ID: 1119944181

View in Genome Browser
Species Human (GRCh38)
Location 14:78674322-78674344
Sequence GATTATTCTGCAAATAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119944181 Original CRISPR GATTATTCTGCAAATAATGG GGG Intronic
904163902 1:28540756-28540778 TATTATTGTGCAAATAATGATGG - Intergenic
904633888 1:31864740-31864762 GATTATTCAATAAATAATGTTGG + Intergenic
907814337 1:57903456-57903478 GAGTATTCATCAAATATTGGAGG + Intronic
908017126 1:59854628-59854650 GATTTCTCATCAAATAATGGAGG - Intronic
909249480 1:73333613-73333635 AATCATTCAGCAATTAATGGAGG - Intergenic
910154760 1:84202749-84202771 GGTTGGTCTGCAAAGAATGGGGG - Exonic
912199066 1:107435512-107435534 AATTATTCTTCAAATAAATGTGG - Intronic
920203489 1:204275215-204275237 GTTTTTTCAGCAAATAATGGGGG - Intronic
924782247 1:247161394-247161416 GATTATTGTCCAACTAATAGAGG - Intronic
924943918 1:248832032-248832054 GTTTAATCAGCAATTAATGGTGG - Intergenic
1064606723 10:17049552-17049574 GATTATTCTGGAACAACTGGTGG + Intronic
1067358425 10:45553426-45553448 GATTGTTCTGGGAATAGTGGAGG - Intronic
1070896798 10:79990382-79990404 GACTATTCTGAAAAAAATAGAGG + Intergenic
1072196827 10:93123257-93123279 GATTATTCGACAAATATTGATGG + Intergenic
1073870557 10:107858918-107858940 GATTATGCAGAAAATAATGAGGG + Intergenic
1079062106 11:17258109-17258131 AATTATTCTTCAAATAACAGTGG - Intronic
1080098538 11:28432603-28432625 GATCCTTCTGCTAAAAATGGTGG - Intergenic
1081449231 11:43156482-43156504 GATAATTCTGCAAATATTCAGGG + Intergenic
1082194939 11:49292550-49292572 GATAATTCTGGAAATGATAGAGG + Intergenic
1083550282 11:63583356-63583378 AAATAGTCTGCAGATAATGGAGG + Intronic
1085996535 11:81922640-81922662 ATTTTTTCTGCAAATATTGGTGG + Intergenic
1086660993 11:89417005-89417027 GATAATTCTGGAAATGATAGAGG - Intronic
1088059405 11:105628231-105628253 AATAAATTTGCAAATAATGGTGG - Intronic
1088522488 11:110713633-110713655 GTTTATTGTGGAAATAATAGGGG + Intergenic
1088924500 11:114286600-114286622 GATGATTCTCCAAATGATGTAGG - Intronic
1093144756 12:15552295-15552317 GATTATTCTGATAATACAGGGGG - Intronic
1093347711 12:18059982-18060004 AATTATTCTTCAAATATTTGGGG - Intergenic
1094718674 12:33038879-33038901 GATTATTCTGGATAAAGTGGAGG - Intergenic
1095127182 12:38493623-38493645 AATTATTTTGCAAAGAGTGGAGG + Intergenic
1098242571 12:68483441-68483463 GATTATTATGCCAATAATTTTGG + Intergenic
1099826330 12:87781420-87781442 GATTATTCCATAAATAATGCTGG - Intergenic
1100001033 12:89835473-89835495 GATGATTCATCAAATATTGGTGG + Intergenic
1100241100 12:92711244-92711266 GATTATTCTGCACAATATGCAGG - Intergenic
1100939748 12:99713125-99713147 GATTATCCTGCATATATTTGTGG - Intronic
1102973317 12:117188879-117188901 GATGATTCCCCAAATAACGGAGG + Intronic
