ID: 1119958272

View in Genome Browser
Species Human (GRCh38)
Location 14:78824269-78824291
Sequence GGGTACTCCTTGGCCAATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 142}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119958263_1119958272 19 Left 1119958263 14:78824227-78824249 CCTGCCCATCATGGCTGGAAACT 0: 1
1: 2
2: 17
3: 62
4: 247
Right 1119958272 14:78824269-78824291 GGGTACTCCTTGGCCAATAGGGG 0: 1
1: 0
2: 3
3: 25
4: 142
1119958265_1119958272 14 Left 1119958265 14:78824232-78824254 CCATCATGGCTGGAAACTTAGTT 0: 1
1: 3
2: 27
3: 73
4: 280
Right 1119958272 14:78824269-78824291 GGGTACTCCTTGGCCAATAGGGG 0: 1
1: 0
2: 3
3: 25
4: 142
1119958259_1119958272 24 Left 1119958259 14:78824222-78824244 CCCTCCCTGCCCATCATGGCTGG 0: 1
1: 0
2: 8
3: 56
4: 410
Right 1119958272 14:78824269-78824291 GGGTACTCCTTGGCCAATAGGGG 0: 1
1: 0
2: 3
3: 25
4: 142
1119958264_1119958272 15 Left 1119958264 14:78824231-78824253 CCCATCATGGCTGGAAACTTAGT 0: 1
1: 3
2: 20
3: 82
4: 254
Right 1119958272 14:78824269-78824291 GGGTACTCCTTGGCCAATAGGGG 0: 1
1: 0
2: 3
3: 25
4: 142
1119958262_1119958272 20 Left 1119958262 14:78824226-78824248 CCCTGCCCATCATGGCTGGAAAC 0: 1
1: 0
2: 9
3: 48
4: 249
Right 1119958272 14:78824269-78824291 GGGTACTCCTTGGCCAATAGGGG 0: 1
1: 0
2: 3
3: 25
4: 142
1119958261_1119958272 23 Left 1119958261 14:78824223-78824245 CCTCCCTGCCCATCATGGCTGGA 0: 1
1: 0
2: 14
3: 93
4: 580
Right 1119958272 14:78824269-78824291 GGGTACTCCTTGGCCAATAGGGG 0: 1
1: 0
2: 3
3: 25
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119958272 Original CRISPR GGGTACTCCTTGGCCAATAG GGG Intronic
906206489 1:43990189-43990211 GGGGTCCCCTTGGCCAAAAGGGG + Intronic
912014725 1:105018428-105018450 GTGGTCTCCTTGGCCAAGAGGGG - Intergenic
915059461 1:153169023-153169045 GGGGCCCCCTTGGCCAAGAGCGG - Intergenic
919740182 1:200976696-200976718 GGGTACTCCCAGGGCAACAGAGG + Intronic
920280951 1:204843218-204843240 GAGTAGTCCTTGGCCTATATTGG - Intronic
920285680 1:204877606-204877628 GGGGTCCCCTTGGCCAAGAGGGG + Intronic
920918706 1:210279946-210279968 GGGGTCCCCTTGGCCAAGAGGGG + Intergenic
921901709 1:220457943-220457965 GGGATCTCATTGGCCAAGAGGGG + Intergenic
923324297 1:232867253-232867275 GGGGTCCCCTTGGCCAAGAGAGG + Intergenic
1063278883 10:4602611-4602633 GGGGTCTCCTTGGCCAAGAGGGG - Intergenic
1065248820 10:23788341-23788363 GAGAACTCCTTGGCAAATAAAGG - Intronic
1066745959 10:38604355-38604377 TGGTACTCCCTGGCCAGGAGAGG - Intergenic
1070048023 10:72858619-72858641 GGGGTCCCCTTGGCCAAGAGGGG + Intronic
1070826684 10:79394322-79394344 GGGAACTCCTGGGCCAACATGGG - Exonic
1073128065 10:101164645-101164667 GGGGTCCCCTTGGCCAACAGGGG + Intergenic
1074591323 10:114816503-114816525 GGGCAATTCTTAGCCAATAGGGG - Intergenic
