ID: 1119957055

View in Genome Browser
Species Human (GRCh38)
Location 14:78809710-78809732
Sequence CAACCTAAGGAGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119957044_1119957055 7 Left 1119957044 14:78809680-78809702 CCTATGCAAATTTCTATAGCATT 0: 1
1: 0
2: 1
3: 34
4: 378
Right 1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119957055 Original CRISPR CAACCTAAGGAGAGGGTGGA GGG Intronic
901215790 1:7554679-7554701 GACGCTAAGGAGAGGGTGGGAGG - Intronic
901434882 1:9241259-9241281 CAACCCAAGGTGGGGGTGGGGGG - Intronic
902700281 1:18167656-18167678 CAGCAGAAGGAAAGGGTGGACGG - Intronic
902777103 1:18682160-18682182 CAACTCAAGGAGAGGAGGGAGGG - Intronic
904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG + Intronic
904293609 1:29503615-29503637 CAAGTTCAGGAGAGGGAGGAGGG - Intergenic
906017293 1:42593226-42593248 AAACCCAAGGAGAGGGTTGTGGG - Intronic
908130954 1:61075130-61075152 CAACCTATTGTGAGAGTGGAAGG - Intronic
908701884 1:66911143-66911165 GAACCCAAGGAGAGGGTTGTGGG - Intronic
909030423 1:70533162-70533184 TACCTTAAGGGGAGGGTGGATGG + Intergenic
909980809 1:82098420-82098442 CGAACTGTGGAGAGGGTGGAGGG + Intergenic
910236126 1:85038141-85038163 CAGCCTAGGGAGTGGGTGGGAGG + Intronic
910354585 1:86340780-86340802 AAGCCTCAGGAGAGGGTGGTGGG - Intergenic
916392398 1:164344784-164344806 GAAGATAAAGAGAGGGTGGATGG - Intergenic
919801795 1:201358867-201358889 CTAGCTGGGGAGAGGGTGGAGGG - Intergenic
924063195 1:240197403-240197425 GAACCTGCGGAGGGGGTGGAGGG + Intronic
1063298745 10:4832851-4832873 CTACATAATGAGAGTGTGGAAGG + Intronic
1069549617 10:69353881-69353903 CAACCCAAGGAGGGGGTTGTAGG + Intronic
1075051274 10:119184017-119184039 CAACAAAAGGGGAGGGGGGAGGG + Intergenic
1075620508 10:123924355-123924377 GAACCTAAGGAGAGGGTCATGGG - Intronic
1076036489 10:127202534-127202556 GAACCTAAGGTGGGGATGGAGGG - Intronic
1076778886 10:132713293-132713315 CATCCTGAGGAAGGGGTGGAAGG + Intronic
1077182749 11:1223916-1223938 CAAGCTTGGGAGGGGGTGGAGGG - Intronic
1077491809 11:2864431-2864453 CACCCTGAGGGGAAGGTGGATGG - Intergenic
1077961938 11:7084775-7084797 AAACCCAAGGAGAGGGTTGTGGG + Intergenic
1078294714 11:10056724-10056746 AAACCTCAGGCGAGGGTGGCTGG - Intronic
1079249071 11:18773942-18773964 CAACGTAAGCAAAGGGTGAAGGG - Intronic
1079256459 11:18835263-18835285 TAACCTAAGGAGAGGCTTGGAGG - Intergenic
1079460277 11:20672218-20672240 TTACCTAAGAAGAGGGTGGATGG - Intronic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1083239638 11:61377931-61377953 GAACCCAAGGAGAGGGTTGTGGG + Intergenic
1083593746 11:63909479-63909501 CAAAGGAAGGGGAGGGTGGATGG + Exonic
1083922697 11:65788976-65788998 CAAACACAGGTGAGGGTGGAGGG - Intronic
