGAGCAAAGACATGGAGG + Intergenic
1040563992 8:48549662-48549684 CAGGGTGATCAGAGACATGGAGG + Intergenic
1041419160 8:57647278-57647300 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1042645326 8:70980233-70980255 GAGGGTGAGCCAAAGCAGGGCGG - Intergenic
1042812987 8:72846241-72846263 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1043080838 8:75763177-75763199 GAGGGTGAGCAAAAGCAGAGTGG + Intergenic
1043253749 8:78106872-78106894 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1043511254 8:80952518-80952540 GAGGGTGAGCAAAGGAAGGTGGG + Intergenic
1044150827 8:88773336-88773358 CTGGGGGAGAAAAGGCAGGGTGG - Intergenic
1044509559 8:93058759-93058781 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044620526 8:94186969-94186991 CAGGATGGGAAAAAGCATGGGGG - Intronic
1044744866 8:95362225-95362247 AGGGGTGAACAAAGGCATGAAGG + Intergenic
1044940346 8:97335434-97335456 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1045157501 8:99492839-99492861 GAGGGTGAGCCAAAGCATGCTGG - Intronic
1045185265 8:99830895-99830917 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1045265385 8:100614363-100614385 CAGACAGAGGAAAGGCATGGGGG + Intronic
1045390499 8:101710120-101710142 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1045684246 8:104694830-104694852 CAGGGTATGCAAAGGTCTGGAGG + Intronic
1046014550 8:108589901-108589923 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1046090438 8:109497386-109497408 CAGTGGGAACAAAGGCAGGGAGG - Intronic
1046354152 8:113057018-113057040 CAGCATGTGCAAAGGCCTGGTGG - Intronic
1046657786 8:116913511-116913533 GAGAGTGAGGAAAGGCAGGGTGG - Intergenic
1046972629 8:120238902-120238924 GAGGGTGAGCATAAGCAGGGTGG - Intronic
1047336427 8:123940890-123940912 GAGGGGAAGGAAAGGCATGGAGG + Intronic
1047448808 8:124944012-124944034 CAGGTTAGGAAAAGGCATGGTGG - Intergenic
1047454504 8:124997504-124997526 CAGGATGAGCAAAGACACTGAGG + Intergenic
1047694796 8:127392857-127392879 CAGGATGAGCAAACCCATGGAGG + Intergenic
1047791854 8:128211364-128211386 CAGTCTGTGCAAAGGCAAGGAGG + Intergenic
1047995386 8:130330250-130330272 CAGGGTGAGAAAATGCAAAGTGG - Intronic
1048215021 8:132486331-132486353 CAGTGTAGGCAAAGGCTTGGAGG + Intergenic
1048459827 8:134612237-134612259 CAGGGTGCGCAAGCGCAAGGTGG + Intronic
1049042597 8:140124010-140124032 TAAGGTGAGCAAAGTCCTGGTGG - Intronic
1049229757 8:141475799-141475821 CTGGGTGAGCAGTGGCGTGGAGG - Intergenic
1049495090 8:142926328-142926350 CAGGGACAGCAAAGGCATAGAGG - Intergenic
1049579268 8:143404053-143404075 CAGGGTGGGCAAAGGCTGGGAGG - Intergenic
1049674003 8:143881758-143881780 CAGGGAGAGCAAGGGCAGAGGGG + Intergenic
1049733213 8:144189706-144189728 CAGGGAGAACAATGGCAGGGCGG - Intronic
1049867499 8:144948304-144948326 CAGGGTGCTCAGAGGAATGGTGG + Intronic
1049880198 8:145056819-145056841 CAGGGTGAGGAGAAGCAGGGGGG - Intergenic
1050201420 9:3149279-3149301 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1050681166 9:8113411-8113433 CAGGATGAGCAAAGGCAGAATGG + Intergenic
1051452057 9:17207635-17207657 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1052125219 9:24765701-24765723 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1052144127 9:25026158-25026180 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1052382417 9:27785480-27785502 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1052610619 9:30768928-30768950 CAGCATGGGCAAAGGCATGGGGG + Intergenic
1052937840 9:34108105-34108127 CAGCAAGAGCAAAGGCAGGGAGG - Intronic
1053150949 9:35742390-35742412 AAGCATGAGCACAGGCATGGAGG - Intronic
1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG + Intronic
1053351319 9:37415125-37415147 AACGGTGAGCAAAGGCCTGGAGG - Intergenic
1053462648 9:38282431-38282453 CAGCTTGAGCAAAGGCATGGGGG + Intergenic
1054703220 9:68435016-68435038 CAGCTTGAGCAAAGGCCTGGAGG - Intronic
1055023985 9:71699710-71699732 CAGTGTGCACAAATGCATGGGGG - Intronic
1055111342 9:72563087-72563109 CAGCATGAGCAAAGGTGTGGAGG + Intronic
1055345124 9:75327443-75327465 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1055453499 9:76452594-76452616 CAGGGGGAGGAGAGGCAGGGAGG + Intronic
1055494492 9:76841161-76841183 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1055614208 9:78054368-78054390 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1055628676 9:78200799-78200821 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1055656267 9:78453039-78453061 CACTGTGAGGAAAGGGATGGGGG - Intergenic
1055710981 9:79061855-79061877 CAGAATGAGCAAATGCCTGGAGG + Intergenic