1077529315 11:3087779-3087801 GGGGACTCCTGGGCCACTCGGGG + Exonic
1078326248 11:10383568-10383590 GGGTACTCCTTCTCCAATGCTGG + Intronic
1079002199 11:16767379-16767401 GGGGACCCCTTGGTCAAAAGGGG + Intergenic
1079471058 11:20777930-20777952 TGGTACCCCTTGGCCAATCAGGG + Intronic
1079726492 11:23886342-23886364 GGGACCCCCTTGGCCAAGAGGGG - Intergenic
1084365440 11:68694514-68694536 GGGGTCTCCTTGGCCAAGAGAGG - Intergenic
1084877813 11:72146522-72146544 GGGGTCTCCTTGGCCAAGAGGGG - Intergenic
1084883113 11:72186178-72186200 GGGGTCTCCTTGGCCAAGATGGG - Intergenic
1085496014 11:76970228-76970250 GGGGTCCCCTTGGCCAAGAGGGG + Intronic
1088194312 11:107258363-107258385 GGGTTCTCCTTGGCCAGGAGAGG + Intergenic
1092374680 12:7945446-7945468 ATGTACTCCTTGGCCAAGTGTGG - Intergenic
1094285146 12:28784177-28784199 GGGGTCCCCTTGGCCAAGAGGGG - Intergenic
1094351417 12:29530174-29530196 GGGGTCTCCTTGGCCAGGAGGGG - Intronic
1096215369 12:49795341-49795363 GGGGACTCCTTGGTGACTAGCGG + Exonic
1096792025 12:54051448-54051470 GGCTACTGCTTGGTTAATAGTGG - Intronic
1098546877 12:71721397-71721419 GGGTTCTCCTTGGCCAAGAGGGG - Intergenic
1099865826 12:88279458-88279480 GGGTTCTCCTTGGCCAACAGGGG - Intergenic
1102444428 12:112990914-112990936 GGGTTCCCCTTGGCCAAGAGAGG + Intronic
1103257474 12:119554456-119554478 GGGGTCTCTTTGGCCAAGAGGGG - Intergenic
1104408363 12:128537456-128537478 GGCATCTCCTTGGCCAAGAGAGG + Intronic
1107380812 13:39855091-39855113 GGGGTCTTCTTGGCCAAGAGGGG - Intergenic
1108920105 13:55662326-55662348 GGGGTCTCCTTGGCCAAAAAGGG + Intergenic
1112608359 13:100930197-100930219 GGGGTCCCCTTGGCCAAGAGAGG + Intergenic
1113922806 13:113923580-113923602 GGGGTCCCCTTGGCCAAGAGCGG + Intergenic
1115316440 14:32029685-32029707 GGGCAACCCTTGGCCAAAAGAGG - Intergenic
1115573500 14:34689164-34689186 GTATAATCCTTGGCCAATAATGG - Intergenic
1118464774 14:66021087-66021109 GGAATCTCCTTGGCCAAGAGAGG + Intergenic
1119752919 14:77093121-77093143 GGGGACTGCTTGGCCAAGAGGGG + Intergenic
1119958272 14:78824269-78824291 GGGTACTCCTTGGCCAATAGGGG + Intronic
1120402634 14:84051307-84051329 GGGTGCTTCTTGACCAATGGTGG - Intergenic
1123136257 14:106030351-106030373 GGTGCCTCCTTGGCCAAGAGGGG - Intergenic
1123974100 15:25536216-25536238 GGGGTCCCCTTGGCCAAGAGGGG + Intergenic
1124392591 15:29273090-29273112 GGGGTCCCCTTGGCCAAGAGGGG + Intronic
1126846290 15:52763445-52763467 GGGGACTGCTTTGCCTATAGTGG + Intronic
1131410080 15:92200289-92200311 GGGGTCCCCTTGGCCAAGAGGGG + Intergenic
1131453679 15:92566522-92566544 GGGGTCCCCTTGGCCAACAGGGG - Intergenic
1134299158 16:12974236-12974258 GGCCACTCCTTGGCCAGGAGAGG + Intronic
1140048573 16:71459245-71459267 GGGACCCCCTTGACCAATAGGGG + Intronic
