ID: 1119951999

View in Genome Browser
Species Human (GRCh38)
Location 14:78754706-78754728
Sequence CAGTAGGTCTAGAGTGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 187}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119951999_1119952010 4 Left 1119951999 14:78754706-78754728 CCCACTCCACTCTAGACCTACTG 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1119952010 14:78754733-78754755 AGAAACTCTGGAGGTGGGTGGGG 0: 1
1: 0
2: 13
3: 68
4: 547
1119951999_1119952006 -1 Left 1119951999 14:78754706-78754728 CCCACTCCACTCTAGACCTACTG 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1119952006 14:78754728-78754750 GAACCAGAAACTCTGGAGGTGGG 0: 1
1: 22
2: 123
3: 500
4: 1216
1119951999_1119952004 -5 Left 1119951999 14:78754706-78754728 CCCACTCCACTCTAGACCTACTG 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1119952004 14:78754724-78754746 TACTGAACCAGAAACTCTGGAGG 0: 3
1: 57
2: 267
3: 526
4: 925
1119951999_1119952009 3 Left 1119951999 14:78754706-78754728 CCCACTCCACTCTAGACCTACTG 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1119952009 14:78754732-78754754 CAGAAACTCTGGAGGTGGGTGGG 0: 1
1: 0
2: 7
3: 39
4: 351
1119951999_1119952002 -8 Left 1119951999 14:78754706-78754728 CCCACTCCACTCTAGACCTACTG 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1119952002 14:78754721-78754743 ACCTACTGAACCAGAAACTCTGG 0: 8
1: 117
2: 432
3: 958
4: 1623
1119951999_1119952005 -2 Left 1119951999 14:78754706-78754728 CCCACTCCACTCTAGACCTACTG 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1119952005 14:78754727-78754749 TGAACCAGAAACTCTGGAGGTGG 0: 1
1: 25
2: 154
3: 515
4: 1299
1119951999_1119952008 2 Left 1119951999 14:78754706-78754728 CCCACTCCACTCTAGACCTACTG 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1119952008 14:78754731-78754753 CCAGAAACTCTGGAGGTGGGTGG 0: 1
1: 1
2: 10
3: 86
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119951999 Original CRISPR CAGTAGGTCTAGAGTGGAGT GGG (reversed) Intronic
902820137 1:18938638-18938660 CAGAAGGTCTAGAGAGGTGCAGG - Intronic
903010110 1:20323793-20323815 CAGTAGGTACTGAGTGGAGCAGG + Intronic
903137668 1:21319897-21319919 CAGAAGATCTGGAGTGGGGTGGG - Intronic
905092256 1:35438935-35438957 CAGGAGGTCAAGACTGCAGTGGG + Intronic
906967421 1:50472103-50472125 CCGTAGGTCTGGAGGGGAGCTGG + Intronic
909358601 1:74736134-74736156 TAGTAGGTCTTGTGTGGAATTGG + Intronic
909761844 1:79298155-79298177 CAGTGTGTCTAGAGTAGAGGTGG + Intergenic
915406425 1:155663295-155663317 CAGGAGGTGGAGAGTGCAGTGGG + Intronic
915554798 1:156655433-156655455 CAGAAGGCCCAAAGTGGAGTTGG + Intronic
916826668 1:168448464-168448486 CAGTATGGATAGAGTGGAGAGGG - Intergenic
