ID: 1119955517

View in Genome Browser
Species Human (GRCh38)
Location 14:78794458-78794480
Sequence TTTTAGTGAGTTATCTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119955515_1119955517 14 Left 1119955515 14:78794421-78794443 CCAGTTGTCTTATGTGTTTAATA 0: 1
1: 1
2: 3
3: 33
4: 279
Right 1119955517 14:78794458-78794480 TTTTAGTGAGTTATCTTGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119955517 Original CRISPR TTTTAGTGAGTTATCTTGGA AGG Intronic
900278004 1:1845374-1845396 TTTCACTGAGTTAGCTAGGATGG - Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
906590655 1:47021839-47021861 TTCTAATGAGTTCTCTTGGCAGG - Intergenic
908188039 1:61671355-61671377 TTTGAGTTAATTATCGTGGAGGG - Intergenic
908202454 1:61811687-61811709 TTTTAGTTATTTATCTAGTATGG + Intronic
913109538 1:115645112-115645134 TTTTAGTGGGTTTATTTGGAGGG - Intronic
914999189 1:152572711-152572733 TTTCTGTGAGCTATCTTGGGTGG + Intronic
916992092 1:170255297-170255319 TTTCACTGTGTTAGCTTGGATGG + Intergenic
917083359 1:171279956-171279978 TTGGAGTGAGATATCTGGGAAGG - Intronic
919343805 1:196349065-196349087 TTTTGATGAGACATCTTGGAAGG + Intronic
919888044 1:201949446-201949468 TTTTAGTTAGGTATGTTGGGTGG + Intergenic
921029289 1:211323551-211323573 ATGTAGTGAGTTAGCTTGCAGGG - Intergenic
922552983 1:226510711-226510733 TACAAGTGAGTCATCTTGGATGG + Intergenic
923379174 1:233397683-233397705 TTTTATTTATTTATTTTGGAGGG - Intergenic
1064562869 10:16609740-16609762 TTTTGGGGAGATATGTTGGATGG - Intronic
1065164566 10:22961739-22961761 ATTTTTTGAGTTATTTTGGAAGG + Intronic
1065172698 10:23047932-23047954 TTCTTTTGAGTTATCTTGGGAGG + Intergenic
1066201647 10:33147546-33147568 TTTGAAGGACTTATCTTGGATGG + Intergenic
1068372400 10:56134198-56134220 TTTCACTGTGTTATCTAGGATGG + Intergenic
1068853473 10:61771563-61771585 TTGTAGTAAGGTATCCTGGATGG + Intergenic
1072525135 10:96264573-96264595 ATTTAAAGAGTTATTTTGGAGGG + Intronic
1072883889 10:99256386-99256408 GTTTGGTGAGTCATCTTGTAGGG - Intergenic
1073548399 10:104373655-104373677 ATTCAGTGAGTTATGTTGTATGG + Intronic
1074816763 10:117147964-117147986 TTTTGCTGAGAGATCTTGGATGG - Intergenic
1074834104 10:117272683-117272705 TTTTAATGATTTATCTTGCTAGG - Intronic
1078590260 11:12634726-12634748 TGTGAGTGAGGTATTTTGGAAGG + Intergenic
1085058352 11:73421725-73421747 TTTTAGAGAGTTGTTTTGGGTGG - Intronic
1087938020 11:104058001-104058023 TTTGAGTTAATTATTTTGGATGG - Intronic
1088549395 11:110995978-110996000 TTTTAGAGGGTGACCTTGGAAGG - Intergenic
1088635344 11:111814764-111814786 TTTTAGAGAGTTATGTGGAATGG - Intronic
1088819101 11:113442027-113442049 TTTCAGTGCGTTATCTTTAAAGG - Intronic