1104183093 12:126401248-126401270 GAATATGGTGGAAATAATGGTGG + Intergenic
1104593758 12:130105334-130105356 GAGTATTCTACAAATGAGGGAGG + Intergenic
1106139435 13:26999519-26999541 GATAATTCTGCAAAACATGGCGG + Intergenic
1106679095 13:31991708-31991730 AAATATTCTAAAAATAATGGAGG - Intergenic
1108298608 13:49052135-49052157 GATTATTAAGCAAATCAAGGAGG - Intronic
1108831771 13:54487779-54487801 GATTATTGAGCAAATCAAGGAGG + Intergenic
1109197022 13:59389798-59389820 GATTATTATGCTAATCAAGGGGG - Intergenic
1110691993 13:78441710-78441732 AATTATTCTGGTAATAATGTGGG + Intergenic
1110716675 13:78713100-78713122 GATTATTATGGTAATATTGGAGG + Intergenic
1110768751 13:79310765-79310787 GATTCATCTTCAAATAATGGAGG + Intergenic
1114776708 14:25492018-25492040 GATCATTCTTGAAATGATGGTGG - Intergenic
1115013755 14:28584508-28584530 AATTCTTCTGAAAATAATAGAGG - Intergenic
1115648735 14:35388075-35388097 GCTTATTTTGCAAATAAAGCTGG + Intergenic
1115789528 14:36863691-36863713 GATTCTTCTGCACATAATCTTGG + Intronic
1115971277 14:38947435-38947457 GATTATTCTCCATATTATCGAGG + Intergenic
1116277673 14:42857404-42857426 GATTCTTGTGCAATTATTGGAGG - Intergenic
1119097717 14:71849256-71849278 GATTATTCTTCTCATTATGGGGG + Intergenic
1119835385 14:77744994-77745016 GTTTGTTCAGCAAATAATAGTGG - Intronic
1119944181 14:78674322-78674344 GATTATTCTGCAAATAATGGGGG + Intronic
1121316361 14:92963359-92963381 GATTATTTTGCAAACTGTGGAGG - Intronic
1122679889 14:103451364-103451386 GATTATACTGCAATTAATTGAGG - Intronic
1127065995 15:55239466-55239488 GATTATACAGTATATAATGGTGG - Intronic
1127674754 15:61228759-61228781 GATTTTTCTGCAAACACTGGAGG - Intronic
1130362340 15:83201686-83201708 TATTATTTTCCAAATCATGGAGG + Intronic
1130836593 15:87655727-87655749 GAATATTCAGCAAGTCATGGGGG + Intergenic
1132033776 15:98462095-98462117 TCTAATTCTGCAAAGAATGGTGG - Intronic
1133547511 16:6822089-6822111 GATTTTTCTGCAGCTACTGGGGG + Intronic
1136495415 16:30640387-30640409 GGGCATTCTGCAAATGATGGTGG + Intergenic
1138361422 16:56432023-56432045 GAGTTTTCTTCACATAATGGGGG - Exonic
1138871625 16:60894849-60894871 GATTTTTCTTCATTTAATGGGGG - Intergenic
1140808618 16:78556059-78556081 GAATCTTCAGGAAATAATGGAGG - Intronic
1140860997 16:79017783-79017805 ATTTGTTATGCAAATAATGGGGG - Intronic
1144444512 17:15314654-15314676 GATTTATATTCAAATAATGGAGG - Intronic
1145967347 17:28929199-28929221 AATTTTTCTTCAAATAATGGGGG + Intronic
1152142928 17:78549041-78549063 GATTATTCTCCTTATAATGGGGG + Intronic
1152392089 17:80009251-80009273 GATTTCTGGGCAAATAATGGTGG - Intronic
1153562806 18:6388358-6388380 AATTTGTCTGCAAATAATGCTGG - Intronic
1155017142 18:21855126-21855148 GATTGTTCTGAAAATAAATGAGG - Intronic
