ID: 1119959531

View in Genome Browser
Species Human (GRCh38)
Location 14:78838946-78838968
Sequence GCAAATAACCTAAATGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 1, 2: 3, 3: 45, 4: 349}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119959531_1119959533 0 Left 1119959531 14:78838946-78838968 CCTTGCTCATTTAGGTTATTTGC 0: 1
1: 1
2: 3
3: 45
4: 349
Right 1119959533 14:78838969-78838991 TGAAAACTATGCCTGTCTCAGGG 0: 1
1: 1
2: 4
3: 21
4: 268
1119959531_1119959532 -1 Left 1119959531 14:78838946-78838968 CCTTGCTCATTTAGGTTATTTGC 0: 1
1: 1
2: 3
3: 45
4: 349
Right 1119959532 14:78838968-78838990 CTGAAAACTATGCCTGTCTCAGG 0: 1
1: 0
2: 2
3: 15
4: 186
1119959531_1119959534 10 Left 1119959531 14:78838946-78838968 CCTTGCTCATTTAGGTTATTTGC 0: 1
1: 1
2: 3
3: 45
4: 349
Right 1119959534 14:78838979-78839001 GCCTGTCTCAGGGAGAATAGTGG 0: 1
1: 0
2: 3
3: 8
4: 173
1119959531_1119959537 17 Left 1119959531 14:78838946-78838968 CCTTGCTCATTTAGGTTATTTGC 0: 1
1: 1
2: 3
3: 45
4: 349
Right 1119959537 14:78838986-78839008 TCAGGGAGAATAGTGGGTGCTGG 0: 1
1: 0
2: 2
3: 33
4: 287
1119959531_1119959536 11 Left 1119959531 14:78838946-78838968 CCTTGCTCATTTAGGTTATTTGC 0: 1
1: 1
2: 3
3: 45
4: 349
Right 1119959536 14:78838980-78839002 CCTGTCTCAGGGAGAATAGTGGG 0: 1
1: 0
2: 1
3: 33
4: 172
1119959531_1119959538 28 Left 1119959531 14:78838946-78838968 CCTTGCTCATTTAGGTTATTTGC 0: 1
1: 1
2: 3
3: 45
4: 349
Right 1119959538 14:78838997-78839019 AGTGGGTGCTGGAGATCCGTTGG 0: 1
1: 0
2: 0
3: 9
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119959531 Original CRISPR GCAAATAACCTAAATGAGCA AGG (reversed) Intronic
901861490 1:12077552-12077574 GCCAACAACCTTAGTGAGCAGGG + Intronic
905378828 1:37545155-37545177 ACACATTACCTGAATGAGCAGGG + Intronic
905849163 1:41260126-41260148 GCCAATAACCTGAGTGAGCATGG + Intergenic
907019420 1:51051950-51051972 GCAATTAAGCTTAATGAGGAAGG - Intergenic
907084277 1:51655246-51655268 GCAAATGCCCTGAATGAGCCTGG - Intronic
908912192 1:69084930-69084952 GAAAATAAACTAATAGAGCAAGG - Intergenic
908918689 1:69163802-69163824 GCCAAGAACCTGAATGAGCCTGG - Intergenic
908959737 1:69682029-69682051 GCCAATAGCCTAAATGAGTTTGG - Intronic
909677442 1:78253804-78253826 GCCAATAACAAAAATGAGCTTGG - Intergenic
910194961 1:84630736-84630758 GCAAACAACCTAGGTGAGCTTGG + Exonic
910665033 1:89715625-89715647 GCAAATAAGTTAAATGATAAAGG - Exonic
911049098 1:93654449-93654471 GCCAATAACCTGAATGAGTGTGG + Intronic
911809504 1:102257291-102257313 GTAGAAAACCTAAATGAGCTTGG + Intergenic
911815828 1:102349336-102349358 GCAAAAAACCTAAAATTGCAAGG + Intergenic
912444617 1:109725675-109725697 GTAGATAACCTCAAGGAGCACGG - Intronic
912859299 1:113198706-113198728 GGAAACAACCTAAATGACTAAGG + Intergenic