1084039005 11:66530875-66530897 GAACCTATGGAGAGGGTGGGTGG - Exonic
1084738712 11:71123501-71123523 CATCATAAGGAGAGGGAGGGAGG + Intronic
1085837192 11:79969698-79969720 CAAATGAATGAGAGGGTGGAAGG + Intergenic
1086855485 11:91860520-91860542 CAACCTGAGGAGAGGGGAGGGGG - Intergenic
1088784026 11:113164519-113164541 GAACCTAAGGAGGGGGTTGTGGG - Intronic
1089157484 11:116413660-116413682 CAACATCAGGAGAGAGGGGAGGG + Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1091029177 11:132169041-132169063 CAAAAGAAGGAGGGGGTGGATGG - Intronic
1092053911 12:5493256-5493278 CAACAGAATGAGAGCGTGGATGG + Intronic
1094141155 12:27183067-27183089 GAACCTGAGGAGAGGGTTGTAGG + Intergenic
1095469890 12:42525380-42525402 AAACCCAAGGAGAGGGTCGAGGG + Intronic
1096527543 12:52220440-52220462 GAACCTAAGGAGCGGGTTGTGGG - Intergenic
1097698407 12:62796725-62796747 CAACCTCATGAGAGGGGAGAAGG - Intronic
1097873949 12:64626009-64626031 CAACCAAAGGAGGGGGAGGTTGG - Intronic
1098213054 12:68186342-68186364 AAAGTGAAGGAGAGGGTGGAGGG + Intergenic
1098825195 12:75287788-75287810 GAACCCAAGGAGGGGGTGGTGGG + Intronic
1099175971 12:79422569-79422591 CAGCCTAAGGAAATGGTGCAGGG + Intronic
1099595020 12:84650743-84650765 CAACATAAGCAGAGGGAGCAGGG - Intergenic
1099752212 12:86790370-86790392 GAACCTAAGGAGAAGAGGGAGGG + Intronic
1101631376 12:106498308-106498330 CAGCCCGAGGTGAGGGTGGAGGG + Intronic
1102151113 12:110689428-110689450 CAGCCTAAGGGAAGGGTGGGCGG + Intronic
1110146156 13:72192862-72192884 GAACCTATGAAGATGGTGGAGGG + Intergenic
1110460614 13:75740792-75740814 CAACTTAAGGAGGGTGTGGAGGG + Intronic
1114736523 14:25049167-25049189 AAACCTGAGGAAAGGTTGGAGGG + Intronic
1117908740 14:60616225-60616247 CAAACTAAGGAAGTGGTGGATGG - Intergenic
1119113140 14:71994531-71994553 CAACATATGGACTGGGTGGAGGG - Intronic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG + Intronic
1120917290 14:89721250-89721272 CAGCTTAAGGAGAGGGGAGAGGG - Intergenic
1121782193 14:96629103-96629125 CATCCTAAGGAGAGTGTGAGGGG + Intergenic
1121962042 14:98269898-98269920 TAAGCTATGGAGAGGGTAGAAGG + Intergenic
1122180802 14:99953240-99953262 TAACCTGGGGAGAAGGTGGAGGG - Intergenic
1122484661 14:102070719-102070741 CAAAATAAGCAGGGGGTGGAGGG + Intergenic
1122774583 14:104111617-104111639 CAGCCTTTGGAGAGGGTGCAGGG - Intronic
1123795085 15:23763143-23763165 CAGCCAAAGGGGAGGGTGGGGGG + Intergenic
1125927076 15:43571720-43571742 CCACCTCAGAAGAGGCTGGACGG + Exonic
1125940220 15:43671285-43671307 CCACCTCAGAAGAGGCTGGACGG + Intergenic
1126908127 15:53389397-53389419 CAGGCTGAGGAGAGAGTGGAAGG + Intergenic
1127388449 15:58486251-58486273 CAGCCTGAGGAGATGGGGGAGGG - Intronic