917218441 1:172702265-172702287 CAGTTTGTCTGGAGTGGAGTGGG + Intergenic
917464756 1:175266324-175266346 CAGGAGGACTAAAGTGGGGTGGG + Intergenic
918186581 1:182132919-182132941 CATTAGGCCTAGACTGGACTGGG - Intergenic
921865438 1:220083161-220083183 CAGGAGGTGTAGATTGCAGTGGG + Intronic
924258603 1:242207105-242207127 CAGTAGGTTTTGAGTAAAGTAGG - Intronic
924280682 1:242434035-242434057 TAGTAAGTCAAGAGTGGAGGAGG + Intronic
1065803502 10:29373558-29373580 CAGGAGGTCAAGACTGCAGTGGG + Intergenic
1066437875 10:35410813-35410835 CAGTAAGTCTGGAGTAGGGTGGG + Intronic
1066539802 10:36433730-36433752 CTCTAGTGCTAGAGTGGAGTAGG + Intergenic
1069369762 10:67735064-67735086 CAGTAGGTCTAGAGCAAGGTTGG + Intergenic
1070396962 10:76019821-76019843 CAGTAGATATAGATTTGAGTTGG + Intronic
1073466129 10:103695433-103695455 CAGGAGGTCAAGACTGCAGTGGG + Intronic
1074011621 10:109487668-109487690 GAGTAGGTCTGGGGTGGAGCTGG + Intergenic
1075079493 10:119373640-119373662 TAGTAGGTCTGAAGTGGGGTGGG + Intronic
1076111501 10:127863153-127863175 CAGTGGTTCTTGAGTGGGGTGGG - Intergenic
1077402537 11:2366313-2366335 CAGAAGGGCTCGGGTGGAGTGGG - Intergenic
1077790478 11:5434316-5434338 TTGTAGGTCCAGAGTGGAGTAGG - Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1087128748 11:94651265-94651287 CAGTAGGTCCTCAGTGGAGGAGG + Intergenic
1087970365 11:104473627-104473649 CAGTTGTTCTAGAGTGGAGCTGG + Intergenic
1088283849 11:108165536-108165558 CAGGAGGTTGAGAGTGCAGTGGG - Intronic
1088875275 11:113930560-113930582 CAGGAGGTCAAGATTGCAGTGGG - Intronic
1090434009 11:126671274-126671296 CAGGAGTTCAAGAGTGGTGTGGG - Intronic
1092209558 12:6637537-6637559 CAGGAGGTCAAGACTGCAGTGGG + Intergenic
1093953731 12:25193568-25193590 CAGTAGATTTGGAGTTGAGTGGG + Intronic
1094540220 12:31357224-31357246 CAGGAGGTCAAGACTGCAGTGGG - Intergenic
1095363626 12:41374563-41374585 CAGTAGGTCTATAGAAAAGTGGG + Intronic
1095377222 12:41544885-41544907 CAGCAAGTCAAAAGTGGAGTTGG - Intronic
1095866746 12:46980421-46980443 CAGGAGGTCAAGACTGAAGTAGG - Intergenic
1097834028 12:64255371-64255393 CAGGAGGTCAAGACTGCAGTGGG + Intergenic
1098467114 12:70800237-70800259 CAGTATGTCTAAAATGCAGTGGG - Intronic
1098663708 12:73132951-73132973 CAATATGTCTTGAGTTGAGTTGG + Intergenic
1099717827 12:86319119-86319141 CAGTAGGAGTAGAAAGGAGTAGG - Intronic
1101960240 12:109243556-109243578 CACCAGGGCTAGAGTGCAGTGGG - Intronic
1102755809 12:115339271-115339293 CAGTCGGTCTAGAGAGGACAAGG - Intergenic
1102915043 12:116746310-116746332 CAGTTGGTCTCCAGTGGGGTCGG + Intronic
1103388254 12:120551057-120551079 CAGTAGGTCAAGGCTGCAGTGGG - Intronic
1104421101 12:128636122-128636144 CAGGAGGTCAAGACTGCAGTGGG - Intronic
1105473957 13:20715225-20715247 CAATTGCTCTAGAGTGGAGCGGG - Intronic