1088934441 11:114384872-114384894 TATGAGTGAGCCATCTTGGAAGG + Intergenic
1089799151 11:121010138-121010160 TTTAAGTGTTTTATCATGGAAGG - Intergenic
1093102182 12:15040582-15040604 TTTTAGTGAGATATGCTGGGAGG + Intergenic
1094034404 12:26051974-26051996 TTTTTGTGAGTTTTGTTGGTGGG - Intronic
1095633149 12:44401252-44401274 TTTTAATTTGTTATCTTGGCTGG - Intergenic
1095828494 12:46556806-46556828 TTTGAGTGAGTCATTTTAGATGG - Intergenic
1095922589 12:47545655-47545677 TGTAAGTGACATATCTTGGAGGG - Intergenic
1097717740 12:62984116-62984138 TTTCACTGTGTTAGCTTGGATGG + Intergenic
1099616809 12:84946445-84946467 TTATAGTGATTTGTCTGGGATGG + Intergenic
1100056313 12:90515366-90515388 ATTTACTGAGATATATTGGAGGG + Intergenic
1100124880 12:91411982-91412004 TTTTTGTGTGTTTTTTTGGAAGG + Intergenic
1101249980 12:102923555-102923577 TTTTGGTAAGTTCTCATGGATGG - Intronic
1104542533 12:129680660-129680682 TTCTTGTCAGTTATCTGGGATGG - Intronic
1106154491 13:27140847-27140869 TTTTAGTGTGTCATTTTGGTTGG - Intronic
1106892219 13:34257981-34258003 TGTGAGAGAGTCATCTTGGAAGG - Intergenic
1112039790 13:95535464-95535486 TGTTCCTGAGTCATCTTGGATGG - Intronic
1112764920 13:102731065-102731087 TTTTACTGAGTGGTTTTGGAGGG + Exonic
1114056160 14:18968446-18968468 CTTTACTGAGTAATCTTAGAAGG + Intronic
1114855739 14:26440319-26440341 TTATAATGAATTATCTTGGTTGG + Intergenic
1114926958 14:27414495-27414517 TTTTAGAAATTTATCTTAGATGG + Intergenic
1114975710 14:28096621-28096643 TTGGAGTGAGTTGTCTAGGAAGG - Intergenic
1116258487 14:42588877-42588899 TTTCAGTGTGTTAGCTAGGATGG + Intergenic
1116885321 14:50215031-50215053 TTTCACTGTGTTATCTAGGATGG + Intronic
1117723701 14:58651827-58651849 TTTTAGTGAGGTATTATTGAAGG + Intergenic
1117964964 14:61197580-61197602 GTTTAATGAGTTATCATGGGAGG - Intronic
1119189168 14:72668260-72668282 GTTAAGTGAGTTAAGTTGGAGGG - Intronic
1119295876 14:73532755-73532777 TTTTACTGTGTTAGCTAGGATGG - Intronic
1119308891 14:73630252-73630274 TTGCAGTGAGCTAACTTGGAGGG - Intergenic
1119955517 14:78794458-78794480 TTTTAGTGAGTTATCTTGGAAGG + Intronic
1120024181 14:79563890-79563912 TCTTATTGACTTATCTTGGTAGG + Intronic
1120350802 14:83355424-83355446 ATTCAGTGAGGTATCTAGGATGG + Intergenic
1120876579 14:89381208-89381230 TTGTGGTGATTTATCTTAGAAGG - Intronic
1125083245 15:35700118-35700140 TTTTCATGAGTTTTCTGGGAAGG + Intergenic
1125264790 15:37866676-37866698 TTTTAGTGAGTTTTCCAAGAAGG + Intergenic
1126030150 15:44488957-44488979 TTTGATAGAGTTTTCTTGGAAGG + Intronic
1126481481 15:49126657-49126679 TTTAAGGTAGTTACCTTGGAAGG + Intronic
1126901026 15:53314339-53314361 TTTTCAGGAGTTGTCTTGGAAGG - Intergenic
1129288558 15:74545449-74545471 TCCTAATGAATTATCTTGGAGGG + Intronic