1127619228 15:60716978-60717000 GAACCCAAAGAGAGGGTGGTGGG + Intronic
1128158001 15:65403900-65403922 CGACCTAAGGAGGGGGTGAATGG + Intronic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129878384 15:78991927-78991949 GAATCTGATGAGAGGGTGGATGG + Intronic
1133028088 16:2997329-2997351 CTAGCTAAGGAGAGGGCGAAGGG - Intergenic
1134872780 16:17666871-17666893 CAACAGAAGGAGAGGGGGAAAGG - Intergenic
1135207265 16:20493907-20493929 CCACCTTGGGAGAGGCTGGAAGG + Intergenic
1135211620 16:20529725-20529747 CCACCTTGGGAGAGGCTGGAAGG - Intergenic
1136515551 16:30766144-30766166 CAAACTAAGGAGTGGGAGGCAGG - Exonic
1138309434 16:56010902-56010924 GCACCTACAGAGAGGGTGGATGG - Intergenic
1142033151 16:87848408-87848430 TTGCCTAAGGAGAGGGTGGCTGG - Intronic
1143227421 17:5318130-5318152 AAACCTAAGGAGATGGTTGTAGG + Intronic
1143246300 17:5488307-5488329 GAACAGAAAGAGAGGGTGGAGGG + Exonic
1145290001 17:21535394-21535416 CAACCAGAGGAGAGGCTGGCTGG + Exonic
1145323631 17:21781665-21781687 AAACCTTAGGAGAGGGTCGTGGG + Intergenic
1146578044 17:34012046-34012068 CAAAATAAGGGGAGGGAGGAAGG - Intronic
1147393093 17:40122151-40122173 CCTCCTCAGGAGGGGGTGGAGGG - Intergenic
1150302238 17:64056169-64056191 CAACCCTAGGAGGGGCTGGATGG + Intronic
1150843154 17:68628196-68628218 CACCCCAAGGAGAGGTTGGCAGG - Intergenic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1152260927 17:79266697-79266719 CAACCTCAGGAGAGGGGAGGGGG + Intronic
1153382003 18:4450813-4450835 AATCCTAGGGAGAGGGAGGAAGG + Intronic
1155096517 18:22560685-22560707 CAGCCAAAGGAGAAAGTGGAGGG - Intergenic
1155518085 18:26642869-26642891 CAACCTGCGGGGAGGGTGGGAGG + Intronic
1156334216 18:36153667-36153689 GAACCTAAAGAGGGGGTCGAGGG - Intronic
1157935950 18:51873614-51873636 CACCCTAAGGAGAGGGGAAAGGG - Intergenic
1158494287 18:57940183-57940205 CAACGTAAGGTGAAGGTGGATGG - Intergenic
1160032126 18:75271296-75271318 TATCCGAAGGAGAGGCTGGAGGG - Intronic
1160203056 18:76810894-76810916 ATAGCTAAGGAGAAGGTGGAAGG - Intronic
1163056229 19:14720427-14720449 CAAGCTAAGAAGAGGGTGGCCGG + Exonic
1163292960 19:16392589-16392611 GACCCTGAGGAGAGGGTGGAGGG + Intronic
1165561941 19:36687626-36687648 CAACCGAAGGTGAGGCTGGTGGG + Intronic
1166325870 19:42050866-42050888 CAAGCTCAGGAGAGGGAGGGAGG + Intronic
1167241898 19:48348872-48348894 CAACCTAAAGACAGTCTGGATGG - Intronic
1168287538 19:55342113-55342135 CAGGCTAAGGAGAGGGCCGAGGG - Intronic
925756675 2:7139395-7139417 CCACCTGTGGAGGGGGTGGAGGG + Intergenic
925900118 2:8503141-8503163 CAACCTAAAGAAAGTGTGGGTGG + Intergenic
927009561 2:18888769-18888791 CTACCTAGGGACAGGGTTGAAGG + Intergenic
930233373 2:48865307-48865329 CAGTCAAAGGAGAGGCTGGAGGG + Intergenic