1143995393 17:11002364-11002386 GGGGTCTCCTTGGCCAAGAGGGG - Intergenic
1144407265 17:14964219-14964241 GGGGTCACCTTGGCCAAGAGGGG + Intergenic
1146765746 17:35519846-35519868 GGGGTCCCCTTGGCCAAGAGAGG - Intronic
1147245812 17:39119899-39119921 GGGGTCTCATTGGCCAAGAGGGG - Intronic
1149036004 17:52135096-52135118 GGGGTCCCCTTGGCCAATAGAGG - Intronic
1152792756 17:82290976-82290998 TGGGACCCCTTGGCCAAGAGGGG + Intergenic
1152822950 17:82446422-82446444 GGGAATTCCTTGGCCAAGAACGG + Intronic
1152824734 17:82457715-82457737 GGGATCTCCTTAGCCAGTAGGGG + Intergenic
1153787989 18:8551918-8551940 GGGGTCCCCTTGGCCAAGAGGGG - Intergenic
1154291637 18:13113205-13113227 TGGTACTGCTTGGCCAGCAGAGG + Intronic
1154318846 18:13327932-13327954 GGGTGCCCCTTGGCCAAGAGGGG - Intronic
1158726792 18:59980880-59980902 GGGGTCTCCTTGGCCAAGAGGGG + Intergenic
1158726799 18:59980900-59980922 GGGGTCCCCTTGGCCAAGAGGGG + Intergenic
1158726808 18:59980920-59980942 GGGGTCCCCTTGGCCAAGAGGGG + Intergenic
1159920778 18:74225696-74225718 GGGGTCCCCTTGGCCAAGAGGGG + Intergenic
1164561435 19:29295014-29295036 GGGGTCCCCTTGGCCAAGAGGGG - Intergenic
1164625842 19:29727364-29727386 GGGGTCCCCTTGGCCAAGAGGGG - Intergenic
1165133720 19:33650262-33650284 GGGTTCCTCTTGGCCAAGAGGGG + Intronic
1165286829 19:34849664-34849686 GGGGTCACCTTGGCCAAGAGGGG + Intergenic
1165909311 19:39214904-39214926 GGGACCACCTTGGCCAATATAGG - Intergenic
1167718746 19:51162700-51162722 GGGGTCCCCTTGGCCAAGAGGGG + Intergenic
925119198 2:1404260-1404282 GTGTTCTCCTTAGCCAATTGTGG + Intronic
925268429 2:2583716-2583738 GGGATCTCCTTGGCTAAGAGGGG - Intergenic
925711793 2:6748271-6748293 GGGGTCCCCTTGGCAAATAGGGG - Intergenic
927950376 2:27164239-27164261 GGGGTCCCCTTGGCCAATAGGGG - Intergenic
928113034 2:28525734-28525756 GGCTACTCCATGGCCACTTGAGG + Intronic
929991602 2:46794104-46794126 GGGGTCTCTTTGGCCAAAAGGGG + Intergenic
930090385 2:47527506-47527528 GGGTACTCATTGGCCTCTTGAGG + Intronic
931284852 2:60823424-60823446 GGGTTCCCCTTGACCAAGAGTGG + Intergenic
933177539 2:79192221-79192243 GGGGTCTCCTTGGCCAAAAGGGG + Intronic
934188241 2:89764407-89764429 TGGTACTCCCTGGCCAGGAGAGG + Intergenic
934308362 2:91843547-91843569 TGGTACTCCCTGGCCAGGAGAGG - Intergenic
937231494 2:120400649-120400671 GGGTATTCTGAGGCCAATAGAGG - Intergenic
940003217 2:148987642-148987664 GGGGTCTCCTTGGCCACGAGGGG + Intronic
943551089 2:189340165-189340187 GGGTTCCCCTTGGCCACAAGTGG + Intergenic
944646456 2:201785431-201785453 GGGGTCCCCTTGGCCAAAAGAGG + Intergenic
945968415 2:216212584-216212606 GGGGTCCCCTTGGCCAAGAGGGG + Intergenic
1171136755 20:22701573-22701595 TGGCACCCCTTGGCCCATAGAGG + Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173997290 20:47348214-47348236 GGGTTCTCATTGGCCCACAGGGG - Intronic