1155051947 18:22156269-22156291 GATTTTTTTGCAATTAAGGGGGG - Intergenic
1155480997 18:26287369-26287391 GACTATTCTGCAAATATTCTGGG - Intronic
1157127347 18:44969513-44969535 TATTCTTATGCAAATAAAGGAGG + Intronic
1162223178 19:9196919-9196941 AAAGATTCTGCAAATAATGAAGG + Intergenic
1164195844 19:22958110-22958132 AATTATTCTGCAAATCCTGCTGG + Intergenic
1164821313 19:31253500-31253522 AATTATTCTGCACATATTGTTGG - Intergenic
1166403092 19:42498519-42498541 GCTTATTCTGCAATTAGTGAAGG - Intergenic
926027906 2:9560624-9560646 GATACTTCTGCACACAATGGTGG - Intergenic
926964862 2:18398786-18398808 GATTATTCTGCCTATATTTGTGG - Intergenic
928920137 2:36518468-36518490 GATGATGCTGCACATAATGACGG - Intronic
929644315 2:43611725-43611747 GATTTTTCTGAAACTCATGGTGG - Intergenic
930157441 2:48119841-48119863 GTTTTTTTTTCAAATAATGGAGG - Intergenic
932097273 2:68862583-68862605 GATAATTCTGCAATAAAAGGGGG + Intergenic
932124503 2:69131645-69131667 CATTACTCAGCAAATAATGATGG + Intronic
936598034 2:113868030-113868052 GAGTATTCTCCAAATAAAGCAGG + Intergenic
937637008 2:124167585-124167607 TAGTATTCTGAAAATAATTGTGG + Intronic
938088099 2:128414781-128414803 TTTTTTTCTGCAAAAAATGGTGG + Intergenic
938146289 2:128837060-128837082 GACTTTACTGCAAGTAATGGAGG - Intergenic
938956269 2:136301570-136301592 GATTCTTATGCAAATGAGGGAGG + Intergenic
939080814 2:137659627-137659649 GAGAAATCTGCAAATGATGGTGG + Intronic
941199923 2:162495822-162495844 AATTATCCTGCAAATCCTGGAGG + Intronic
941753693 2:169162049-169162071 TATTAGTCTGCACATTATGGTGG - Intronic
941823146 2:169862918-169862940 CATTATTCTGCATATAATTTTGG - Intronic
943324278 2:186479439-186479461 GATTATTCTGGAAGTCCTGGAGG - Intergenic
944330157 2:198456195-198456217 GATTTTTCTGTAAAAAATGATGG + Intronic
944386164 2:199167495-199167517 AATTATTCTGAAAAAAATAGAGG - Intergenic
944522934 2:200589753-200589775 GCTCATTGTGCAAATAATGCAGG - Intronic
944786291 2:203074268-203074290 GTTTAATCTGCAAATGTTGGGGG + Intronic
945663507 2:212714728-212714750 TATGATTCTGGAATTAATGGGGG + Intergenic
945784183 2:214212963-214212985 GATTATATTGACAATAATGGTGG - Intronic
945827048 2:214734135-214734157 GTTGTTTCTGAAAATAATGGAGG + Intronic
946412398 2:219521887-219521909 AATTTTTTTGCAAATCATGGTGG + Intronic
946482281 2:220068731-220068753 CGTTATCCTGCAAAAAATGGGGG + Intergenic
946593956 2:221285332-221285354 GAATATTCTGAAAAGAAGGGTGG - Intergenic
947042734 2:225942302-225942324 GATTATTCTGGAAGGAACGGAGG + Intergenic
947579566 2:231306384-231306406 GATTATTCTCCAAATGATTCTGG - Intronic
1169950105 20:11034422-11034444 GATTATGGTGGAAATAGTGGTGG + Intergenic
1170345587 20:15383214-15383236 GATTATTCTGGAAAATATGTGGG - Intronic
1170388319 20:15844709-15844731 ATTCATTCTGCAAACAATGGTGG - Intronic
