ID: 1119955240

View in Genome Browser
Species Human (GRCh38)
Location 14:78791140-78791162
Sequence ATGTTGTTTTAGGTGTGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119955240 Original CRISPR ATGTTGTTTTAGGTGTGATA AGG (reversed) Intronic
903792107 1:25900846-25900868 ATGTTGTTTTAGGGGCTAAAGGG - Intronic
907583984 1:55599788-55599810 ATTTTGTTTTACATCTGATATGG + Intergenic
908574982 1:65450119-65450141 ATGTTGTTTTAAATTTGCTAAGG + Intronic
909731758 1:78900476-78900498 ATGTACATATAGGTGTGATATGG + Intronic
910136840 1:83982026-83982048 ATGTTTTATGAGCTGTGATATGG - Intronic
910170969 1:84376768-84376790 CTGTTGGTTTAGGTATCATATGG - Intronic
911268700 1:95774912-95774934 ATGTTTTTTTAGTTGTGAGGAGG - Intergenic
911936713 1:103985559-103985581 TTGTTGTTTTATGTTTGATGAGG + Intergenic
912988930 1:114464375-114464397 ATGTTGTAGTTGGTGTAATACGG - Exonic
913590378 1:120319179-120319201 CTGTGGTTTTAGGGGTGATGTGG + Intergenic
913617808 1:120579184-120579206 CTGTGGTTTTAGGGGTGATGTGG - Intergenic
915126201 1:153666811-153666833 ATGTTTTTTAATGAGTGATAAGG - Intronic
915730851 1:158053135-158053157 ATGCAGTTATAGGTGTGATATGG - Intronic
916956464 1:169841527-169841549 AGGTTGTTTGAGGTGTGGTGGGG - Intronic
917124311 1:171672498-171672520 GTGTTGTTTTATATGTGGTATGG + Intergenic
920578393 1:207080533-207080555 ATAATGATTTAGTTGTGATATGG + Intronic
920668569 1:207985008-207985030 ATGTTGTTTTGGTTGAAATATGG + Intergenic
921997865 1:221441185-221441207 ATGTTGTTTTAGCACAGATATGG + Intergenic
922941921 1:229474391-229474413 TTGTTATTTTAGGTGGGATATGG - Intronic
1063757303 10:9027605-9027627 ATTTTGTTTTAATTTTGATATGG - Intergenic
1064745828 10:18477264-18477286 ATCTTGATTTAGGTGGGATTTGG + Intronic
1066375416 10:34853919-34853941 ATGTTATTTTAGTAGAGATAGGG - Intergenic
1069248623 10:66241885-66241907 ATTTTGTTTTAGGAGTGGAATGG - Intronic
1069509500 10:69031167-69031189 TTGTAGTTTTAGGAGAGATAGGG + Intergenic
1070936802 10:80304684-80304706 ATGGTGTTTTAGGTCTGAAAAGG + Intergenic
1071811633 10:89188233-89188255 ATGTTATTTTAGGTGTGGAGGGG - Intergenic
1072304102 10:94090351-94090373 ATGATGTTTTATGAGTGTTAGGG + Intronic
1073897781 10:108183395-108183417 ATCTTGTTTCATGGGTGATATGG + Intergenic
1077747182 11:4919643-4919665 ATAATGTTTTATGTGTGATATGG + Intronic
1077879427 11:6337098-6337120 ATTTTATTTTATGTGTGATAGGG + Intergenic
1078329348 11:10406646-10406668 ATGTAGTTTTAGGCTTGAAATGG + Intronic
1081113267 11:39163559-39163581 ATATTGTTTTATGTTTTATATGG - Intergenic
1084271532 11:68031810-68031832 ATGTTGTTTTTGGTTAGATTTGG + Intronic
1087897049 11:103597908-103597930 ATGTTTTGTTAAATGTGATAAGG - Intergenic
1088105797 11:106205222-106205244 ATGTTTTTTGAGGAATGATATGG + Intergenic
1089324191 11:117646007-117646029 ATGTGGTATTAGCTGCGATATGG + Intronic
1089379828 11:118020631-118020653 ATGTTGTTGTAAGTGTGAACAGG + Intergenic