1055725518 9:79224099-79224121 CTGGGAGAGCTAAGACATGGTGG + Intergenic
1056385227 9:86091052-86091074 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1056456274 9:86764002-86764024 CAGCATGAGCAAAGGCACAGAGG + Intergenic
1056474394 9:86939437-86939459 CAGCGTGACCAAAGGCATACAGG - Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057561639 9:96132644-96132666 CAACATGAACAAAGGCATGGAGG - Intergenic
1057870970 9:98717082-98717104 TAGAATGAGCAAAGGTATGGAGG - Intergenic
1058003446 9:99890720-99890742 TAGCTTGAGCAAAGGCATAGAGG + Intergenic
1058086737 9:100755798-100755820 CAGCAAGAGCAAAGGCATGGAGG - Intergenic
1058265712 9:102897255-102897277 GAGGGTGAGCAGAAGCAGGGAGG + Intergenic
1058765987 9:108183207-108183229 CCGTGTGAGCCAAGGCCTGGTGG - Intergenic
1058822977 9:108749386-108749408 CTGGGTAAGGAAAGCCATGGAGG + Intergenic
1058996285 9:110301767-110301789 CAGGGAGAGGAAAGCTATGGGGG - Intergenic
1059323347 9:113486327-113486349 AAGCATGAGCAAAGGCAAGGAGG + Intronic
1059399829 9:114061955-114061977 CAGTGGGAGCAAAGGCAGGGTGG - Intronic
1059423869 9:114208908-114208930 CAGAGTGAGGAAAGGCTGGGAGG + Intronic
1059687653 9:116652883-116652905 CAGAGTGAGCAAAGGCACAGAGG - Intronic
1059846257 9:118280293-118280315 CAGAGTTAGCAAATGAATGGTGG - Intergenic
1059988923 9:119846362-119846384 CAGCGTGAGCAAAGGCCTGGAGG + Intergenic
1060051719 9:120382968-120382990 CAGCCTGTGCAAAGGCATGGAGG - Intergenic
1060145917 9:121252281-121252303 CAGCGTGAGCTAAGATATGGGGG + Intronic
1060223505 9:121776537-121776559 CAGCGTGAGCACAGGCCTGGAGG + Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060637339 9:125209735-125209757 CTGTGTGTGCAAAGGCATGGAGG - Intronic
1060730406 9:126033507-126033529 CAGGGTGAGCAAGCCCAGGGTGG - Intergenic
1060786110 9:126452675-126452697 CAGCAAGATCAAAGGCATGGGGG - Intronic
1060815991 9:126635436-126635458 CTGCCTGGGCAAAGGCATGGAGG + Intronic
1060827512 9:126695381-126695403 GAGGGGCGGCAAAGGCATGGAGG - Intronic
1060978835 9:127780836-127780858 CAGCCTGAGCGAAGGCCTGGAGG - Intergenic
1061167766 9:128934055-128934077 CACGGTGAGCAGGGGCTTGGGGG + Exonic
1061887498 9:133599188-133599210 CAGTGTGTGCAAAGGCCAGGAGG - Intergenic
1062567264 9:137168799-137168821 AAGGGAGGGCAAAGGCATGGGGG + Exonic
1203602027 Un_KI270748v1:20368-20390 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1185715030 X:2334838-2334860 CAGGGTTCACAAAGGCTTGGAGG - Intronic
1186273150 X:7911681-7911703 CAGGGTGAGAAAAGGCTTTAGGG - Intronic
1186773393 X:12839656-12839678 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1186774941 X:12855044-12855066 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
1186961034 X:14736533-14736555 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1187288810 X:17932292-17932314 CAGGGTGAGCAAAGGCTTGCTGG - Intergenic
1187392964 X:18897608-18897630 CAGGGCGAGCACGGGCTTGGGGG + Intronic
1187660759 X:21544734-21544756 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1187729486 X:22238280-22238302 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1188084078 X:25882385-25882407 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1188299284 X:28487628-28487650 AAGGGTGAGGAATAGCATGGGGG - Intergenic
1188893380 X:35636658-35636680 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1189017725 X:37301550-37301572 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1189243266 X:39542004-39542026 TAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1189331836 X:40148915-40148937 CTGGGTGAGCATCTGCATGGAGG + Intronic
1190286720 X:48966359-48966381 CAGCCTGAGCAAAGGCTTGAGGG - Intronic
1190738432 X:53271144-53271166 CAGTGTCCGCAAAGGCCTGGAGG - Intronic
1190944045 X:55073351-55073373 GAGGGTGAGCAAAAGCAGGGTGG - Intergenic
1190963805 X:55278395-55278417 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191004996 X:55702268-55702290 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191073762 X:56430051-56430073 GAGGGTGAGCTAAAGCAGGGCGG - Intergenic
1191148181 X:57190691-57190713 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1191174241 X:57482534-57482556 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191591253 X:62887957-62887979 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191662942 X:63669287-63669309 CAGTGTGAGCAAAATCCTGGAGG - Intronic
1191676556 X:63797624-63797646 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191987306 X:66995435-66995457 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192246785 X:69379407-69379429 CAGGGTTAGAAAAGGCCTGGAGG + Intergenic