932009422 2:67960391-67960413 CAAACTGAGGAGATGGTGTAGGG + Intergenic
932054321 2:68429508-68429530 CAACCTCTGGAGAGGGGAGAAGG + Intergenic
932331388 2:70900311-70900333 CAACTTTAGGAGGGGGTGTAGGG + Intergenic
932337982 2:70941930-70941952 AAGGCCAAGGAGAGGGTGGAAGG + Exonic
932953223 2:76318072-76318094 TCATCTAAGGTGAGGGTGGAAGG + Intergenic
935559840 2:104548611-104548633 TCACCTAAGGAGAAGGAGGAAGG - Intergenic
936175310 2:110214607-110214629 AAACCTAAGGAGGGGGTTGTTGG - Intergenic
936258458 2:110936602-110936624 GAACCTAAGGAGAGGGTCATGGG - Intronic
936280136 2:111131893-111131915 CAAACTAAGGACAGGATTGATGG + Intronic
936856623 2:116966060-116966082 CACCCTAAAGGCAGGGTGGAAGG - Intergenic
937854052 2:126660093-126660115 CAACCCAAGGAGAGAGTTGCAGG + Intronic
938297265 2:130185955-130185977 GAACCTGAGGAGGAGGTGGAGGG + Intronic
938459511 2:131488720-131488742 GAACCTGAGGAGGAGGTGGAGGG - Intronic
940037794 2:149329504-149329526 AAATCCAAGGAGAAGGTGGAGGG + Intergenic
942968347 2:181925408-181925430 CATGCTATGGAGAGGTTGGAAGG - Intronic
946312039 2:218887443-218887465 GAACCTAAGGGGAAGGAGGATGG - Intronic
946458946 2:219851987-219852009 CCACCTAAGGGGAGAGTTGAGGG + Intergenic
948366489 2:237458192-237458214 ACACCCATGGAGAGGGTGGAGGG - Intergenic
948469459 2:238167820-238167842 CCACCTCTGGAGAGGGTGGAAGG - Intronic
948510086 2:238458268-238458290 CACCCTGAGGAGAGAGTGGTTGG + Intergenic
948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG + Intronic
1169633199 20:7656994-7657016 CATTCTAGGGAGAGGGGGGAGGG + Intergenic
1169712441 20:8580056-8580078 CAGCCTAATGAGAAGGTGGTGGG + Intronic
1169963326 20:11187431-11187453 CAACCCAAAGAGAGGGTTGTGGG - Intergenic
1170462065 20:16586677-16586699 CAGCCAAAGGAGAAGGTGAAGGG + Intergenic
1170662727 20:18358691-18358713 CATCCCAAGGAGAGGAAGGAGGG - Intergenic
1172307747 20:33893428-33893450 CATCCTAAGTGGAGGCTGGAGGG + Intergenic
1179418697 21:41218612-41218634 TAACCTATGGAGAGGTTGGTGGG + Intronic
1181182373 22:21077346-21077368 AAACCTGGGGAGAAGGTGGAGGG - Intergenic
1181553418 22:23653843-23653865 CACCCCAAGGAGATGGTGGCAGG + Intergenic
1181744055 22:24943399-24943421 CCACCTAAGGAGAGCTTGAAAGG + Intronic
1182831412 22:33307536-33307558 GAACCTGAGGAGAGGGCCGAGGG - Intronic
949140221 3:623794-623816 CAACCAAAGGAGACGGTGAAGGG + Intergenic
949777964 3:7653111-7653133 CAGGCTAAGGAGATGCTGGAGGG - Intronic
950252979 3:11482339-11482361 CAACCTAAGGGAAAGGTGGTGGG - Intronic
950439908 3:13004533-13004555 TAATCCAAGGAGAGGGAGGAGGG - Intronic
950631789 3:14286849-14286871 TAACCAAAGGAGAGAGTGGAAGG + Intergenic
950631793 3:14286874-14286896 GAACCAAAGGAGAGAGTGGAAGG + Intergenic