1090652520 11:128819921-128819943 ATCTTGTTTTAGGTGTGCAGGGG + Intergenic
1091027573 11:132155780-132155802 ATGATGGTTTATGTGTGAAAGGG - Intronic
1094578918 12:31715177-31715199 ATGTTGTTTTAGGAGCTAAAGGG - Intronic
1095555784 12:43502357-43502379 ATGTTGCTGTAGGTATGAAAGGG + Exonic
1097459790 12:59846835-59846857 ATGTTGTTTTAGTTGGGTTGAGG + Intergenic
1097739781 12:63227357-63227379 ATGTTGTTTGATGTTTGATGTGG - Intergenic
1097813605 12:64046277-64046299 ATTTTGTTCTATGTGTGATGGGG + Intronic
1098149669 12:67533784-67533806 ATTTTTTTTTATTTGTGATATGG + Intergenic
1099783507 12:87231243-87231265 ATGTTGTCCTAGGTGATATAGGG + Intergenic
1100924317 12:99526755-99526777 ATGTTACTTTGGGTATGATATGG + Intronic
1100994564 12:100289795-100289817 ATGTTTTTTTCTGTGTGACATGG + Intronic
1101778845 12:107817594-107817616 CTGTTGTTCTAGGTGTGAGGTGG - Intergenic
1101916249 12:108898224-108898246 ATGTTGATGAAGGTGTGATTGGG + Intronic
1105437974 13:20392827-20392849 ATGATGTTTGAGGTGTGTGATGG - Intergenic
1107359065 13:39600551-39600573 AGGTTGTTTGAGGTGTAGTAGGG - Intronic
1108337388 13:49459038-49459060 ATTTTGTTTGAGCTGTGCTATGG + Intronic
1109606794 13:64707050-64707072 ATTTTGTTTCAGGTCTGAGAGGG + Intergenic
1109616076 13:64835970-64835992 ATGCTCTTTTAGGGTTGATATGG + Intergenic
1109994107 13:70100767-70100789 ATATTGATTTAGGTCAGATAAGG - Intronic
1110129373 13:71988113-71988135 AAATTGTATTATGTGTGATAGGG - Intergenic
1110166067 13:72445138-72445160 ATGTTGTTTTACATGTGCTTGGG - Intergenic
1111083905 13:83348340-83348362 ATTTTGTTTCAGGTGTTATTTGG - Intergenic
1111139591 13:84098421-84098443 ATGTTGTGGTTGGTGTGAGACGG + Intergenic
1111703182 13:91716247-91716269 TTGTTTTTTTAGGTGAGATATGG + Intronic
1112294154 13:98171920-98171942 ATGTGATTTTCTGTGTGATAGGG - Intronic
1112795491 13:103051954-103051976 ATTTTGTTTTAAATGTGAAAAGG - Intronic
1112795635 13:103053980-103054002 CTGCTGTTTTGGGAGTGATATGG + Intronic
1113321749 13:109239527-109239549 ATGTTGTTTTAGATTTGAAAAGG - Intergenic
1114147666 14:19995590-19995612 ATATTCTTTTGGGTATGATATGG - Intergenic
1114437560 14:22720121-22720143 ATGTTGAATTAGGTGTGGCAGGG - Intergenic
1117250418 14:53931419-53931441 ATTTGTTTTTAGGTGTAATATGG + Intergenic
1117312638 14:54543298-54543320 ACGTCTATTTAGGTGTGATATGG + Intergenic
1117885634 14:60358853-60358875 CTGTTGTGTTTGGTGTGATAGGG - Intergenic
1119863174 14:77951697-77951719 ATGGTGTGTTAGGTCTGATTGGG + Intergenic
1119955240 14:78791140-78791162 ATGTTGTTTTAGGTGTGATAAGG - Intronic
1130429210 15:83829958-83829980 ATTTTGTAATAAGTGTGATATGG + Intronic
1130604512 15:85303425-85303447 AAGTTGTTATATGTGAGATAGGG - Intergenic
1133676258 16:8075749-8075771 ATGTTGTCTTAGGGGTGAAAGGG - Intergenic
1135790867 16:25394154-25394176 ATATTGTTTTTGGTGTGTTTTGG - Intergenic
