ID: 1119959429

View in Genome Browser
Species Human (GRCh38)
Location 14:78837638-78837660
Sequence GTCCCTGCCACTTCTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 143}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119959422_1119959429 -8 Left 1119959422 14:78837623-78837645 CCCACCCCCATGCCTGTCCCTGC 0: 1
1: 0
2: 10
3: 87
4: 816
Right 1119959429 14:78837638-78837660 GTCCCTGCCACTTCTAGAGCAGG 0: 1
1: 0
2: 1
3: 8
4: 143
1119959423_1119959429 -9 Left 1119959423 14:78837624-78837646 CCACCCCCATGCCTGTCCCTGCC 0: 1
1: 0
2: 11
3: 103
4: 1169
Right 1119959429 14:78837638-78837660 GTCCCTGCCACTTCTAGAGCAGG 0: 1
1: 0
2: 1
3: 8
4: 143
1119959421_1119959429 -7 Left 1119959421 14:78837622-78837644 CCCCACCCCCATGCCTGTCCCTG 0: 1
1: 0
2: 11
3: 117
4: 1036
Right 1119959429 14:78837638-78837660 GTCCCTGCCACTTCTAGAGCAGG 0: 1
1: 0
2: 1
3: 8
4: 143
1119959417_1119959429 29 Left 1119959417 14:78837586-78837608 CCTTTGAGAAATACTTGTTCTTG 0: 1
1: 0
2: 1
3: 25
4: 360
Right 1119959429 14:78837638-78837660 GTCCCTGCCACTTCTAGAGCAGG 0: 1
1: 0
2: 1
3: 8
4: 143
1119959419_1119959429 0 Left 1119959419 14:78837615-78837637 CCCTGCTCCCCACCCCCATGCCT 0: 1
1: 3
2: 19
3: 151
4: 1350
Right 1119959429 14:78837638-78837660 GTCCCTGCCACTTCTAGAGCAGG 0: 1
1: 0
2: 1
3: 8
4: 143
1119959420_1119959429 -1 Left 1119959420 14:78837616-78837638 CCTGCTCCCCACCCCCATGCCTG 0: 1
1: 2
2: 19
3: 168
4: 1278
Right 1119959429 14:78837638-78837660 GTCCCTGCCACTTCTAGAGCAGG 0: 1
1: 0
2: 1
3: 8
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119959429 Original CRISPR GTCCCTGCCACTTCTAGAGC AGG Intronic
900956614 1:5889900-5889922 CTCCCTGTGACTTCTAGAGGAGG - Intronic
903283761 1:22264675-22264697 GTCCTTGCCACTTCTAGGCTGGG - Intergenic
904428165 1:30445022-30445044 GTTCCTGTCCCTCCTAGAGCAGG - Intergenic
907421881 1:54353165-54353187 GCCCCAGCCAGTTTTAGAGCTGG + Intronic
908939306 1:69412002-69412024 GACACTGCCACTGTTAGAGCAGG - Intergenic
912417980 1:109523276-109523298 ATTAATGCCACTTCTAGAGCTGG - Intergenic
913333599 1:117687279-117687301 GTCACTGTCACTTCTTCAGCAGG + Intergenic
915328637 1:155094432-155094454 GTCCCTGAGCCTTCTAGGGCTGG + Intergenic
915598253 1:156907432-156907454 GTCCCTGCCATTTCCAGTCCTGG + Intronic
916398174 1:164414463-164414485 GTGCCTGCCAGTCCAAGAGCAGG + Intergenic
917587630 1:176443945-176443967 TTTCCTGCCACTTCTACAGCTGG - Intergenic
918632675 1:186737238-186737260 GTCACTTCTAATTCTAGAGCAGG - Intergenic
923183463 1:231546911-231546933 CTCCATGCCACTTCCAGGGCTGG - Intronic
1063192658 10:3712013-3712035 ATCCCTGCCATTTCTAGATCTGG + Intergenic
1063773042 10:9226182-9226204 TTTACTGCCACTTCTAGGGCTGG - Intergenic
1067985164 10:51135877-51135899 GTCCATGCCACTTCTAGGTTAGG - Intronic
1070800346 10:79241749-79241771 GTCCCAGCAACTTCCAGGGCCGG + Intronic
1071681100 10:87706639-87706661 GTCCCAGCTACTTCTAGGGCTGG + Intronic
1075361481 10:121839203-121839225 ATCCCTGCAAATACTAGAGCTGG - Intronic
1076433297 10:130422561-130422583 GTCCATGCCACTTCTCCAGCAGG + Intergenic
1076982446 11:211942-211964 GTCGCTGCCACTGCTGGTGCTGG + Intronic