950791199 3:15473824-15473846 CACCCTGGGGAGAGGGTGGCAGG - Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952511147 3:34057404-34057426 CAAACCAAGGAGAGGATGCACGG - Intergenic
953100487 3:39820931-39820953 CAACCCAAGCAGAAAGTGGATGG - Intronic
955008573 3:54992669-54992691 CACCCTAAGGGGAGGATGCAGGG - Intronic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
956106534 3:65824662-65824684 CAACTTAAGGAGGGAATGGAGGG - Intronic
956977398 3:74597075-74597097 CAACTTAATGAGAGGGGGGAAGG + Intergenic
960333240 3:116388287-116388309 CACCCAAAGGAAAAGGTGGAGGG + Intronic
961478384 3:127163325-127163347 CAGGCTTTGGAGAGGGTGGAAGG + Intergenic
964741917 3:159975306-159975328 GAACCCAAGGAGGGGGTGAAGGG + Intergenic
968657071 4:1783324-1783346 CATCCTTAGGAGAGGGTGTGTGG + Intergenic
968782644 4:2594617-2594639 AACCCTGAGGAGAGGCTGGAGGG - Intronic
973084090 4:46032571-46032593 CAACCTAAGCAGAGGCCAGATGG - Intergenic
973824480 4:54691548-54691570 CAGCCTAAGGAGAGGCAGGTTGG + Intronic
976437562 4:85035434-85035456 AAAGCTAAGGAAAGGGAGGAAGG - Intergenic
977694434 4:99950404-99950426 CAAGCGAAGAAAAGGGTGGAGGG + Intergenic
980077245 4:128306763-128306785 CAACCACAGGAGAGGGTGTTTGG + Intergenic
981950122 4:150396189-150396211 CAACTCAAGGAGTGGGTGGAGGG - Intronic
983129271 4:163995168-163995190 GAACCTAAGGAGGGGGTTGTGGG - Intronic
983144977 4:164202250-164202272 TAAGCTAAGGAGATGGTGGAGGG + Intronic
983633108 4:169870110-169870132 CAACCTTGGAAGAGGGAGGAAGG + Intergenic
985043553 4:185916989-185917011 CAACCTCATGGGAGGGTAGAGGG + Intronic
985723624 5:1503862-1503884 GAACCCAAGGAGAGTGTGGCGGG - Intronic
989003106 5:36782101-36782123 AAAACCAAAGAGAGGGTGGAGGG + Intergenic
989381140 5:40810545-40810567 CAACCTCTGGAGAGGGGAGAGGG - Intergenic
990605628 5:57407006-57407028 AGACCTAAGAAGAGGCTGGAGGG - Intergenic
990985765 5:61639470-61639492 CTACCCAAGGAGAGTGTAGATGG - Intronic
992102274 5:73419308-73419330 CACCCTTAGGAGGGGGTGGCAGG - Intergenic
992129267 5:73675028-73675050 AAACCCAAGGAGAGGGTTGTGGG + Intronic
992446158 5:76835841-76835863 CAACCTAAGGAGCCGTTGGTAGG - Intergenic
994337555 5:98585951-98585973 CTACCTACGAAGGGGGTGGAAGG + Intergenic
997820720 5:137063294-137063316 GAACCTGAAGAGATGGTGGAAGG - Intronic
998359653 5:141573875-141573897 CAGGCAAAGGAGGGGGTGGAGGG + Exonic
998498855 5:142614583-142614605 CAACGCAACGTGAGGGTGGAGGG - Intronic
1001134364 5:169090215-169090237 AAACCAAAGAAGAGGGTGAAGGG + Intronic
1001933464 5:175688801-175688823 CAAGCTCAGGAGAGGCTGGGAGG + Intergenic
1001945039 5:175771784-175771806 GAACCCAAGGAGGGGGTTGAGGG - Intergenic
1001972443 5:175967658-175967680 GAAGGTGAGGAGAGGGTGGATGG - Intronic