913175952 1:116273465-116273487 ACAAATAACCAAAGTGAGGAAGG - Intergenic
914675783 1:149906356-149906378 GCAAATTACCTCTATGAGCCTGG - Intronic
914934010 1:151962031-151962053 GCCAAAAACAGAAATGAGCAAGG - Intergenic
915629752 1:157143358-157143380 GCAAATAATCAAAATTAGCATGG + Intergenic
916218564 1:162420357-162420379 ACCAATAACCTGAATGAACAAGG - Intergenic
916923046 1:169488533-169488555 GCTAAAAACCTAAATGAGCTTGG + Intergenic
917780030 1:178385020-178385042 GAAAATATCTTAAATGAGAAAGG - Intronic
918220775 1:182434431-182434453 CCATATTACCTTAATGAGCAGGG - Intergenic
918233689 1:182558538-182558560 GCCAATAACCTGAATGAACCAGG - Intronic
918400581 1:184158654-184158676 GCCAATAACCTGAATGAGCTTGG + Intergenic
918909256 1:190544313-190544335 GGAAATAAGCTAAGTGAGGAAGG - Intergenic
920794389 1:209124511-209124533 GCCAACAACCTGAATGAGCCTGG + Intergenic
921244869 1:213227556-213227578 GCCAACAACCTGAATGAGCTTGG - Intronic
921941160 1:220841415-220841437 GCCAATAGCCTACATGAGCTTGG - Intergenic
922480397 1:225936717-225936739 GGAAATGACCTAAATATGCACGG + Exonic
922575275 1:226656915-226656937 GCAAAAAACCAAAGTGAGCCTGG - Intronic
922985015 1:229859680-229859702 GAAAATAACCTAAACAAGTAAGG - Intergenic
923901673 1:238332914-238332936 GCCAATGACCTCAATGAGCTTGG - Intergenic
1064341767 10:14492259-14492281 GCCAATGAGCTAAATGAGCTTGG + Intergenic
1064831342 10:19470347-19470369 GGAAACAACCTAAATGTCCATGG - Intronic
1065932255 10:30490325-30490347 GAAAATAACAAAAATGAGCCAGG - Intergenic
1066451640 10:35535312-35535334 GTAGATAACCTCAAGGAGCACGG + Intronic
1067327002 10:45279040-45279062 GCAGATAACCTCAAGGAGCATGG - Intergenic
1068245750 10:54364828-54364850 GCCAATAATCTGAATGAGCTTGG - Intronic
1068341559 10:55710961-55710983 ACCAATAACTTGAATGAGCAAGG + Intergenic
1068646850 10:59477692-59477714 GCAAATAACTTCAAGGAGCTCGG + Intergenic
1069220021 10:65871544-65871566 GGAAATAAACAAAATGAGCATGG - Intergenic
1069500759 10:68950930-68950952 GGAAATAACCTGAATGAGGAGGG + Intergenic
1070353454 10:75615694-75615716 GGAAAAAACATTAATGAGCAAGG + Intronic
1070492978 10:76994796-76994818 GCAAATGTCCTAAATGTGCTGGG + Intronic
1070984902 10:80680276-80680298 GCAAATGTCCAAAATGAGGAGGG + Intergenic
1072332262 10:94365215-94365237 GCAAATAATATAAATTAGCCGGG - Intergenic
1075810291 10:125220177-125220199 GCAAATTACAAAAATGTGCAAGG - Intergenic
1078252153 11:9624991-9625013 GCCAATAACCAGAATGAGCTTGG + Intergenic
1078390773 11:10933620-10933642 GCAAAAAACTTGAATGAACATGG + Intergenic
1078481440 11:11679520-11679542 GAAAATAGCCAAAATAAGCAGGG + Intergenic
1079763745 11:24363333-24363355 TCAAATAACCTAATTGAAAATGG + Intergenic
1081373177 11:42329007-42329029 GCAAATAAACAAAATGACAATGG + Intergenic
1082802188 11:57423305-57423327 GCAAATATCCTTACTTAGCAGGG - Intronic
1082957531 11:58886053-58886075 GAAAATAAACAAAATTAGCAGGG + Intronic