1077615578 11:3671313-3671335 GGCCCTGGCACTGCAAGAGCGGG + Exonic
1078108021 11:8370809-8370831 TTCCCAGCCACTTCTCGTGCTGG - Intergenic
1082189515 11:49225814-49225836 GTGCCTGCCAGTTCTAGGGTGGG - Intergenic
1083284339 11:61648376-61648398 GTCTCTGTCTCTTCTTGAGCTGG + Intergenic
1083945551 11:65920816-65920838 GTCCCTGCCACTCCCAGTGATGG + Intronic
1086168785 11:83811891-83811913 GTCTCTGCCACATATACAGCAGG - Intronic
1086677009 11:89620690-89620712 GTGCCTGCCAGTTCTAGGGTGGG + Intergenic
1088128408 11:106457473-106457495 GTCACTGCCACTTAGAGACCAGG + Intergenic
1089076120 11:115740189-115740211 GTGCCTGCCGCTTCCATAGCAGG - Intergenic
1089678302 11:120105359-120105381 GACCCTGCTACTTCAGGAGCGGG + Intergenic
1090684107 11:129096538-129096560 GCCCCTGCCACCCCTATAGCAGG + Intronic
1091131226 11:133148715-133148737 GTCTCTGCCATTTGTAGAGCTGG - Intronic
1100026355 12:90133421-90133443 TTCTCTGCCACTTCCAGACCAGG - Intergenic
1100189951 12:92179856-92179878 GTCCCTGCCTCTCCAAGAACAGG + Intergenic
1103455081 12:121059182-121059204 TTCCCTGGCACTTAGAGAGCTGG + Intergenic
1104778929 12:131407360-131407382 GTTCCTGCCCCTCCTAGAACAGG + Intergenic
1109756385 13:66766255-66766277 ATCTCTGACTCTTCTAGAGCTGG - Intronic
1119959429 14:78837638-78837660 GTCCCTGCCACTTCTAGAGCAGG + Intronic
1124135075 15:27028188-27028210 GTCCCTTCCACTCCTGCAGCAGG - Intronic
1129722630 15:77886697-77886719 GTCCCTGCTTCTTCTAGCACTGG - Intergenic
1129845658 15:78766639-78766661 GTCCCCGCCAGGTCTAGATCGGG + Exonic
1130256200 15:82327222-82327244 GTCCCCGCCAGGTCTAGATCGGG - Intergenic
1130269812 15:82440315-82440337 TTCCCTGCCACAGCTAGATCAGG - Intergenic
1130282445 15:82530766-82530788 TTCCCGGCCACTGCTAGATCAGG - Intergenic
1130462151 15:84167616-84167638 TTCCCTGCCACAGCTAGATCAGG - Intergenic
1130473771 15:84246539-84246561 TTCCCTGCCACAGCTAGATCAGG - Intergenic
1130481186 15:84360603-84360625 TTCCCTGCCACAGCTAGATCAGG - Intergenic
1130490526 15:84427157-84427179 TTCCCTGCCACAGCTAGATCAGG + Intergenic
1130502114 15:84505927-84505949 TTCCCTGCCACAGCTAGATCAGG + Intergenic
1130598753 15:85262765-85262787 GTCCCCGCCAGGTCTAGATCGGG + Intergenic
1130933759 15:88451326-88451348 GTCACTGCCACTCCCAGGGCTGG + Intergenic
1133279497 16:4657165-4657187 GTCCCTCCCACTCCGACAGCTGG - Intronic
1133332349 16:4982411-4982433 GACCCTGGCCCTTCTAGAACTGG + Intronic
1136108921 16:28052535-28052557 GTCCGTGCCACTTCTAGGCAAGG + Intronic
1136394071 16:29983365-29983387 GACCCAGGCAGTTCTAGAGCAGG - Intronic
1136451949 16:30358501-30358523 TTTCCCGCCACTTCTTGAGCTGG + Exonic
1138290367 16:55841504-55841526 GCCTCTGCCACTCCTAGAACTGG + Intergenic
1138439422 16:57025351-57025373 GTCCCTGCCCCTTGCAGAGTTGG + Exonic
1140471769 16:75219220-75219242 GTCCTTCCCACTCCTGGAGCAGG - Intronic
1143517237 17:7425983-7426005 GTCCATGCCACATCTGGGGCAGG - Exonic
1143580773 17:7824390-7824412 GTACCTCCCACTTCTACAGAGGG + Intronic
1145408311 17:22630752-22630774 TTCCCTGCCTCTTCTAGTTCCGG - Intergenic
1148028966 17:44607044-44607066 GGCCCTGCCACATCTCCAGCTGG - Intergenic
1148083262 17:44979056-44979078 AGCCCTGTCACTTCTGGAGCTGG - Intergenic