1131665959 15:94571372-94571394 TTTTAGTTAAATATCTGGGAAGG + Intergenic
1133211642 16:4266434-4266456 TTTAGGTGAGTTATATTTGAGGG - Intronic
1133437957 16:5796115-5796137 TTTTGGTGAGCTGTTTTGGAAGG + Intergenic
1134610737 16:15606063-15606085 TTTGAATGATTTATGTTGGATGG - Intronic
1136649792 16:31659209-31659231 TTTTGGTGATTGATCCTGGATGG - Intergenic
1137746595 16:50824956-50824978 ATTTAGTGATTTATCCTGCATGG - Intergenic
1139760296 16:69179452-69179474 GGTTAGTGATTTATCTTGGTGGG + Intronic
1140211600 16:72974909-72974931 GTGCAGTGAGTTATCTAGGAGGG - Intronic
1141338738 16:83182452-83182474 TTTCTGTGAGTTTTGTTGGATGG + Intronic
1142329047 16:89438627-89438649 TTTTAGAAAATTTTCTTGGATGG - Intronic
1145955566 17:28852168-28852190 TTTTACTGTGTTAGCCTGGATGG - Intronic
1147975085 17:44242770-44242792 GATTAGTGAGTTATCATGGGAGG + Intergenic
1148474056 17:47915603-47915625 TTTTAGTGAGGTCTGGTGGAAGG - Intronic
1148841410 17:50500359-50500381 TTTTACTGTGTTAACCTGGATGG - Intergenic
1149766068 17:59279614-59279636 TTTGAGTGAGTTATCAGGGAAGG - Intergenic
1153364650 18:4241984-4242006 TTATAGTCATTTATCTGGGATGG + Intronic
1155351316 18:24910123-24910145 TGTTAGTGAGTTATCTGGGATGG - Intergenic
1155394463 18:25372340-25372362 TTTTAGTGATTTATTTTGGGGGG - Intergenic
1155725318 18:29074183-29074205 TTTTAGTGACTTTTCCTGGCTGG - Intergenic
1155828386 18:30479652-30479674 TATTAGGGAGTGATCTTGGTTGG + Intergenic
1155831894 18:30526394-30526416 TTATATTGGGTTATCTTGGTGGG - Intergenic
1155982912 18:32199306-32199328 TTTTATTGATTTATCCTGGAAGG + Intronic
1157046862 18:44111196-44111218 TTTTTTACAGTTATCTTGGAAGG + Intergenic
1157218443 18:45806122-45806144 TATTAGCGACTTATCTGGGAGGG + Intergenic
1157833290 18:50877206-50877228 TTGTAGAGAGCTATCATGGAGGG - Intergenic
927966591 2:27273951-27273973 TTTTGGTGAGTGACCTTCGAAGG + Intronic
928806116 2:35157864-35157886 TTGTAGAGAGTGATGTTGGATGG - Intergenic
929527002 2:42713921-42713943 TTTTAGGGATCTATCTTGTAAGG - Intronic
931238034 2:60428374-60428396 TTTAAGTGAGTTATTCTTGAAGG - Intergenic
931277715 2:60758345-60758367 TTTTTTTGAGTCATTTTGGAAGG + Intronic
932543983 2:72688004-72688026 TTTTGGTGATTTTTTTTGGAGGG - Intronic
932657324 2:73621283-73621305 TTTAAGTGGGTTTTCTTGAATGG + Intergenic
933215646 2:79626815-79626837 GTGTGGTGGGTTATCTTGGAGGG + Intronic
935387495 2:102515454-102515476 TCTTAGTGACTTTTCTTTGAGGG + Intronic
939025833 2:137013001-137013023 TTTCATTGAGTTATCTTGACCGG - Intronic
940669736 2:156651951-156651973 TTTTGGAGAGTTATTTTGGCAGG + Intergenic
942310971 2:174656174-174656196 TTGTAGTGAGTTATCTGGTCAGG - Intronic
942810654 2:179996085-179996107 TTTTAGGCAGTTAACTTGGTTGG - Intronic