1138150203 16:54649779-54649801 ATGTTATTCTAGGTGTGATGGGG + Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1138318072 16:56087448-56087470 ATGTAGTTTGAGGTGTTTTAAGG + Intergenic
1140488405 16:75313499-75313521 ATGTATTTTTAGTAGTGATAGGG + Intronic
1142379696 16:89724254-89724276 ATGTTGTTTTAGGAGGGCCAGGG + Intronic
1142730433 17:1851198-1851220 GTATTTTTTTAGGTGTGAAATGG - Intronic
1144129694 17:12234292-12234314 AGGCTGTTTTAGGTGAGATAGGG + Intergenic
1145233239 17:21190328-21190350 AGTTTGTTTTAGGTGTTAGAAGG - Intronic
1146187601 17:30735445-30735467 TTTTTGTTTTAGGAGAGATAGGG - Intergenic
1147162644 17:38577070-38577092 ATGTTGTTTTAGGAGTGGTGGGG - Intronic
1148658700 17:49309579-49309601 AGGTTTTTTTGTGTGTGATACGG - Intronic
1153760692 18:8329007-8329029 ATGTTGTTATAGATGCCATAAGG + Intronic
1153889157 18:9496527-9496549 ATCTTGGTTTTGGTGTGATATGG - Intronic
1154007662 18:10546314-10546336 GTTTTGTTTTAGGTTTGATGAGG + Exonic
1154025321 18:10702071-10702093 ATGATGTTTGGGGGGTGATACGG + Exonic
1155521713 18:26675011-26675033 ACGTTATTTTATGTCTGATATGG + Intergenic
1159724952 18:71945517-71945539 ATAGTATTTTAGGTGTGAAAAGG + Intergenic
1160141389 18:76326761-76326783 ATGTTTCTTTAGCTTTGATAGGG - Intergenic
1163301688 19:16451426-16451448 TAGTTGTGTAAGGTGTGATAAGG + Intronic
1165661323 19:37582949-37582971 ATTTTATTCTAAGTGTGATAGGG - Intronic
1168575642 19:57506306-57506328 ATGTAGTCTTTGGTGTGAGAAGG - Intronic
1202674880 1_KI270710v1_random:34158-34180 ATGTTTTTTTAGTAGAGATAGGG - Intergenic
927523714 2:23719003-23719025 ATGTTGTTTTATGTGGTAAAGGG - Intergenic
930367842 2:50464126-50464148 ATTGTGTTTTAAGTGTGATTTGG + Intronic
931057629 2:58490701-58490723 ATTTTGTTCTAAGTGTGATGTGG - Intergenic
932456956 2:71856060-71856082 CTGTTCTGTTAGGTGTGAAATGG + Intergenic
932500272 2:72177067-72177089 ATGTTGTTTTTTGTTAGATAAGG + Exonic
933479579 2:82839095-82839117 ATGTTGTTTTAGGAATGTCAAGG + Intergenic
934589579 2:95534541-95534563 ATGTTGTTTTACTTCTCATAGGG + Intergenic
935614178 2:105059634-105059656 AGGTTGGTTTAGGAGTGAAAAGG + Intronic
937334499 2:121053673-121053695 ATGCTGTATTATATGTGATATGG - Intergenic
938926478 2:136047818-136047840 GTGTAGTTTTAGGTGTCACATGG + Intergenic
938990826 2:136628035-136628057 GTGTTCTCTTAGCTGTGATATGG - Intergenic
939044821 2:137237892-137237914 AAGTTATTTTTGGTTTGATAAGG - Intronic
939343926 2:140937704-140937726 ATCTTGTTTTCTATGTGATAAGG + Intronic
939473878 2:142660763-142660785 TTGTTGTTTTTGCTGTGATCAGG - Intergenic
940510928 2:154613771-154613793 ATGTTGGTGTAGAAGTGATAGGG + Intergenic
941496875 2:166216011-166216033 ATGATGTTTTAAATGTGCTAGGG - Intronic
941795210 2:169591206-169591228 ATGTTATTTTAGGATTAATATGG + Intronic
941874153 2:170416592-170416614 ATTTTATTCTAGGTGTGATGAGG - Intronic
943557262 2:189420885-189420907 ATGTTATTTTAGGTATCATTTGG - Intergenic