1082964185 11:58948477-58948499 GAAAATAAACAAAATTAGCAGGG + Intronic
1085373768 11:76038894-76038916 GCCAACAACCTGAATGAGCTTGG + Intronic
1086676192 11:89609892-89609914 GTCAATATCCCAAATGAGCAAGG - Intergenic
1087723379 11:101692069-101692091 GCCAATAATCTGAATGAGCCTGG + Intronic
1087825898 11:102764432-102764454 GAATATAACCTGAATGAGCTTGG - Intergenic
1088341798 11:108776878-108776900 GCCAACAACCTGAATGAGCTTGG + Intronic
1088368266 11:109061497-109061519 GCAAATGAAATAAAAGAGCAGGG - Intergenic
1090478509 11:127046780-127046802 GCACCTAACCTAAATTAGGAGGG + Intergenic
1090901329 11:131034409-131034431 GCCAACAACCTAAATGAACTTGG + Intergenic
1091482422 12:847302-847324 GTAAATAACCTAAATGCTAAAGG + Intronic
1091551673 12:1539700-1539722 TCAGAAAACCTAAATGGGCAAGG - Intronic
1093985793 12:25531128-25531150 GCCAACAACCTCAAAGAGCATGG + Intronic
1094618075 12:32054344-32054366 GTAGATAACCTCAAGGAGCACGG - Intergenic
1096065336 12:48735153-48735175 GCCAACAACCTGAATGAGCCTGG + Intergenic
1097941809 12:65317043-65317065 ACAAATAAACTAAAGGAGGAAGG + Intronic
1099265211 12:80437823-80437845 GCAAACTACTTGAATGAGCAAGG - Intronic
1099997223 12:89791575-89791597 ACCAATAACCTGAATGAGCTGGG + Intergenic
1100701809 12:97156610-97156632 GCAGGTAACATAGATGAGCATGG + Intergenic
1101150836 12:101880965-101880987 GCAAACAACCTAAAAGACCCAGG - Intronic
1102307495 12:111816417-111816439 GTAGATAACCTCAAAGAGCATGG + Intergenic
1102922073 12:116799092-116799114 GCCAACAACCTTAATGAGCCTGG - Intronic
1106976510 13:35223921-35223943 GCTAATAACCTGAGTGAGCCTGG - Intronic
1107309761 13:39063854-39063876 GCAAATTACACAAATGAACAGGG - Intergenic
1107906581 13:45066902-45066924 GCCAACAACCCAAATGAGCTTGG - Intergenic
1109493368 13:63132916-63132938 GGAAACAATCCAAATGAGCATGG - Intergenic
1109848056 13:68023392-68023414 ATAAATAACCTAAATAAGAATGG + Intergenic
1110571591 13:77010727-77010749 GCCAATAACTTGAATGAGCGTGG + Intronic
1111633999 13:90880094-90880116 CCAAATAATCAAAATGAGCAAGG + Intergenic
1113362965 13:109648424-109648446 GCAAATAACGTAAGTGATAAAGG + Intergenic
1113669955 13:112169951-112169973 GCAAATACCCCAAATGCACAGGG + Intergenic
1115966507 14:38895593-38895615 GAAAATAACCTAAATGTTTATGG + Intergenic
1117270727 14:54140652-54140674 GCAAACAAACTGAATGAGCTTGG + Intergenic
1117414027 14:55477289-55477311 GCCAATAACCTAAGGGAGCTTGG - Intergenic
1117543880 14:56774906-56774928 GCAAATTAACTAAAAGAGCAAGG - Intergenic
1118930732 14:70237935-70237957 GCAGATAACCTCAAGGAGCATGG - Intergenic
1119019838 14:71099890-71099912 GCAAACAAACAAAAAGAGCAGGG - Intronic
1119305221 14:73602400-73602422 GTAAATAACCTCAAGGAGCTCGG - Intergenic
1119433190 14:74581634-74581656 GCAGATAACCTGAATGAGCGAGG + Intronic
1119636063 14:76274445-76274467 GCAAACAATCTAAAGGAGCTAGG - Intergenic