944096294 2:195972620-195972642 TTTTAGTGAGATGTTTGGGAGGG - Intronic
944406325 2:199388226-199388248 TCTTAGTGACTTATGTTGGAGGG - Intronic
944677326 2:202044574-202044596 TGTTAGTTAGATATCATGGAGGG + Intergenic
947550996 2:231046816-231046838 TGTGAGTGAGTTATCTAGGAAGG - Intronic
947874403 2:233458888-233458910 TTTGAAAGAGTTATCTTGGCCGG - Intronic
1169571257 20:6908590-6908612 TTTGAATGAGTTCTCTTGGTTGG + Intergenic
1170347161 20:15400041-15400063 TTATAGTGAATTTTCTTGGAGGG - Intronic
1173744321 20:45424987-45425009 ATTTACTGGGTTATCTAGGAAGG + Intronic
1174767600 20:53268652-53268674 TTTTAAAGATCTATCTTGGATGG + Intronic
1176134168 20:63512948-63512970 TTTTAGTGTCTTATCTAAGAAGG - Intergenic
1178083564 21:29090704-29090726 TTTTAGTGACTTTTTTTGCATGG + Intronic
1180474651 22:15691149-15691171 CTTTACTGAGTAATCTTAGAAGG + Intronic
950206032 3:11081853-11081875 GCTTAGTGAGTTTTCATGGATGG - Intergenic
950316655 3:12006720-12006742 TTTGAGTGAGTTCTCTTAAAAGG - Intronic
951042790 3:18006019-18006041 GTTTAGTGAGTTATGTAAGAAGG - Intronic
952941565 3:38449033-38449055 TTTCAGTGAGTGCACTTGGATGG + Intergenic
955565931 3:60246264-60246286 ATATAGAGAGTTATCTTTGAAGG + Intronic
956371976 3:68572573-68572595 TTCTTGTGAATTATCTTGTAGGG - Intergenic
957420274 3:79959014-79959036 TTTTAGTAAGTTATTTTTGGTGG - Intergenic
961604069 3:128080748-128080770 TTGTAATGGGTTATCCTGGATGG + Intronic
962087710 3:132209220-132209242 CTTTAAAGAGTTATATTGGAAGG + Intronic
965152692 3:165001338-165001360 TTTTATTGAATTATTTTTGAAGG + Intronic
966357848 3:179100849-179100871 ATGTGATGAGTTATCTTGGAAGG + Intergenic
970752805 4:19385129-19385151 TTGTAGTGAGTTATCATGTGAGG + Intergenic
970887214 4:21000371-21000393 TTTTAGTAAGATCTATTGGAAGG - Intronic
971218675 4:24685370-24685392 TTGCAGTGTGATATCTTGGAAGG - Intergenic
971975955 4:33687297-33687319 TTTTACTGAATTATCTTTCAAGG + Intergenic
972983624 4:44736418-44736440 TTTTACTGAATTGTATTGGAAGG - Intergenic
972990376 4:44816301-44816323 ATGTAATGTGTTATCTTGGATGG - Intergenic
972997686 4:44902360-44902382 TTTTTGAGAGTTATCATGGATGG + Intergenic
974600058 4:64067619-64067641 TGTTAGTAGGTTATCTTTGAGGG - Intergenic
974761986 4:66288914-66288936 TTAAAGTGAGTTGTCTTGCAAGG - Intergenic
975578895 4:75889478-75889500 TTTTATAGAGTTGTCTGGGAAGG - Intronic
977155138 4:93562341-93562363 TTTTGGTGAGGTATCTGGTAAGG + Intronic
977447276 4:97146819-97146841 TTTTACTGACTTATCTCGCAAGG + Intergenic
978421370 4:108536914-108536936 GTTTACTGAGCTACCTTGGAAGG - Intergenic
978527704 4:109682061-109682083 TTTTAGTGAGTTCTCTGGTTGGG + Intronic
979279577 4:118850363-118850385 TGTTAGTGATTTATCCTGGAGGG + Intergenic