1172322436 20:34006906-34006928 GCTTCTTCAACAAATAATGGGGG - Intronic
1173027132 20:39318821-39318843 GACTTTTCTGCAAATTATGGCGG + Intergenic
1173455694 20:43199555-43199577 GAATATTCTCCAAATAATCTCGG + Intergenic
1178167540 21:29997032-29997054 CGTTATTCTGCACATAAGGGGGG + Intergenic
1182572821 22:31251501-31251523 CATTATTTGCCAAATAATGGAGG + Intronic
1184273631 22:43398501-43398523 CATTATTCTCAACATAATGGAGG + Intergenic
949162969 3:903361-903383 GTATATTCTGCAATTATTGGAGG - Intergenic
950314664 3:11990422-11990444 GATGGATCTGAAAATAATGGAGG - Intergenic
950934825 3:16828318-16828340 AATTATTTTGCAAAGTATGGGGG - Intronic
951302559 3:21016843-21016865 GATTATTAAGCTAATCATGGAGG - Intergenic
951437599 3:22682844-22682866 TATTTTTCTGGAGATAATGGGGG - Intergenic
951606601 3:24441464-24441486 TATTATTCTGAAAGCAATGGAGG + Intronic
952204776 3:31170327-31170349 GATTATTCTGCAAATTATATGGG + Intergenic
952610949 3:35207919-35207941 CATTTTTATGCAAATAATTGTGG - Intergenic
953008366 3:38999143-38999165 CATTTTACAGCAAATAATGGAGG + Intergenic
953634968 3:44655613-44655635 GATTAATCAGCAAATAATCCGGG - Intronic
956235316 3:67063419-67063441 GCTTATTCAGCAAATAAAGCAGG + Intergenic
956610920 3:71122075-71122097 AATTATGCTCAAAATAATGGAGG + Intronic
957296570 3:78340681-78340703 AATTATACTATAAATAATGGAGG - Intergenic
957452611 3:80399568-80399590 GATAATTCTGCACATTATGGTGG + Intergenic
959762237 3:109979002-109979024 GATTATTCTGCTCATTATAGTGG + Intergenic
961430585 3:126879925-126879947 TATTATTCTGCAAATTTTGTTGG + Intronic
962013024 3:131411573-131411595 GATTATTAAGCTAATAAAGGAGG + Intergenic
963771608 3:149391764-149391786 GAATATGCTTCAAATAATGTGGG - Intergenic
964575699 3:158165214-158165236 GCTTTTCCTGCAATTAATGGAGG + Intronic
965160927 3:165131871-165131893 TATTATTCAACAAATAATGTTGG + Intergenic
967439623 3:189491634-189491656 GAGTTTTCTTAAAATAATGGGGG - Intergenic
967491079 3:190091650-190091672 GATAATTCTGAAAAGAATGATGG + Intronic
968790597 4:2658587-2658609 GGTCTTTCTGCAAATATTGGTGG + Intronic
972188102 4:36556902-36556924 GATTATTTTGCAAATAAACTTGG - Intergenic
972195067 4:36644607-36644629 CGTTATTCTGAAAATAATGATGG - Intergenic
973805388 4:54520949-54520971 GATTTTTATGCAAATGATTGTGG + Intergenic
975410951 4:74049053-74049075 GATTATTCTCCTATTAATGTAGG + Intergenic
975831570 4:78374269-78374291 GATTATTCTGGAAAGAAGTGAGG + Intronic
976193530 4:82511771-82511793 GATTATTCTGTCAATAGTGTAGG - Intronic
977681118 4:99799493-99799515 GATTATTCTGGAAATACATGAGG - Intergenic
978065866 4:104401127-104401149 GCTTAATCTCCAAATATTGGGGG - Intergenic
978638924 4:110845090-110845112 GATTCTTGACCAAATAATGGGGG - Intergenic
979030056 4:115632749-115632771 GATTATTCAGCTAATCAAGGAGG - Intergenic