1119959531 14:78838946-78838968 GCAAATAACCTAAATGAGCAAGG - Intronic
1120306019 14:82771609-82771631 GCAAATATCCTTGATGAACATGG - Intergenic
1120480570 14:85044192-85044214 GCCAACAACCTAAATGACCTTGG - Intergenic
1124393547 15:29281081-29281103 GCAAATTACCTAATTCAACATGG + Intronic
1126156458 15:45569912-45569934 GCCAATGACCTAAATGAACTTGG + Intergenic
1126184214 15:45815136-45815158 GTAGATAACCTCAAGGAGCATGG - Intergenic
1126373675 15:47973023-47973045 GCCAACAACCTAAACGAGCAAGG + Intergenic
1126904473 15:53349546-53349568 GGAAATAAGCAAAATGAGCTTGG + Intergenic
1127755921 15:62091908-62091930 GCAAATACCATAAATGTGAAAGG - Intergenic
1127959583 15:63880740-63880762 TCACAGAACCAAAATGAGCAAGG + Intergenic
1131175320 15:90205693-90205715 GCAAATAACCTCACCAAGCAAGG - Intronic
1134144657 16:11750342-11750364 TCAAATGAGCTACATGAGCAGGG - Intergenic
1134377684 16:13693157-13693179 GTAGATAACCTCAAGGAGCATGG + Intergenic
1135112079 16:19698168-19698190 GCAAATACCCTGAAGGAACAAGG - Intronic
1137034802 16:35560761-35560783 ACAGATAACCTCAAGGAGCACGG - Intergenic
1137635644 16:49984053-49984075 GCCAATAACCTGAATGGGCAGGG + Intergenic
1140276287 16:73511929-73511951 GCAAATACCCAACATGAGCCAGG + Intergenic
1140450595 16:75067815-75067837 GCTAAAGACCTAAATGAGAATGG + Intronic
1140855995 16:78978243-78978265 GGAAATAACCCAAATGCCCATGG - Intronic
1140980498 16:80104392-80104414 GCCAACAACCTAAATGTGCCTGG - Intergenic
1141951079 16:87339783-87339805 GCAAATAAACAAGATGAGCCGGG + Intronic
1142598687 17:1042143-1042165 GGAAACAACCCAAATGTGCACGG + Intronic
1144075376 17:11714865-11714887 GCCAAGAACCTGAATGAGCTTGG + Intronic
1146567960 17:33929408-33929430 GAAAATTACCTAAATGAGGTTGG - Intronic
1148255080 17:46123772-46123794 TCCAATAACCTAAAAGTGCAAGG + Intronic
1149309529 17:55380516-55380538 GCAGATAATCTCAAAGAGCATGG + Intergenic
1151107167 17:71629530-71629552 GCAAATAACCTACAATAGCAGGG + Intergenic
1153702392 18:7709686-7709708 GCAAATAAGCTCAATTAGAAAGG + Intronic
1155004087 18:21712630-21712652 GCCAACAACCTGAATGAGTATGG + Intronic
1157715253 18:49880908-49880930 GTAGATAACCTTAAGGAGCATGG - Intronic
1157800198 18:50613421-50613443 GCCAACAACCTGAATGAGCTTGG + Intronic
1158700300 18:59739322-59739344 GCCAACAACCTAAATGAACTTGG + Intergenic
1159800395 18:72891872-72891894 GGAAACAACCTAAATGTCCATGG - Intergenic
1159916728 18:74194615-74194637 GCCTGTAACCCAAATGAGCAAGG - Intergenic
1164050516 19:21582623-21582645 GCCAATGACCTGAATGAGCTTGG + Intergenic
1164125430 19:22311048-22311070 CCAAATAACCTCAATAAGAAAGG - Intronic
1164278664 19:23748401-23748423 GTAGATAACCTCAAGGAGCATGG - Intronic
1166594607 19:44034461-44034483 GTAGATAACCTCAAGGAGCACGG + Intergenic
1167662826 19:50805965-50805987 GAAAACAACCCAAATGACCAGGG - Intergenic