979861238 4:125696315-125696337 TTTAACTGGGTTTTCTTGGAGGG - Intergenic
979926494 4:126572492-126572514 TTGTAATGTGCTATCTTGGATGG - Intergenic
980482198 4:133401402-133401424 TTTTAGTCAGTTATCTGAGCTGG - Intergenic
980885364 4:138756842-138756864 TATTAGTTAGTTTTATTGGATGG - Intergenic
980932310 4:139193713-139193735 ATTTAGTGATTTATCTGAGATGG + Intergenic
981854168 4:149267693-149267715 TTTTGGTTATTTATCTTAGAAGG - Intergenic
982946869 4:161635616-161635638 TTCTAATGAGTTAACTTGAATGG - Intronic
984074288 4:175154924-175154946 TTTAAATGTGTTATCTTGAAGGG + Intergenic
985297467 4:188450667-188450689 ATTCTGTGAGTTACCTTGGAAGG - Intergenic
987936374 5:24470627-24470649 TTTTTGAGAGTTATCTTAGATGG - Intergenic
987978512 5:25047453-25047475 TTTTAATGGGTTGTCTTTGATGG - Intergenic
989504476 5:42211009-42211031 TTTTAGGGTTTTATCATGGAGGG + Intergenic
990513283 5:56508864-56508886 TTTTTGGGATTTATTTTGGATGG - Intergenic
990611123 5:57457825-57457847 TTTTAATGAGGTATTTTGGAAGG - Intergenic
990641026 5:57783727-57783749 TTTTAATGAGTTTTTTTGGGGGG - Intergenic
992499519 5:77328113-77328135 TTATTCTGAGATATCTTGGAAGG - Intronic
993570757 5:89535943-89535965 TTTCAGAAAGTCATCTTGGAAGG + Intergenic
993988366 5:94624987-94625009 TTTCACTGTGTTATCTAGGATGG - Intronic
994451192 5:99946370-99946392 GTTTGGTAATTTATCTTGGAGGG - Intergenic
996328271 5:122300943-122300965 TTTTGGTGATTTATCTTAAAAGG + Intergenic
996338861 5:122414203-122414225 TTTTAATGACTTTTCTTGGCTGG - Intronic
996465202 5:123793175-123793197 TCTTAGTGAGTTTTCTTGTCGGG + Intergenic
997900699 5:137761323-137761345 TTTAAGTGTTTTATTTTGGAAGG - Intergenic
1000011975 5:157241572-157241594 TTTTAGTGATTTAAGTTAGATGG + Intronic
1004983217 6:21050163-21050185 TTTTAGGGAGATACCTTGAAAGG + Intronic
1005525191 6:26640586-26640608 TTTTTGTGAGTCAGCTGGGACGG - Intronic
1007560393 6:42803238-42803260 ATTAAGTGGATTATCTTGGAAGG + Intronic
1010359043 6:74971121-74971143 CTTTAGTATGTTATCCTGGAAGG - Intergenic
1010905213 6:81478827-81478849 TTTTAATGTATTATCTTGGCTGG + Intergenic
1011707489 6:90016761-90016783 TTTTTGAAAGTTATCTTTGAAGG + Intronic
1012148350 6:95714901-95714923 TGTTAGTGTATTATCTTTGAAGG - Intergenic
1012686831 6:102260903-102260925 TTTTAGGGTGTTATATTGGTAGG - Intergenic
1014631194 6:123792010-123792032 TTTTAGCAAGTTATCTCAGAAGG - Intergenic
1015043578 6:128751421-128751443 TTTTATTGGGTCATATTGGAAGG - Intergenic
1017137830 6:151163889-151163911 TTGTAGTGATTTTTTTTGGAGGG - Intergenic
1017249689 6:152265749-152265771 TTTTCCTTAGTAATCTTGGAAGG + Intronic
1017391966 6:153950038-153950060 TTTTTGTGGGTTTTCTTGGGGGG + Intergenic