980644965 4:135632420-135632442 GATTATTAAGCTAATAAAGGAGG - Intergenic
982502919 4:156180647-156180669 GATTATTCAGCAAATTGTGCTGG + Intergenic
982623290 4:157732523-157732545 GATGATTCTGCAAAATATGCAGG - Intergenic
982851576 4:160323376-160323398 TATTATTCTTCAAGTTATGGTGG + Intergenic
983480001 4:168261258-168261280 GATTTTTCAGCAAATGATGCTGG + Intronic
985364867 4:189218039-189218061 TATTAATCTGAAAAAAATGGAGG + Intergenic
985842567 5:2319573-2319595 GACTATTCTGTAAATATTTGTGG + Intergenic
987037047 5:14029565-14029587 GAAATTTCTGCAAATAATAGGGG - Intergenic
990799896 5:59588639-59588661 GAAAATTCTCCAAATTATGGTGG - Intronic
992261412 5:74974242-74974264 GATTATTCTGAAAACTATTGTGG - Intergenic
993678211 5:90843418-90843440 TATTATTCAGCAAATAGTGTTGG + Intronic
993782480 5:92084893-92084915 TATTTCTCTGAAAATAATGGAGG - Intergenic
993897927 5:93560930-93560952 AATTATTATGGAAAGAATGGTGG + Intergenic
995459280 5:112385860-112385882 GATGTTTCTGGAAATAATGTGGG + Intronic
996197473 5:120626755-120626777 TTTTATTCTACAAATTATGGAGG - Intronic
998069059 5:139182426-139182448 GGGTACTCAGCAAATAATGGTGG + Intronic
998440431 5:142156426-142156448 GAAAATTCTGAGAATAATGGAGG - Intergenic
998455182 5:142266588-142266610 GATTAATCTTCAATTAATAGGGG - Intergenic
998654036 5:144154927-144154949 AAATATTCTGAAAATAGTGGTGG + Intergenic
1000392326 5:160736863-160736885 CATTATTCTGCAAATAGAGATGG + Intronic
1006822240 6:36906283-36906305 GCTTATTTTGCAAATAAAAGAGG - Intronic
1008719915 6:54336355-54336377 GAAAATGCTGCAAATAATGAAGG - Intronic
1009389589 6:63130132-63130154 GATTATTATGCTAATCAAGGAGG - Intergenic
1009783808 6:68304580-68304602 AACTATTCTGCAAAAAAAGGAGG + Intergenic
1012353744 6:98287303-98287325 GATTGCTCTCCAAATAAGGGTGG + Intergenic
1014673910 6:124341659-124341681 GATTATGCTGCAGATCATAGAGG - Intronic
1014774540 6:125493571-125493593 AATTATGATGCAAATAATGATGG + Intergenic
1016602926 6:145883157-145883179 GATCATTATACAGATAATGGAGG + Intronic
1017039746 6:150298348-150298370 AATTTTTCTCCAAATGATGGTGG + Intergenic
1020441193 7:8218623-8218645 TATTATTCAGCAAATATTGATGG - Intronic
1023048340 7:36230422-36230444 GATTATTCTGCAGAAACAGGTGG - Intronic
1023176093 7:37437091-37437113 GATTATGTTGCATATAAAGGAGG - Intronic
1028451376 7:90988501-90988523 GCTTATTTTGCAACTAATGGAGG - Intronic
1028494170 7:91445551-91445573 GATTATTCTGCTGACAATGTAGG - Intergenic
1028867908 7:95735166-95735188 GATTATTCTGCATTTTATGCCGG - Intergenic
1030700391 7:112631956-112631978 GAAAATACTGAAAATAATGGTGG + Intergenic
1033269729 7:139919986-139920008 GATTATGCTGTGAATAATGATGG - Intronic
1033762919 7:144456099-144456121 GTCTACTCTGCAAACAATGGGGG - Intronic