1167819480 19:51913443-51913465 GTAGATAACCTCAAGGAGCATGG - Intronic
1167838038 19:52090893-52090915 GTAGATAACCTCAAGGAGCATGG - Intronic
1168679739 19:58305830-58305852 GTAGATAACCTCAAGGAGCAGGG - Intronic
925036291 2:688983-689005 GCAAAAAAGCTAAAGGAGAAAGG - Intergenic
925620595 2:5788662-5788684 GGAAATAACCAAAAGCAGCATGG + Intergenic
927069506 2:19511992-19512014 ACAAATAACTCAAATCAGCAAGG - Intergenic
927270621 2:21205941-21205963 GCATATAACATAAATGATTAGGG - Intergenic
927611271 2:24543618-24543640 GCACTTAACCTAGATGAACAGGG + Intronic
927659348 2:24979780-24979802 GCCAAAAACCTGAATGAGCCTGG + Intergenic
928246520 2:29633703-29633725 GCAAATTACCAATATGAGGAAGG + Intronic
928797354 2:35038853-35038875 GCCAAAAACCCAAATGAGGAGGG - Intergenic
928892541 2:36220583-36220605 GCAAACAATCTAACTGAGCAAGG + Intergenic
930863581 2:56100594-56100616 GCAAATAAATTAGAAGAGCAAGG - Intergenic
930896082 2:56448244-56448266 GCCAATAATCTAAATGAGTCTGG + Intergenic
930906542 2:56575362-56575384 TCAAATAACCTCTGTGAGCAAGG - Intergenic
931314368 2:61113676-61113698 GCAAATAACTGAATTTAGCAAGG - Intronic
931957678 2:67445981-67446003 GCAAATAACTAAAATGAGAGAGG + Intergenic
933113267 2:78431818-78431840 GAAAAAAACCTGAATAAGCATGG + Intergenic
935577607 2:104726956-104726978 GCAAATAACCAAAACCAACATGG - Intergenic
935895060 2:107727120-107727142 GCAAATGACCTAAAATAGCAAGG + Intergenic
936341827 2:111640433-111640455 GCAAATAACCCAGATAAACAAGG + Intergenic
939098749 2:137869199-137869221 GCAAATAACATAACTGGACATGG + Intergenic
941333518 2:164210423-164210445 GTGAACAACCTAAATGAGCCTGG + Intergenic
942392585 2:175511191-175511213 ACAAAAAACCCAAATTAGCAGGG + Intergenic
943084269 2:183293860-183293882 ACAAAAAACCTGAATGAGCTTGG + Intergenic
943307624 2:186284210-186284232 GCCAATAACCTGAATGAGCTTGG + Intergenic
943399868 2:187394260-187394282 GCCAACAACCTGAATGAGTATGG + Intronic
944086145 2:195850168-195850190 GAGAATAACCAAAATGAGCATGG + Intronic
945165510 2:206938835-206938857 GCTAATAGTCTAACTGAGCAAGG - Intergenic
946273800 2:218615693-218615715 CCAGATCACCTAAAGGAGCAAGG - Exonic
946286199 2:218705042-218705064 ACAAAAAACCTAACTGGGCATGG - Intergenic
946872676 2:224098563-224098585 GCCAATAACCCAAATGAACTTGG - Intergenic
947968170 2:234299861-234299883 GCCAAGAACCTTAATGAGCTTGG - Intergenic
1168762405 20:358206-358228 GGAAACAACCTAAATGCTCATGG + Intronic
1168905102 20:1396955-1396977 GTAGATAATCTCAATGAGCATGG - Intergenic
1168905757 20:1402422-1402444 GTAGACAACCTCAATGAGCATGG - Intergenic
1169693739 20:8363342-8363364 GGCAACAACCTAAATGAGCTTGG - Intronic
1169870025 20:10240109-10240131 ACAAACAACCTGAATGAGCTTGG - Intronic
1170190670 20:13641753-13641775 GCCAATCACCTGAATGAGCTTGG - Intergenic
1171081325 20:22188123-22188145 CCAAATAACCTCAATAAGAAAGG - Intergenic