1018068588 6:160141499-160141521 ATTTAGTGAGTCATTTTGGCAGG + Intronic
1021054035 7:16024821-16024843 TTTTAGTGAGTTCCATTGAAAGG - Intergenic
1021364337 7:19757618-19757640 GTTTAGTGAGATAGCTTGGCTGG + Intronic
1022665028 7:32402812-32402834 TTTTAGGCACTCATCTTGGAGGG - Intergenic
1023997165 7:45167152-45167174 TTTCAGTGTGTTAGCTAGGATGG + Intronic
1024449765 7:49525774-49525796 TTCTAGTGATTTATCTTAGATGG - Intergenic
1026482170 7:70788948-70788970 TTTTAGAGACCTGTCTTGGATGG - Intronic
1030484964 7:110153677-110153699 TTTTATTGAATAATCATGGAAGG - Intergenic
1030981578 7:116191173-116191195 GTTTAGTAAGTTTTCCTGGAAGG - Intergenic
1031041328 7:116841470-116841492 TTTTAGTGACTTAACTGGGAAGG + Intronic
1031593568 7:123622418-123622440 TCTTCATGAGTTAGCTTGGAAGG + Intronic
1033508150 7:142026714-142026736 TTTTATTGAGTTCTTTTGGGAGG + Intronic
1034256297 7:149726253-149726275 TTTTAGTGACTTGTCTTAGAAGG + Intronic
1035042067 7:155936194-155936216 TGTTAGTGAGTCATCTTGCTGGG + Intergenic
1036210726 8:6838464-6838486 TTTTTGTAAGTTATATTAGAAGG - Intergenic
1036984466 8:13511966-13511988 TTGTAGTGAGTTATATGGTATGG + Intronic
1040613694 8:49013071-49013093 TTTTAGTTTGTGAACTTGGAGGG + Intergenic
1043284595 8:78513997-78514019 ATTTAGTGTGGTATCCTGGATGG + Intergenic
1046183941 8:110689104-110689126 TTTTAGTTAGCTATCTTATAAGG - Intergenic
1047554885 8:125918648-125918670 TTTCACTGTGTTATCTAGGATGG - Intergenic
1048939072 8:139381173-139381195 TTCTAATGAGTTATTTTGTAGGG - Intergenic
1052240413 9:26265527-26265549 TGTGAGTGAGTAATCTTGGAAGG + Intergenic
1054868944 9:70031471-70031493 TCTGAGTGAGTTTTATTGGAGGG + Intergenic
1055981884 9:82011822-82011844 TTTTAGGGAGATATATTGGTAGG + Intergenic
1062665311 9:137667716-137667738 TTTTGGTGTGTTTTCTTGAAAGG + Intronic
1186441306 X:9589077-9589099 TTTCAGTGAGCTAACTTGGCTGG + Intronic
1186622110 X:11252414-11252436 ACTTTGTGAGTTATGTTGGAGGG + Intronic
1187417164 X:19103356-19103378 TATTCGTGAGTTTTCTGGGATGG - Intronic
1191592015 X:62896886-62896908 GTTTAGCAAGTTCTCTTGGAGGG + Intergenic
1194424613 X:93721256-93721278 TTTTGGTTTGTTATCTTTGAAGG + Intergenic
1195310449 X:103627311-103627333 TTTCAGTGAGATATCTTATAAGG + Intronic
1195997648 X:110747055-110747077 TTTTATTGTGTTATCATGGGGGG - Intronic
1201799319 Y:17937962-17937984 TTTTAGGCAGTTATTTTAGAAGG - Intergenic
1201802234 Y:17967994-17968016 TTTTAGGCAGTTATTTTAGAAGG + Intergenic
1202362223 Y:24122680-24122702 TTTTAGGCAGTTATTTTAGAAGG + Intergenic
1202362850 Y:24130416-24130438 TTTTAGGCAGTTATTTTAGAAGG - Intergenic
1202507928 Y:25539699-25539721 TTTTAGGCAGTTATTTTAGAAGG + Intergenic
1202508556 Y:25547435-25547457 TTTTAGGCAGTTATTTTAGAAGG - Intergenic