1192359053 X:70426925-70426947 CAGGGTGAGGAGATGCATAGGGG - Exonic
1192367603 X:70487347-70487369 CAGTGTAAGCAAAGGTCTGGAGG - Intronic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1192632536 X:72788617-72788639 CAGGCTGAGCAAGGAAATGGTGG + Intronic
1192649173 X:72932184-72932206 CAGGCTGAGCAAGGAAATGGTGG - Intronic
1192674506 X:73182230-73182252 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1192759273 X:74078346-74078368 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192992048 X:76471073-76471095 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1193019981 X:76781082-76781104 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193068517 X:77282672-77282694 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1193130288 X:77912370-77912392 TAATGTGAGCAAAGCCATGGGGG + Intronic
1193398182 X:81010527-81010549 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193514314 X:82445443-82445465 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1193525366 X:82581628-82581650 GAGGGTGAGCAAAATCAGGGTGG - Intergenic
1194021176 X:88694343-88694365 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1194203193 X:90979359-90979381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194315371 X:92369793-92369815 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1194631539 X:96291548-96291570 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1194643487 X:96429882-96429904 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194732698 X:97474475-97474497 CAGGGTAAGGCCAGGCATGGTGG + Intronic
1194975377 X:100390858-100390880 CAAAATGAGCAGAGGCATGGTGG + Intronic
1195311639 X:103637806-103637828 CAGCATCAGCAAAGGCATGCAGG - Intergenic
1195519333 X:105812748-105812770 GAGGGTGAGCCAAAGCAGGGAGG - Intergenic
1195832803 X:109078024-109078046 CAGGGTGAACCAAAGCAGGGTGG - Intergenic
1195985490 X:110626155-110626177 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1196133315 X:112181025-112181047 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1196221132 X:113113215-113113237 AAGGGAGAGTAAAGACATGGAGG + Intergenic
1196230236 X:113212507-113212529 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1196367891 X:114943465-114943487 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1196476518 X:116092469-116092491 GAGGGTGAGCAGACGCAGGGTGG - Intergenic
1196587126 X:117443292-117443314 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1196919544 X:120571627-120571649 CAGTGTGTGCAAAGACATGGAGG + Intronic
1197004166 X:121475185-121475207 GAGGGTGAGCTGAAGCATGGTGG - Intergenic
1197614400 X:128675351-128675373 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1197640076 X:128958150-128958172 CAGTATGAGCAAAGACATAGAGG - Intergenic
1197771182 X:130090475-130090497 CAGTGTGAACACAGGCACGGAGG - Intronic
1197926853 X:131656071-131656093 TAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1198081307 X:133242288-133242310 CAGCAAGAGCAAAGGCTTGGTGG + Intergenic
1198295482 X:135282783-135282805 GAGGGTGAGCAGAAGCAAGGTGG - Intronic
1198438606 X:136640248-136640270 CAGGCTGAGGCCAGGCATGGTGG + Intergenic
1198944624 X:141996603-141996625 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1199539383 X:148942238-148942260 CAGGATAAGCAAAGGCATGGAGG + Intronic
1199594230 X:149493956-149493978 CAGGGGTGGCAAAGGCCTGGAGG + Intronic
1199780180 X:151051380-151051402 CAGCATGTGCAAAGGCCTGGAGG + Intergenic
1200136805 X:153879205-153879227 CAGAGTGAGAAGAGGCAGGGGGG + Intronic
1200214548 X:154361856-154361878 CTGGGAGAGGACAGGCATGGAGG - Intronic
1200247348 X:154533231-154533253 CAGGGTGAGCAGAGCCAAGCAGG - Intronic
1200333139 X:155319403-155319425 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1200378434 X:155808939-155808961 GAGGGTGAGCAAAAGCAGGGCGG + Intergenic
1200549026 Y:4554785-4554807 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200623420 Y:5481328-5481350 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1201065770 Y:10092792-10092814 AAGGGGGAGCAGAGGCAGGGCGG + Intergenic
1201394840 Y:13537107-13537129 CAGGGAGAGCCAAAGCAGGGTGG - Intergenic
1201529628 Y:14977629-14977651 CAGGGGGAGACAAGGCAGGGAGG + Intergenic
1201563660 Y:15344161-15344183 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1201913569 Y:19158197-19158219 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1201922123 Y:19245213-19245235 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1201938662 Y:19435053-19435075 GAGGGTGAGCCAAATCATGGTGG + Intergenic