1002244996 5:177876122-177876144 GAAGGTGAGGAGAGGGTGGATGG + Intergenic
1002390823 5:178910388-178910410 CATCCTCAGGAGATGGTGGGAGG - Intronic
1002544062 5:179926714-179926736 AAACCTAAGGAGGGGGCGGTGGG + Intronic
1003751922 6:9068610-9068632 CAAGCCAAGGAGAGGGTTGCAGG - Intergenic
1006135010 6:31889747-31889769 CCACATAAAGAGAGGGTGCATGG + Intronic
1006303921 6:33207969-33207991 GAGCCAAAGCAGAGGGTGGAGGG + Intergenic
1006717998 6:36132272-36132294 AAGCATAAGGGGAGGGTGGAAGG - Intronic
1006921124 6:37627857-37627879 CAAAAGAAGGAGAGGGTGAAAGG + Intergenic
1007076965 6:39074269-39074291 CCAGCCAAGGAAAGGGTGGACGG + Intronic
1007695833 6:43733915-43733937 CACCCCAAGGACAGGGTGGAGGG - Intergenic
1007801434 6:44397097-44397119 CAACCTCAGGGGAGGGGAGAAGG - Intronic
1009037770 6:58138729-58138751 CCACGTAAGGAGATGGAGGAGGG + Intergenic
1009213557 6:60892367-60892389 CCACGTAAGGAGATGGAGGAGGG + Intergenic
1009530033 6:64801929-64801951 CAACCTAATCAGAGTGTGGCAGG - Intronic
1012442010 6:99269696-99269718 CAACTTCAGGGGAGGATGGAAGG + Intergenic
1012630753 6:101464252-101464274 CAGCCTAAGGAGAGGGTCCATGG + Intronic
1012860799 6:104556755-104556777 AAACCCAAGGAGAGGGTTGTGGG + Intergenic
1015499869 6:133920901-133920923 CCACCTGAGGAGACGATGGATGG + Intergenic
1015523868 6:134157751-134157773 ACACCTATGGAGAGGGCGGAAGG - Intergenic
1016083921 6:139888911-139888933 CAACATGGGGTGAGGGTGGAGGG + Intergenic
1017027787 6:150197044-150197066 GAGCCTGAGGGGAGGGTGGAAGG - Intronic
1017242620 6:152187678-152187700 CAAGCTAAGGCTAGTGTGGATGG - Intronic
1017289014 6:152712998-152713020 CAAACAGAGGAAAGGGTGGATGG - Intronic
1018298701 6:162377086-162377108 CATCCTAAGAGGATGGTGGAGGG + Intronic
1019226356 6:170513322-170513344 AAAGCTAGGGAGAGAGTGGAAGG + Intergenic
1019459922 7:1152341-1152363 GCACCTACAGAGAGGGTGGATGG + Intronic
1020224538 7:6269752-6269774 CAAGATAAGGAGAGAGAGGATGG - Intronic
1020785463 7:12568022-12568044 CAACCTCAAGGGAAGGTGGAAGG + Intergenic
1024156020 7:46626364-46626386 CAACCCAAGGAGAGAGAGGATGG + Intergenic
1026450305 7:70523524-70523546 CCACCTAGGGAGAGGGAGAATGG - Intronic
1028016349 7:85719008-85719030 TTAGCCAAGGAGAGGGTGGAAGG + Intergenic
1028333368 7:89623348-89623370 CACCCTAAGGAAAGGGGGAAAGG + Intergenic
1028610518 7:92705501-92705523 AAACCTAAGTAGAGAGTGAAAGG + Intronic
1028826777 7:95282596-95282618 CAGCCTCTGGGGAGGGTGGAGGG - Intronic
1031573610 7:123388866-123388888 CAACCTCTGGAGTGAGTGGATGG + Intergenic
1031834542 7:126667604-126667626 AAAGCTGAGGAGAAGGTGGAAGG + Intronic
1032427480 7:131833273-131833295 GAGCCCAAGAAGAGGGTGGAGGG + Intergenic
1033319755 7:140328680-140328702 CAATTTAAGGAGAGGCTGCATGG + Intronic