1149373488 17:56020155-56020177 ATCTCTGCCACTTCTAAATCTGG - Intergenic
1151678100 17:75610232-75610254 GTCTCTGCCGCCTCTGGAGCAGG - Intergenic
1151704148 17:75757917-75757939 GTACCTGCCTCCTCTAGAGGTGG - Intronic
1153051893 18:908053-908075 GCATCTGCCACTCCTAGAGCCGG + Intronic
1153265217 18:3262504-3262526 GACCCGGCCACTTCTCCAGCAGG - Exonic
1155491310 18:26404565-26404587 GTCCCTGTCTCTTCCAGAGTAGG - Intergenic
1157665571 18:49484012-49484034 GTCCCAGCCACTTATGTAGCTGG - Intronic
1164711081 19:30357667-30357689 GGCCCTGCTGCTTCAAGAGCAGG - Intronic
1166065619 19:40356702-40356724 GGCCCTGGAACCTCTAGAGCTGG + Intronic
1167121652 19:47520951-47520973 TTCCCTTCCACTTCTAGAGCAGG - Exonic
1167444504 19:49529303-49529325 GTCCCTGCCATTTACAGAGCAGG - Intronic
1167523760 19:49971625-49971647 GTCCCTGGTCCGTCTAGAGCCGG + Intergenic
927213305 2:20651616-20651638 GTGCCTGCCATTTATGGAGCGGG - Intergenic
929717250 2:44325317-44325339 GCCAGTGCAACTTCTAGAGCTGG - Intronic
929821678 2:45279061-45279083 GTTCCTACCACTTCTTCAGCCGG + Intergenic
930652662 2:53977933-53977955 GAGGCTGCCACATCTAGAGCTGG + Intronic
934131922 2:88956524-88956546 GTCACTGTCACCTGTAGAGCTGG - Intergenic
936610202 2:113995078-113995100 CTCTCTGTCTCTTCTAGAGCTGG - Intergenic
936931859 2:117798071-117798093 GTCCGTTCCCCTTCCAGAGCAGG - Intergenic
942690107 2:178575996-178576018 GTCCATGTCACTTCAGGAGCAGG + Exonic
946089518 2:217208211-217208233 TTCCCCTCCACTTCCAGAGCGGG - Intergenic
948651057 2:239444164-239444186 GTCCTTGCCGCTTCTCGAGTCGG + Intergenic
1168970916 20:1930085-1930107 GTGCCTGCCACCCCTGGAGCTGG - Intronic
1172233550 20:33353502-33353524 CCCTCTGCCACTTCTAGGGCCGG - Intergenic
1173835607 20:46123245-46123267 CTCCATGCCACTCTTAGAGCAGG - Intronic
1177061478 21:16379711-16379733 GTGCCTGCCCCTTGTTGAGCTGG - Intergenic
1179218476 21:39386635-39386657 GTCCCTGCCAGCAGTAGAGCAGG - Intronic
1184176629 22:42792803-42792825 GTCCCTGCCAGGTCTAGGTCAGG + Intergenic
1184630595 22:45775158-45775180 GTCCTTACCACTCCTAGAGAAGG + Intronic
1184659797 22:45960505-45960527 GTCCCTGCCACCCAGAGAGCTGG - Intronic
950555721 3:13694851-13694873 GTTCCTGTCCCTCCTAGAGCAGG - Intergenic
952746346 3:36785095-36785117 GTCCCTGCCAGTTCTGGGGAGGG + Intergenic
954196566 3:49000612-49000634 GCCCCAGACACTTCCAGAGCAGG - Intronic
954290964 3:49649853-49649875 GGCCCTGCTCCTTCCAGAGCTGG - Intronic
956856780 3:73282944-73282966 GTCCTTGCCACATCTGGAGTGGG + Intergenic
962644248 3:137420276-137420298 GTTCGTGCCACTTCTGGAGTTGG - Intergenic
962975208 3:140440180-140440202 GTCCCTGCCCTTCCTAGGGCTGG - Intronic
967816845 3:193806600-193806622 GACCCTGCCTCTTCTAGCCCAGG - Intergenic
967992288 3:195140346-195140368 GTCCGTGCCACCTCCGGAGCTGG - Intronic
968584903 4:1411794-1411816 GTCCCTGGCACTTCTGGAAGGGG - Intergenic
969604237 4:8194383-8194405 ATGCCTGCCGCTTCTAGTGCTGG + Intronic
979764419 4:124446919-124446941 GTTCTAGCCAGTTCTAGAGCAGG + Intergenic
982837894 4:160145921-160145943 TTCCATGCCACATCCAGAGCAGG + Intergenic
984147991 4:176088649-176088671 GTTCATGCCACATCTATAGCAGG - Intronic