1174416039 20:50367919-50367941 AGGGACTCCCTGGCCAATCGCGG - Intergenic
1179173243 21:38989363-38989385 GGGGTCCCCTTGGCCAAGAGGGG + Intergenic
1180535450 22:16390627-16390649 TGGTACTCCCTGGCCAGGAGAGG - Intergenic
1183289604 22:36991640-36991662 GGGTACTCCATGGCTTATATTGG + Intronic
1184918332 22:47588522-47588544 GGGGACTCCTTGGCCAAGAGGGG - Intergenic
1185076435 22:48685687-48685709 GGGCTCTCCTTGGCCTATGGGGG + Intronic
949909139 3:8886373-8886395 TGGGTCCCCTTGGCCAATAGGGG + Intronic
949966532 3:9361557-9361579 AGGGTCTCCTTGGCCAAGAGAGG - Intronic
952213986 3:31257232-31257254 AGCTTCTCCTTGGCCAAAAGTGG - Intergenic
952628734 3:35439529-35439551 GGGCTCCCCTTGGCCAACAGGGG + Intergenic
955132376 3:56183657-56183679 GTGTCCTACCTGGCCAATAGTGG - Intronic
955405840 3:58625167-58625189 GGGGTCTCCTTGGCCAAGAGGGG - Intronic
958471312 3:94524162-94524184 AGGTACTCCTTGGCCACAGGTGG - Intergenic
960298662 3:115974915-115974937 GGGGTCCCCTTGGCCAAGAGGGG + Intronic
960725155 3:120662635-120662657 AGGAACTCCTTGAGCAATAGAGG - Intronic
960845338 3:121999698-121999720 GGGGTCCCCTTGGCCAAGAGGGG - Intronic
963877241 3:150490280-150490302 GGGGTCCCCTTGGCCAAAAGGGG - Intergenic
964575965 3:158168910-158168932 GGGGTCCCCTTGGCCAAAAGGGG - Intronic
964854990 3:161137134-161137156 GGGATCCCCTTGGCCAAGAGTGG + Intronic
965557497 3:170033344-170033366 GGGGTCCCCTTGGCCAAGAGAGG + Intergenic
971107379 4:23541874-23541896 AGGTACTCTCTGGCCAACAGAGG + Intergenic
974027285 4:56744843-56744865 GGGGTCCCCTTGGCCAAGAGGGG - Intergenic
975206253 4:71646975-71646997 GGGTTCCCCTTGTCCAAAAGGGG + Intergenic
976885430 4:89978017-89978039 GGGGTCTCCTTGGCCAAGAGGGG - Intergenic
978911634 4:114070458-114070480 AGGTACAACTTGGCCAAAAGTGG + Intergenic
983411368 4:167402782-167402804 GGGGTCCCCTTGGCCAAAAGGGG - Intergenic
984240895 4:177218289-177218311 TGGGTCTCCTTGGCCAAGAGGGG - Intergenic
987144958 5:14982911-14982933 TGGGACCCCTTGGCCAAGAGAGG - Intergenic
989589189 5:43097581-43097603 GGGGTCCCCTTGGCCAATAGAGG - Intronic
991207783 5:64069313-64069335 GGGGTCCCCTTGGCCAAGAGAGG - Intergenic
992114820 5:73529924-73529946 GGGGTCCCCTTGGCCAAGAGGGG - Intergenic
993021547 5:82597617-82597639 GTGTACTCCTTCACCACTAGAGG + Intergenic
995795132 5:115933093-115933115 GGTGACTCCTTGGCCATCAGTGG - Intergenic
1004311840 6:14552984-14553006 GGGTAGACCTTGGTCAATACAGG + Intergenic
1004474663 6:15960091-15960113 GGGATCCCCTTGGCCCATAGGGG - Intergenic
1004604999 6:17185714-17185736 GGGGTATCCTTGGCCAAGAGTGG - Intergenic
1005981763 6:30842010-30842032 GGGGTCCCCTTGGCCAAGAGGGG - Intergenic
1006420860 6:33933072-33933094 GGGGTCCCCTTGGCCAAGAGGGG - Intergenic
1007144862 6:39618393-39618415 GGGGTCCCCGTGGCCAATAGGGG - Intronic