944864731 2:203849335-203849357 ATGTTGTTTTATTTGTGATAGGG - Intergenic
945379654 2:209125175-209125197 ATGCTGTTTTAGTTGTGAGGTGG + Intergenic
945580290 2:211586222-211586244 ATTTGGTTTTTGGTGTGTTATGG - Intronic
945756600 2:213855233-213855255 ATGTTGTTTTATGTGTGTCTAGG - Intronic
945769041 2:214016501-214016523 ATGTTGTTTACTTTGTGATATGG - Intronic
1169321840 20:4639475-4639497 ATGTTGTTTTCTGGGTGAGATGG - Intergenic
1172080411 20:32336229-32336251 ATGTGGTTATTGCTGTGATAAGG + Intergenic
1175352862 20:58337930-58337952 ATTTTGTTTTTGATGTGAAATGG + Intronic
1177951242 21:27540590-27540612 ATGTTGTTTCTGATGTGAAAGGG + Intergenic
1181954606 22:26579348-26579370 ATGCTGTTTTTGGTTTGATTTGG - Intronic
1182380411 22:29883196-29883218 ATGTTGTTGTGGTTGTGAGAAGG + Exonic
1184901486 22:47449059-47449081 ATTATGTTTGGGGTGTGATATGG + Intergenic
952294437 3:32048872-32048894 ATGTTGTTTTTGGTGGGTTTTGG - Intronic
953620888 3:44531824-44531846 CTGATGTTTTAGATGTGAGAGGG - Intergenic
954883419 3:53851399-53851421 AGGTTGCTTTAGGTGAGATGTGG + Intronic
956038058 3:65117170-65117192 ATGTTCTTTTAAGTGAGATGGGG + Intergenic
956827611 3:73013142-73013164 ATGTTGCTTTTGGTAGGATATGG + Intronic
957726771 3:84076147-84076169 ATGTTGTTTTATTAGTAATATGG + Intergenic
957871552 3:86095654-86095676 ATTTTGTATTAAGTGTGATGTGG - Intergenic
958669680 3:97186974-97186996 AATTTTTTTAAGGTGTGATATGG - Intronic
959343849 3:105166720-105166742 ATGTTGTTTATGGTTTGATTTGG + Intergenic
960110649 3:113841460-113841482 ATTTTGTTTTAGTTGAGATGGGG + Intronic
960209796 3:114949242-114949264 TTTTTGTGTTAGGTGTGAGATGG - Intronic
962544638 3:136420369-136420391 ATTTTGTTTTAATTGAGATAGGG + Intronic
964456012 3:156866930-156866952 ATGTTGATTGAGGTTTGAAAAGG + Intronic
965674904 3:171184316-171184338 AGTTTGTTTTATGTGTGAAATGG - Intronic
971752214 4:30665369-30665391 ATTTTGTTTTAGATGTGTTTTGG + Intergenic
972127921 4:35792348-35792370 ATTTTGTTTTAGCTGAGTTATGG - Intergenic
972172217 4:36360197-36360219 GTGTTGTTCTAGGTGAAATATGG - Intergenic
972680681 4:41304025-41304047 ATGTGGTTTGAGGGCTGATACGG - Intergenic
972832178 4:42826909-42826931 AAGTTGTTTTACCTGTGCTACGG - Intergenic
973598150 4:52513546-52513568 ATATAGCTTTATGTGTGATATGG + Intergenic
973930182 4:55784786-55784808 ATGTTTTTTATAGTGTGATATGG + Intergenic
974499105 4:62674956-62674978 ATTTTGTTTTAAATTTGATACGG + Intergenic
975410207 4:74039724-74039746 ATGTGATTTTATGTGTGATCTGG - Intergenic
975889966 4:79016077-79016099 ATGTGATTTTAAGTTTGATATGG - Intergenic
977063157 4:92280834-92280856 ATATTGTTTTAGGAATGTTATGG + Intergenic
979989801 4:127362356-127362378 ATGTTCTTTTAGTAATGATAGGG - Intergenic
980274683 4:130633864-130633886 GTGATCTTTTAGGGGTGATAAGG - Intergenic
981238216 4:142443117-142443139 AGGTTTTTTGAGGTCTGATATGG - Intronic
981798498 4:148628233-148628255 GTTTTATTTTAGGTGTGAGAAGG + Intergenic