985115309 4:186584390-186584412 GTCCCTTGCACTTGTAGAACTGG - Intergenic
991729933 5:69575933-69575955 GTCCCTGCTACTTGTGGGGCTGG - Intronic
991806367 5:70431076-70431098 GTCCCTGCTACTTGTGGGGCTGG - Intergenic
991865020 5:71051930-71051952 GTCCCTGCTACTTGTGGGGCTGG + Intronic
992911214 5:81397750-81397772 GTCACTGCCATCCCTAGAGCAGG - Intergenic
993859163 5:93113416-93113438 GTCTCTGCCTCCTCAAGAGCTGG - Intergenic
996967535 5:129322833-129322855 TTCCCTGCCACATCCAGGGCTGG - Intergenic
997735376 5:136209092-136209114 GTCCCTGCTCATTCTAGAGGAGG + Intergenic
998904975 5:146894952-146894974 TTCCATGCCAGTTCTAGGGCCGG - Intronic
999417783 5:151414930-151414952 ATTCCTGCCCCTTCTGGAGCTGG - Intergenic
1000852056 5:166352503-166352525 GTGCCCACCACTTCTAAAGCTGG + Intergenic
1001659979 5:173384021-173384043 GTCCTTGCCACGTTTTGAGCAGG - Intergenic
1006762038 6:36471428-36471450 GTCTCTGCCACTACTGTAGCAGG - Intronic
1007240034 6:40418162-40418184 GTCCTTGCCACTTCTCCAACAGG + Intronic
1013233072 6:108174646-108174668 GTCCCAGCCCCTTCTCGATCTGG + Intronic
1015072781 6:129116243-129116265 GTCCCTGCCAGTTTAATAGCTGG - Intronic
1015923660 6:138289595-138289617 ATCCATCCCACTTCTGGAGCTGG + Intronic
1016413532 6:143808874-143808896 CTCCCTTCCACTTCTAGGGTCGG + Intronic
1018033352 6:159861780-159861802 GGCCCAGCCACTCCTAGACCTGG + Intergenic
1022097177 7:27148217-27148239 GTCACTGCCCCTCCTGGAGCAGG - Intronic
1023654366 7:42404892-42404914 GTTCCTGGCACTTTTAGAGAAGG + Intergenic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1032061847 7:128731312-128731334 CTCCATGCCACTGCCAGAGCTGG + Exonic
1034274645 7:149818682-149818704 GTCCGTGCAGCTTCTGGAGCAGG - Intergenic
1034331321 7:150285277-150285299 TTCCCTGCATCTTCTAGACCAGG - Intronic
1034640929 7:152601807-152601829 GTCCCTGCTGCTCCTTGAGCAGG + Intergenic
1034666722 7:152824576-152824598 TTCCCTGCATCTTCTAGACCAGG + Intronic
1036586781 8:10131759-10131781 GTCGCTGCCTCTTCCTGAGCTGG + Intronic
1037272761 8:17147404-17147426 GTCACTACCACCTCTAGGGCTGG - Intergenic
1037909607 8:22736138-22736160 GTCCCTGACACTCAGAGAGCTGG + Intronic
1041422198 8:57680154-57680176 GTCCCAGCTACTTGTAGGGCTGG + Intergenic
1041790541 8:61691887-61691909 GCCCCTGCAACTGCTGGAGCTGG + Intronic
1045235569 8:100350235-100350257 GTCCCTTTCTCTTCTTGAGCTGG + Intronic
1045307423 8:100970537-100970559 CTTCCTGCCATTTCTAGAGGAGG - Intergenic
1049472900 8:142784185-142784207 GGCCCTTCCACTTCTGGAGAGGG - Intergenic
1052697058 9:31891494-31891516 GTTCCTGCCCTTTCTAGAGCTGG - Intergenic
1057793712 9:98141207-98141229 GTCTCTGCCTCTTCTACAGCAGG + Intronic
1060202310 9:121658470-121658492 CACCCCGCCACTCCTAGAGCGGG - Intronic
1188967161 X:36568554-36568576 GTTCCTGTCCCTCCTAGAGCAGG - Intergenic
1193689942 X:84629303-84629325 ATGCCTGCCACTTCTTTAGCTGG + Intergenic
1194746387 X:97633114-97633136 TTCTCTGCCACTGCTACAGCTGG + Intergenic
1196091162 X:111744805-111744827 GTCTCTCCCACATCAAGAGCAGG - Exonic
1196411907 X:115428440-115428462 GTCCCAGCCTCTGCCAGAGCAGG + Intergenic
1199976374 X:152897257-152897279 GTCCATGCCATTTCTTGGGCTGG + Intergenic