1105492833 13:20904082-20904104 CAGGAGGTCGAGAGTGCAGTGGG + Intergenic
1107816458 13:44249121-44249143 CAGGAGGTCGAGACTGCAGTGGG + Intergenic
1108586609 13:51875582-51875604 CAGTGGGTCTGGAGAGGGGTAGG - Intergenic
1110847957 13:80211042-80211064 TAGTAGCCCTAGAGTGAAGTGGG + Intergenic
1111738804 13:92176169-92176191 CAGTAAGTCTAGGATGGAGCCGG + Intronic
1111942168 13:94622073-94622095 TAGTAGGTTTTGAGTGGAATAGG + Intronic
1112056403 13:95692561-95692583 CTATAGCGCTAGAGTGGAGTAGG - Intronic
1113603923 13:111591212-111591234 CAGCAGGGCAAGTGTGGAGTTGG - Intronic
1119420574 14:74505654-74505676 CAGGAGCTCTCGGGTGGAGTGGG + Intronic
1119662070 14:76459302-76459324 CAGTGGGACTAGAGAGGAGCTGG + Intronic
1119951999 14:78754706-78754728 CAGTAGGTCTAGAGTGGAGTGGG - Intronic
1121002893 14:90464833-90464855 CAGTAGGTCTGGGGTGGGGCTGG + Intergenic
1121049009 14:90807861-90807883 TAGTAGGTCTAGGGTGGAGCTGG - Intronic
1122761726 14:104033648-104033670 CAGAGGGTCTCGAGTGGAGGTGG + Intronic
1124510144 15:30317176-30317198 CAGTGGTTTTAAAGTGGAGTTGG - Intergenic
1124653320 15:31488347-31488369 CAGAAGGGCTAGGGTGGAGGGGG + Intronic
1124732745 15:32213377-32213399 CAGTGGTTTTAAAGTGGAGTTGG + Intergenic
1125814191 15:42570315-42570337 CAGGAGGTTCAGAGTGCAGTGGG - Intergenic
1125841817 15:42808808-42808830 CAGCAAGGCTAGAGTGCAGTTGG - Intronic
1127351102 15:58153333-58153355 CTATAGTGCTAGAGTGGAGTAGG - Intronic
1130617891 15:85429764-85429786 CAGTAGGTGTAGGGTGGCGCAGG + Intronic
1130882474 15:88067026-88067048 CAGTAGGGCTGGAGTGGGATGGG - Intronic
1133413635 16:5589071-5589093 CAGTGGGTATGGAGTGGGGTGGG + Intergenic
1133812612 16:9172569-9172591 CAGTAGGTCATGGGGGGAGTGGG - Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134542045 16:15075495-15075517 CAGGAGGTCGAGGCTGGAGTGGG + Intronic
1135702731 16:24647000-24647022 CAGGAGGTCAAAACTGGAGTGGG - Intergenic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1137753755 16:50885651-50885673 CAGTAGGGCTGGAATGCAGTAGG - Intergenic
1139555796 16:67709232-67709254 CAGTAGGTCAAGGCTGCAGTGGG + Intronic
1140951142 16:79818600-79818622 GAGAAGGTCTGGAGTGGAGCTGG - Intergenic
1141102581 16:81208918-81208940 CAGTAGGTATGGAGTGCAGCTGG + Intergenic
1141173689 16:81705986-81706008 CAGGAGGTCTGGAGTGGGCTTGG - Intronic
1141939129 16:87263097-87263119 CAGGAGGTCTAGGCTGCAGTGGG - Intronic
1146156868 17:30531680-30531702 TAGTGGGTCTTGAGTAGAGTAGG + Intergenic
1146523811 17:33548736-33548758 CAGCATGGCTAGAGTGGAATGGG - Intronic
1149820967 17:59777115-59777137 CAGCAAGTCCAGAATGGAGTGGG - Intronic
1156339937 18:36201620-36201642 CACCAGGGCTAGAGTGCAGTGGG - Intronic
1156918432 18:42488977-42488999 CAATAGGGCTGGAGAGGAGTAGG - Intergenic