1033594559 7:142848242-142848264 CAACCCAAGGAGAGACAGGAAGG - Intergenic
1034482445 7:151332936-151332958 AAACCTAAGGAGGGGGTTGTGGG + Intergenic
1036559224 8:9887516-9887538 CCACCTCAGGAGAAGGTGTAAGG - Intergenic
1038317928 8:26503340-26503362 CCAGCTCAGGAGAGGCTGGAAGG - Intronic
1039103896 8:33970066-33970088 TTGCCTGAGGAGAGGGTGGATGG + Intergenic
1040048579 8:42989119-42989141 CAATATTAGAAGAGGGTGGAGGG + Intronic
1042696159 8:71556898-71556920 CCACCTGCGGAGAGGGTGCAGGG + Intronic
1044580007 8:93815758-93815780 TAACGTCTGGAGAGGGTGGATGG - Intronic
1045620947 8:103977742-103977764 CAAACTAAGGAGAGGGGCTATGG - Intronic
1046962032 8:120122911-120122933 AAACTTAAGGAGAGGAAGGAAGG + Intronic
1048189835 8:132277909-132277931 GAAGCTAAGGAGAGGGAGGTAGG - Intronic
1049212938 8:141395043-141395065 GAGCCTGAGCAGAGGGTGGAGGG + Intronic
1049415251 8:142492072-142492094 CAGACAGAGGAGAGGGTGGATGG - Intronic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1052033694 9:23657001-23657023 CAGCCTAAGGGCAGGGTTGAGGG + Intergenic
1053157333 9:35790794-35790816 GAACCCCAGGAGAGCGTGGATGG + Intergenic
1055649969 9:78397569-78397591 CAACCTAACACGAGTGTGGAGGG + Intergenic
1058439407 9:104993269-104993291 CAACCTATGAACTGGGTGGAAGG + Intergenic
1058770282 9:108224416-108224438 AGACCTCAGGAGAGTGTGGAAGG - Intergenic
1058969147 9:110064205-110064227 CTACCTAAGGAGGAGGAGGAAGG + Intronic
1059473152 9:114522553-114522575 CAAGCAAAGGAGAGGGGAGAAGG - Intergenic
1059775253 9:117468145-117468167 CAATCTAAGGAGTTGGTTGATGG + Intergenic
1061799655 9:133106908-133106930 CAACCCAAGGAAAGAGTGTAAGG + Intronic
1185513430 X:679417-679439 CTACCCAAGGAGAGGGGGGCCGG - Intergenic
1187110294 X:16291810-16291832 CAACCTTGGGAGAAGGAGGAAGG - Intergenic
1187606249 X:20886276-20886298 CATCCAAAGGAGGGGATGGAAGG + Intergenic
1188852307 X:35146884-35146906 CAACACAAAGAGAGGTTGGAAGG + Intergenic
1190076711 X:47322366-47322388 CAGCCTGAGGAGAGTGTGTAGGG - Intergenic
1191618605 X:63192656-63192678 CAGCCCACGGAGAGGGTGGGAGG + Intergenic
1195748249 X:108139445-108139467 CAACCTAAAGAGAGGAAGAAGGG - Intronic
1196300625 X:114046803-114046825 GAACCTGAGGAGGGGGTGGTGGG + Intergenic
1196364921 X:114913339-114913361 AAACCTAAGGAGAGAGTTGTGGG - Intergenic
1196586077 X:117429499-117429521 CATACTAAGGAGATGGTGTATGG + Intergenic
1199050202 X:143228776-143228798 GAACCCACGGAGGGGGTGGAAGG + Intergenic
1199074159 X:143510807-143510829 GATCCGAAGGAGAAGGTGGAGGG - Intronic
1199093153 X:143714068-143714090 GATCCGAAGGAGAAGGTGGAGGG - Intronic
1199215182 X:145254092-145254114 GATCCGAAGGAGAAGGTGGAGGG + Intronic
1199854560 X:151749964-151749986 GAACCTCAGGAAAGGGTGGTGGG + Intergenic