1008104100 6:47424439-47424461 GGGTTCTTCTTGGCCAAGAGAGG - Intergenic
1009645714 6:66398367-66398389 GGCTCCTCTTTGGCCAATAATGG + Intergenic
1011253235 6:85394829-85394851 GGGGTCTCCTTGGCTAAGAGGGG + Intergenic
1011509990 6:88089767-88089789 GGGGTCTACTTGGCCAAGAGAGG - Intergenic
1011630794 6:89321998-89322020 GGGGTCACCTTGGCCAAGAGGGG + Intergenic
1014549772 6:122777374-122777396 GGGCATCCCTTGGCCAAAAGGGG - Intergenic
1015127584 6:129771642-129771664 GGGGTCCCCTTGGCCAAGAGGGG - Intergenic
1019019609 6:168907070-168907092 GGGGTCCCCTTGGCCAAGAGGGG + Intergenic
1021248670 7:18296528-18296550 TGTTTCTCCTTGGCCAAGAGGGG - Intronic
1024035081 7:45501102-45501124 GGGGTCCCCTTGGCCAAAAGGGG - Intergenic
1026683694 7:72490106-72490128 GGCTTCTCCTTGGCAAATAGAGG + Intergenic
1027566020 7:79795629-79795651 GGGGACCCCTTGGCCAAGATGGG + Intergenic
1027993778 7:85397338-85397360 GGGGTCTCCTTGGCCAAGAGGGG + Intergenic
1031558694 7:123210319-123210341 GGGGTCCCCTTGGCCAAGAGAGG + Intergenic
1031810471 7:126361485-126361507 GGGATCTGCTTGGCCAAGAGGGG + Intergenic
1032358292 7:131230324-131230346 GGGGCCCCCTTGGCCAAAAGGGG + Intronic
1032803965 7:135337911-135337933 GGGCACCCCTTGGCCAAGAGGGG - Intergenic
1041317442 8:56579224-56579246 GGGGCCTCCTTGGCTAAGAGTGG + Intergenic
1041720344 8:60969592-60969614 GGGATCCCCTTGGCCAAGAGGGG + Intergenic
1045989962 8:108295489-108295511 GGTTACTCCTGGGCCAATACTGG - Intronic
1048704886 8:137142635-137142657 GGGTCCCCCTTGGCCAAGAGGGG - Intergenic
1048850907 8:138644489-138644511 TGGGTCTCCTTGGCCAAGAGGGG - Intronic
1049168746 8:141144420-141144442 GGGGTCCCCTTGGCCAAAAGGGG - Intronic
1052223875 9:26060449-26060471 GGGGTCCCCTTGGCCAAGAGGGG + Intergenic
1052649032 9:31275730-31275752 TGGGATTCCTTGGCCAAGAGGGG + Intergenic
1056802677 9:89703928-89703950 GGGGTCTCCTTGGCCAAGAGGGG + Intergenic
1057840801 9:98484382-98484404 TGGTTCTCCTTGACCATTAGAGG + Intronic
1057888533 9:98850455-98850477 GGGATCTTCTTGGCCAAGAGAGG - Intergenic
1058670187 9:107354728-107354750 GGGGACTGCTTGGACAAAAGAGG + Intergenic
1058826035 9:108776831-108776853 GTGGTCTCCTTGGCCAAAAGGGG - Intergenic
1062371764 9:136242929-136242951 GGGGTCTCCTTGGCCAAGAGGGG - Intronic
1185662529 X:1738681-1738703 GAGAACCCCTTGGCCAACAGGGG + Intergenic
1187101550 X:16198043-16198065 GGGGTCTCCTTGGCCAAGAGGGG - Intergenic
1187946260 X:24428773-24428795 GGGTACTCCTTGACTTATGGAGG + Intergenic
1189679986 X:43505873-43505895 GGGTGGCCCTTGGCCAATGGGGG - Intergenic
1189843065 X:45102878-45102900 GTGTTCTCCTAGGACAATAGTGG - Intronic
1195578451 X:106475831-106475853 GGGTTCCCCCTGGCCAAGAGGGG - Intergenic
1195648039 X:107254592-107254614 GGGATCCCCTTGGCCAATAGTGG - Intergenic