1158557581 18:58487987-58488009 CAGTAGGTCTGGAGTGGGGGTGG + Intronic
1161226388 19:3148489-3148511 CAGGAGGCCTGGCGTGGAGTTGG + Intronic
1161560829 19:4971633-4971655 CTGTGGGTTTAGAGTGTAGTGGG + Intronic
1161806491 19:6446444-6446466 CAGCAGGTCTGAATTGGAGTGGG - Intronic
1163100452 19:15092785-15092807 CAGGAGTTCGAGACTGGAGTGGG + Intergenic
1164551235 19:29214061-29214083 CAGAAGTTCGAGACTGGAGTGGG - Intergenic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166309156 19:41952653-41952675 CAGTAGGTCAAGGCTGCAGTGGG - Intergenic
1167387869 19:49174975-49174997 CAGGAGGTCAAGACTGTAGTGGG - Intronic
931190314 2:59994033-59994055 CTGTAAGTCCAGAGTGGAGCAGG - Intergenic
931861847 2:66363002-66363024 CAGTTGGTTTAGCGTTGAGTAGG + Intergenic
932272354 2:70421618-70421640 CAGCAGGTCTAGGGTGGAGCTGG + Intergenic
932405471 2:71510264-71510286 CAGTAGGTCTAGGGTGGGCCTGG - Intronic
932741496 2:74294220-74294242 TGGTAGGTCCAGAGTGGCGTAGG - Intronic
933187894 2:79299136-79299158 CAGCAAGTCAGGAGTGGAGTAGG + Intronic
936611082 2:114002630-114002652 CAATAGGTCTGGAGTGTAGTTGG + Intergenic
937816006 2:126251406-126251428 CACTAGGTGCAGAGTCGAGTTGG + Intergenic
938445214 2:131371352-131371374 CTATAGTGCTAGAGTGGAGTAGG + Intergenic
939510226 2:143095805-143095827 CTATAGTGCTAGAGTGGAGTAGG + Intronic
940477102 2:154176988-154177010 CAGTAAGTTTGGAGTGGAGAGGG - Intronic
940644740 2:156379219-156379241 CAGAAGGTCTAGAAAGTAGTTGG - Intergenic
941155583 2:161973750-161973772 CCATAGGTCTGGAGTAGAGTGGG - Intronic
941222571 2:162802085-162802107 CAGTAGGTCTTGTGTGAGGTTGG + Intronic
941274393 2:163472337-163472359 GAGTAGAACTAGAATGGAGTTGG + Intergenic
941817017 2:169806042-169806064 CAGGAGGTCAAGACTGCAGTGGG - Intronic
942476411 2:176328490-176328512 AAGTAATTCTAGAGTTGAGTTGG + Intronic
943755591 2:191553762-191553784 CAATAGGTCTGGGGTGGAGCTGG - Intergenic
944863497 2:203838383-203838405 CAGTAAGTCAAGAGTGCAGTTGG - Intergenic
946156538 2:217810261-217810283 CAGCAGGTCTGCAGTTGAGTTGG + Exonic
946803378 2:223444739-223444761 GAACATGTCTAGAGTGGAGTGGG + Intergenic
947274910 2:228379654-228379676 CAGCAGGTATAGAGTGCAGTGGG + Intergenic
1170331204 20:15212880-15212902 TAGTAGGTCTGGAATGGAGTAGG - Intronic
1172837227 20:37880934-37880956 CAGGAGGGCTGGAGTGGGGTGGG - Intergenic
1173935906 20:46864132-46864154 CAGCAGGTCTCCTGTGGAGTAGG - Intergenic
1176249733 20:64114826-64114848 CAGGAGGTCCAGGGAGGAGTTGG - Intergenic
1176988195 21:15462323-15462345 CAGTAGGTCCTGAGTGGGGAGGG - Intergenic
1177719893 21:24892150-24892172 CAACAGGTCAAGAGTGAAGTTGG + Intergenic
1183680616 22:39326909-39326931 CAGGAGGGCAAGAGAGGAGTTGG + Intergenic
1185410409 22:50678688-50678710 CAGGAGGTGAGGAGTGGAGTCGG + Intergenic