981821814 4:148895972-148895994 ATGTTGGTTTAGGTCTAATTAGG + Intergenic
982588298 4:157271366-157271388 AGGTTGTTTTAGCTGTGCTTTGG + Intronic
982756998 4:159232855-159232877 ATGTGGCTTCAGGTGTGAAATGG + Intronic
982850790 4:160313085-160313107 ATGATGTTTTAGATACGATAGGG - Intergenic
983297665 4:165886683-165886705 ATATTGTATTAAGTGTTATATGG - Intronic
983658627 4:170109122-170109144 ATGTTGATTTAGGAGTGTTTTGG + Intergenic
986274367 5:6260672-6260694 ATGTTGTTTTGTGTGTGTTGTGG - Intergenic
987919122 5:24255847-24255869 TTGTTGTTTTAGTAGAGATAGGG - Intergenic
991210195 5:64095694-64095716 ATGTTGTTTTCAGTGGGAGAAGG + Intergenic
992575414 5:78105621-78105643 ATTTTGTTATAGGTGTTATTTGG + Intronic
993731954 5:91432874-91432896 AATTTGTTTGAGGTGTGATCTGG + Intergenic
995155806 5:108911844-108911866 ATGCAGTTTTAGTTATGATATGG + Intronic
997378617 5:133418830-133418852 TTGTTGTCTTGGTTGTGATATGG - Intronic
997709867 5:135995255-135995277 CTGCTGTTTTCTGTGTGATAGGG + Intergenic
997764113 5:136482098-136482120 GTTTTGTTTTAGGAGTGACAGGG - Intergenic
998205752 5:140155763-140155785 ATTTTTTTTTAACTGTGATAGGG - Intergenic
998979431 5:147685030-147685052 ATCTTGTTTTAAGTATGAAATGG - Intronic
999107433 5:149086188-149086210 AGGCTGTTATAGGTGTGAAAAGG - Intergenic
999139225 5:149346446-149346468 ATGTTGGGTCAGGTGTGTTAAGG - Intronic
999359884 5:150974697-150974719 AAATTGTTTTTGGGGTGATAAGG - Intergenic
999431702 5:151530668-151530690 GTTATCTTTTAGGTGTGATAAGG + Intronic
999740533 5:154546691-154546713 ATGTTGTTTTGGTTTTCATATGG + Intergenic
1001268918 5:170296335-170296357 ATGTTGAACTAGGTGTGGTATGG - Intronic
1001663362 5:173412994-173413016 ATGTTGTCTTCGGAGTGAGATGG + Intergenic
1002934410 6:1659472-1659494 ACCTTGCTTTGGGTGTGATAGGG + Intronic
1003897764 6:10623799-10623821 ATGTTGTTTTTGGTTTGAATTGG + Intronic
1006065589 6:31459984-31460006 ATGTAGTTTTAGTTGAGACAGGG - Intergenic
1010977726 6:82335022-82335044 AAATTGTGTTAGGTGTTATAGGG - Intergenic
1011289392 6:85760741-85760763 ATTTTGTAATAGGTGTGATGTGG + Intergenic
1011295150 6:85818631-85818653 ATTTTGGAATAGGTGTGATATGG - Intergenic
1013701407 6:112774406-112774428 ATCTTGTTTTTGGTGGGATTTGG - Intergenic
1015305141 6:131698643-131698665 ATAGTGTTTTTGGTGTTATATGG - Intronic
1016778220 6:147929412-147929434 ACGGGGTGTTAGGTGTGATAGGG - Intergenic
1018181968 6:161231896-161231918 TTTTTGTTTTAGGTTTGAAATGG - Intronic
1018824595 6:167399521-167399543 ATGTTATTTACGGTGTGATGAGG + Intergenic
1019011355 6:168846031-168846053 ATTTTCTATTATGTGTGATATGG - Intergenic
1019150578 6:170002987-170003009 ATGTGGAATGAGGTGTGATATGG - Intergenic
1019454615 7:1119960-1119982 AATTTGTTTTATGTGTGATAGGG - Intronic
1021646045 7:22790374-22790396 ATGTTGTTTTATTTGAGATTAGG + Intergenic
1023263707 7:38383084-38383106 TTGTTGTTTTAAGTGTGAATAGG - Intergenic