1033934387 7:146565864-146565886 GATTACTCTGCAAATATAGCAGG - Intronic
1034705375 7:153138767-153138789 GATTATTAAGCAAATCAAGGAGG - Intergenic
1036273540 8:7330544-7330566 GATCATTCTCCAGAAAATGGTGG + Intergenic
1036347807 8:7979808-7979830 GATCATTCTCCAGAAAATGGTGG - Intergenic
1037537037 8:19834403-19834425 GATAATTATATAAATAATGGTGG - Intronic
1040058469 8:43083375-43083397 GATTATTCTGAAAACAGTGTTGG - Intronic
1042992838 8:74660006-74660028 GATTATTCTGCAAATATACAAGG + Intronic
1044329651 8:90902022-90902044 GAATATTCTATAAATAATAGAGG + Intronic
1045102302 8:98857354-98857376 GTTTATTTTGCAATTAATGAAGG + Intronic
1045196516 8:99936636-99936658 GATTTTTCTGATAATATTGGTGG + Intergenic
1045849465 8:106675232-106675254 GATTATTCTGTTACCAATGGAGG - Intronic
1045925452 8:107575740-107575762 GATTTTTCTCCCAATAATGCAGG + Intergenic
1046254956 8:111683919-111683941 GTTTATTCTGCTAATGATGATGG - Intergenic
1046420209 8:113971899-113971921 GATTTTTCTACAAATTATGCTGG + Intergenic
1048271769 8:133034537-133034559 CGTTATTCTGCAAATAATGGCGG + Intronic
1048482997 8:134818801-134818823 GATGAATCTCCAAATAATGCTGG + Intergenic
1051730534 9:20138235-20138257 GACTATTTTCCAAATAATGCAGG + Intergenic
1052484888 9:29084181-29084203 GATTATTCTACAAAAAAATGTGG + Intergenic
1055590815 9:77811924-77811946 GAGTATTCTACAAAAAATGAAGG + Intronic
1055800989 9:80035668-80035690 GATTATTCTACAATTAACGCAGG + Intergenic
1056972470 9:91218354-91218376 GATTATCATGAAAAAAATGGTGG - Intronic
1057367294 9:94434655-94434677 GATTATCCTTCCAATAATAGTGG + Intronic
1057656036 9:96953414-96953436 GATTATCCTTCCAATAATAGTGG - Intronic
1058181115 9:101800968-101800990 GGTTATTCTTCAAATAATCTTGG + Intergenic
1059673892 9:116517692-116517714 GATTATTATGCTAATCAAGGAGG + Intronic
1186008265 X:5099343-5099365 GATTAAGCTGCAAAGAATAGTGG - Intergenic
1187133162 X:16522062-16522084 GAGTATTCTGCAGATCTTGGAGG - Intergenic
1188391093 X:29620674-29620696 GTTTCTTCTACAAGTAATGGCGG - Intronic
1188839537 X:34998956-34998978 GCTCATTCTGAAAAGAATGGTGG + Intergenic
1188979193 X:36711999-36712021 GAGTATTCTGCAGATAATGCAGG + Intergenic
1190397822 X:50002560-50002582 GATTAGTGTGGAAATAATAGAGG - Intronic
1192193211 X:69009233-69009255 GTTTAATCTCCAAATATTGGGGG + Intergenic
1192852898 X:74976825-74976847 GATTATTAAGCTAATCATGGAGG - Intergenic
1194139177 X:90188094-90188116 AATTTTTCTGAAAATAATAGGGG + Intergenic
1194742651 X:97593349-97593371 GATTATTCAACAAATAGTGCAGG + Intronic
1195120677 X:101748325-101748347 GATTATTCTGGAAATGGTGTTGG + Intergenic
1198439295 X:136646410-136646432 TATTATTGAGCTAATAATGGTGG + Intergenic
1198630618 X:138634078-138634100 TATTAATCTGCTAATAATGATGG + Intronic
1200484921 Y:3757070-3757092 AATTTTTCTGAAAATAATAGGGG + Intergenic