949318510 3:2783401-2783423 CAATAGGTATAGTGTGGAGAGGG - Intronic
949877390 3:8635176-8635198 CAGTAGGTCTGGGGTGCAGACGG + Intronic
950649004 3:14395743-14395765 CAGCAGGTCTGGGGTGGGGTTGG - Intergenic
952853656 3:37749992-37750014 CAGTAGGTCTAGGGTGGGGCTGG - Intronic
954446576 3:50550134-50550156 AAGCAGGTCTGGACTGGAGTTGG - Intergenic
954865092 3:53722201-53722223 CTGGAGGTCTAGATTGGGGTGGG - Intronic
955760235 3:62272019-62272041 CAGTAGGTCAAGGCTGCAGTGGG + Intronic
962425024 3:135262083-135262105 CAGCAGGTCTAGAGTGGAACTGG + Intergenic
962682229 3:137812323-137812345 CAGCAGGTCCAGAGTGTACTTGG - Intergenic
962898822 3:139739021-139739043 CAGTAGGTCTGGAATGGGGCTGG + Intergenic
963248161 3:143082073-143082095 CAGTAGGTCTAGCCAGGGGTGGG - Intergenic
963667237 3:148203631-148203653 CAATAGGGCTAGAGAGGAGCTGG + Intergenic
964785104 3:160387705-160387727 CAGTAAGTCTGGAGTCAAGTGGG + Intronic
967544620 3:190710202-190710224 GTGAAGGTCTAGAGGGGAGTTGG + Intergenic
969529090 4:7719931-7719953 CAGTAGGTGCACAGTGGGGTGGG - Intronic
970502951 4:16696877-16696899 TAGTAGGTCTGGAGTGGTGCCGG + Intronic
972321029 4:37973903-37973925 CAGTAGGTCTAGATTAGGGCAGG + Intronic
974043327 4:56876670-56876692 CAGGAGGTCAAGATTGCAGTGGG + Intergenic
974447218 4:62000853-62000875 CAGGAGGTCTAGGCTGCAGTGGG - Intronic
977381790 4:96283801-96283823 CAGTAGTTCAAGATTGCAGTGGG - Intergenic
979383977 4:120042131-120042153 CAGTACCTCTGGAGTGCAGTCGG - Intergenic
979474819 4:121142830-121142852 GAGTAGGTCAAGAGTGGCTTGGG - Intronic
979736725 4:124095653-124095675 GAGTAGATATAGAGTAGAGTAGG + Intergenic
980129380 4:128804038-128804060 CAGTAGGTCTGGGGTGGGGCTGG + Intergenic
981197945 4:141942653-141942675 CACTTGCTCTGGAGTGGAGTAGG + Intergenic
981815086 4:148821480-148821502 CAGTAGGTTTTGAGTAAAGTAGG + Intergenic
982442571 4:155454098-155454120 CTGTAGTGCTGGAGTGGAGTAGG + Intergenic
983266797 4:165515847-165515869 CAGAAAGTCTTGAGTGGACTTGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
991328573 5:65465575-65465597 GAGTAGGTTTAAAATGGAGTGGG - Intronic
992519857 5:77539436-77539458 CAGTAGGTCTGGGGTGGAGTGGG + Intronic
993446584 5:88020131-88020153 CAGTAGCTCTAGATTAGAGTGGG + Intergenic
996138119 5:119870188-119870210 CAATAAGTCTGGAGTGGAATTGG - Intergenic
999398970 5:151249854-151249876 CAGTAGGTCTTCAGTGGTGGAGG - Intronic
1001327766 5:170741896-170741918 CAGAAGGGGTAGACTGGAGTTGG - Intergenic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1004585373 6:16994630-16994652 CAGTGGGGCTCAAGTGGAGTGGG + Intergenic
1006376119 6:33672604-33672626 CAGTAGGTCTAGGGTGGGGCCGG - Intronic
1007696777 6:43739046-43739068 CAGAAGGTAAACAGTGGAGTGGG - Intergenic