1026377342 7:69765270-69765292 GTGTCCTGTTAGGTGTGATAAGG - Intronic
1027847143 7:83394908-83394930 ATGTTGTTTTTGGATTGTTAAGG + Intronic
1028501183 7:91520611-91520633 AGGTTTTCTTAGTTGTGATAGGG + Intergenic
1030335603 7:108322606-108322628 ATGCAGGTTTAGGTGTGATTGGG - Intronic
1032675157 7:134123251-134123273 ATGTCGTTTTATTTGTCATATGG - Intergenic
1032967476 7:137117107-137117129 ATTTTCTTTTAGATGTGTTATGG + Intergenic
1033739252 7:144256876-144256898 ATAGTGTTTTTGGTGTTATATGG - Intergenic
1034388676 7:150764446-150764468 ATGTTTTTTTATTTGTAATACGG - Intergenic
1038482044 8:27908626-27908648 ATGTTGTATTAGGAGGGAAAAGG - Intronic
1038718279 8:30011104-30011126 AAGTAGTTTTAGTTGTGATTTGG - Intergenic
1042486756 8:69354822-69354844 ATTTTGGATTAGGTGTGGTATGG + Intergenic
1043579205 8:81692223-81692245 ATACTGTGTTAGATGTGATAGGG + Intergenic
1043983448 8:86667028-86667050 ATGTTGTCTGCGGTTTGATATGG + Exonic
1044815485 8:96108262-96108284 GTGTTTTTTTAGGTGAGATTAGG - Intergenic
1051287998 9:15515552-15515574 TTGTAGTTTTAGGAGAGATAGGG + Intergenic
1052246178 9:26337846-26337868 ATTCTGTTTTAGGTAAGATAGGG - Intergenic
1055938592 9:81626936-81626958 ATTTTGTTTTTGCTGTGATTAGG - Intronic
1058771317 9:108235215-108235237 ATCTTGTTTGATGGGTGATAAGG + Intergenic
1059568230 9:115405843-115405865 ATGTGGTTTTAGTGGTGGTATGG + Intergenic
1061298741 9:129692120-129692142 ATTTTTTTTTAGAAGTGATAAGG + Intronic
1061536363 9:131252605-131252627 ATGTTCTTTTAGGAGTGACAAGG - Intergenic
1061640801 9:131953421-131953443 AAGTGGTTTTAGGTGATATATGG + Intronic
1186057582 X:5666447-5666469 ATCTTGTTTTTGGTGGGATTTGG - Intergenic
1186380008 X:9047857-9047879 AAGTTCTGTTAGATGTGATAGGG - Intronic
1186420213 X:9419715-9419737 TTGTGGCTTTAGGTGTGACAAGG - Intergenic
1186772487 X:12831357-12831379 ATGCTTTTTTAGTTGTGATTGGG - Intergenic
1187715424 X:22097709-22097731 ATGGTGTTTTAGGTAGGATAGGG + Intronic
1187895563 X:23976836-23976858 GTATGGGTTTAGGTGTGATATGG - Intergenic
1188172969 X:26950803-26950825 ATGTTGTTTTAGGTATCATTTGG + Intergenic
1188637730 X:32456306-32456328 ATATTGTTCTAGATGTGTTAGGG - Intronic
1190542339 X:51490268-51490290 TTGTTTTTTAAGATGTGATATGG - Exonic
1192574678 X:72233776-72233798 TTATTTTGTTAGGTGTGATATGG + Intronic
1193194359 X:78612672-78612694 ATGTTGTTTTTGCTATTATAGGG + Intergenic
1195054620 X:101131599-101131621 AAGTGGTTTTAGCTATGATATGG + Intronic
1196146972 X:112328718-112328740 ATTTTGGTATAGGTGTGATGTGG - Intergenic
1196534742 X:116829855-116829877 ATGTTGTATTAGATGTGATGAGG - Intergenic
1196579722 X:117364449-117364471 GTGTTGTTTCAAGTGTGCTATGG - Intergenic
1199496530 X:148458557-148458579 TTGTTGTTTTTGCTGTGGTAAGG - Intergenic
1199714657 X:150498151-150498173 ATGCTGTTCTAGGTGTGGTCTGG - Intronic
1201701316 Y:16885116-16885138 GTGTTGTTTTTAGTGTGATTTGG + Intergenic