1008678427 6:53845752-53845774 CAGTAGATCCAGAGTGGATCTGG + Intronic
1010261635 6:73824068-73824090 CAGTAGGGCTAGGTTGGAGGTGG - Exonic
1010742384 6:79524183-79524205 CAATAGGTCTAGAATGTAGTTGG - Intronic
1011035502 6:82969565-82969587 CACTCGGTCTGGAGTGCAGTGGG - Intronic
1013047157 6:106497880-106497902 CAGGAGTTCTAGAGTGGCCTGGG + Intergenic
1015513835 6:134065430-134065452 AAGTAGATCTAGAGTTGATTGGG - Intergenic
1015544045 6:134344268-134344290 CAGCAGGTCAAGACTGCAGTGGG - Intergenic
1017684719 6:156900392-156900414 CAGTATTTCTATAGTGGATTTGG + Intronic
1017858464 6:158373056-158373078 AAGTAGGTCATGAGTAGAGTGGG + Intronic
1019126050 6:169840606-169840628 GAGTGGGTGTAGTGTGGAGTGGG - Intergenic
1019653419 7:2173099-2173121 CAGGAGATGCAGAGTGGAGTTGG - Intronic
1020559339 7:9710424-9710446 CAGGAGATCTGGAGTGGAGCCGG - Intergenic
1021540498 7:21752040-21752062 CAGGAGGTCTGGCTTGGAGTTGG - Intronic
1021823286 7:24519298-24519320 AAGAGGGTCTAGAGTGTAGTGGG - Intergenic
1023164536 7:37330377-37330399 GAGTAACTCTAGAGTGGATTTGG - Intronic
1024030834 7:45458254-45458276 CCCTAGGTCCAGAGAGGAGTGGG - Intergenic
1025949019 7:66128896-66128918 CAGGAGGTCTAGAAGGTAGTAGG + Intronic
1026202426 7:68225931-68225953 CTGTAGGTCTAGAGTGGGCAGGG + Intergenic
1037463826 8:19139563-19139585 CAGTGGGCCTAGAGTGGGGCGGG - Intergenic
1037696542 8:21228769-21228791 CAGGAGGGCTGGGGTGGAGTGGG + Intergenic
1037951022 8:23018896-23018918 GAGTTGGTCTAGAGAGGAGGAGG + Intronic
1038204444 8:25452529-25452551 CAGTAGGTCTGGGGTGGGGTAGG - Intronic
1038290086 8:26241459-26241481 CAGTAGGCATATAGTGGAGCTGG - Intergenic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1046280556 8:112023949-112023971 TAGGAGGCCTGGAGTGGAGTAGG - Intergenic
1046328090 8:112676082-112676104 CAGCAGGTTTAGAGTGACGTGGG + Intronic
1047056490 8:121170379-121170401 CAGTACAGCCAGAGTGGAGTGGG - Intergenic
1053455021 9:38227099-38227121 AAGTAGCTCTTAAGTGGAGTGGG + Intergenic
1054725854 9:68649357-68649379 CAGTAGGGATAAAGTGGAGCTGG - Intergenic
1055511475 9:76999655-76999677 CAGTAGGTCTAGGGAGGATCAGG - Intergenic
1056274904 9:84984541-84984563 CAGTAGGCTTAGGGTGGAGGTGG + Intronic
1057326087 9:94065452-94065474 CAGTAGGACTAAAGTGAAGGTGG - Intronic
1057447045 9:95123811-95123833 CCGCAGGTCTAAATTGGAGTAGG - Intronic
1060531146 9:124347640-124347662 CAGAAGGACTAGAGAGGAGGAGG - Intronic
1187726154 X:22204164-22204186 CAGTAGGTCTAGGGAGGTGGGGG + Intronic
1193017602 X:76753334-76753356 CATTTGGTCTAAAGTGTAGTTGG - Intergenic
1193450086 X:81655115-81655137 CACTAGCTCTGGAGTGGGGTAGG - Intergenic
1197315628 X:124962380-124962402 CAATATGTCTAGAGTGGGGCTGG + Intronic
1201055857 Y:9991031-9991053 CAGGAGGTAGAGATTGGAGTGGG - Intergenic