1172176720 20:32976904-32976926 GTAGATAACCTCAATGAGCACGG + Intergenic
1172741776 20:37174312-37174334 ACAAATAAACCAAATGAGCAAGG - Intronic
1174029941 20:47615436-47615458 GCAAATTAGCTAAATGGACAAGG - Intronic
1174963031 20:55179207-55179229 GCAAATAACCAAATTGACTAAGG - Intergenic
1174990626 20:55505352-55505374 GCCAACAACCTAAAGGAGCTTGG - Intergenic
1176996938 21:15565965-15565987 GCCAATAACCTAAGAGAGCCGGG + Intergenic
1177141148 21:17359535-17359557 GCCAACAACCTGAATGAGTATGG + Intergenic
1177326530 21:19597136-19597158 GAAAAAAACCTAATTTAGCAAGG + Intergenic
1177520832 21:22222335-22222357 GGAAAAAACCTAAATGATCTTGG - Intergenic
1178106847 21:29328953-29328975 GGAAACAACCTAAATGTCCATGG - Intronic
1179071168 21:38072505-38072527 CCCACTAACCTGAATGAGCAAGG + Intronic
1182042940 22:27252566-27252588 GCCAATAACCTGAATGAACTTGG - Intergenic
1184475144 22:44716251-44716273 CCAAATAACCTAACTGTCCAGGG - Intronic
949390946 3:3561598-3561620 GCCTATAACCTAAATGAGCAAGG - Intergenic
949392587 3:3579069-3579091 GCCAATGACCTAAATGAGCCTGG - Intergenic
949408267 3:3737050-3737072 TCAGATAACCCAAAAGAGCAAGG + Intronic
950883750 3:16345091-16345113 GCCAACAACCTAAGTGAGCTTGG + Intronic
951228633 3:20150133-20150155 GAAACTGACCTAATTGAGCAAGG + Intronic
951470623 3:23052340-23052362 GCAACTAACCTATATAACCAGGG + Intergenic
952014328 3:28939049-28939071 GGAAACAACCTAAATGTTCATGG + Intergenic
952540641 3:34364027-34364049 GCCAACAACCTGAATGAGCTTGG + Intergenic
953006002 3:38979929-38979951 GCAAAGAAGCTGAATGGGCAGGG - Intergenic
953292131 3:41675975-41675997 GTCAACAACCTAAATGAGCCTGG + Intronic
953373682 3:42410862-42410884 GCCAACAACCTCAATGAGCAAGG - Intergenic
954858238 3:53664995-53665017 GTAGATAACCTCAATGAGCACGG + Intronic
954946258 3:54427198-54427220 ACAGATAACCTACATGTGCAGGG - Intronic
955113198 3:55970500-55970522 ACAAATAACCTAATTAAACATGG + Intronic
955384164 3:58465767-58465789 GGAAATAACCTAAATATTCATGG + Intergenic
955403139 3:58607831-58607853 GCCAACAGCCTGAATGAGCACGG + Intronic
955639617 3:61068271-61068293 GCCAACAACCGGAATGAGCAAGG - Intronic
956274699 3:67485746-67485768 GAAAATAACCTAAATTTGTAAGG + Intronic
956928396 3:74014687-74014709 TCTAATCACCTCAATGAGCAAGG + Intergenic
956928658 3:74017531-74017553 TCTAATAACCTCAATGAGCAAGG + Intergenic
957302003 3:78404036-78404058 GCCAACCACCTAAATGAGCTTGG - Intergenic
957506589 3:81129234-81129256 GCGAATATCCTTAATGAACATGG + Intergenic
957969731 3:87367249-87367271 TAAAATAACCTAAATTAGTAGGG - Intergenic
958010704 3:87875611-87875633 TCAAATAACCTAATTAAGAATGG + Intergenic
958826166 3:99034114-99034136 GGAATTAACCTAGATGACCATGG + Intergenic
959000684 3:100960831-100960853 GCAAAGAACCTGAATGAGCCTGG + Intronic
959776042 3:110164534-110164556 GCTAACTACCTAATTGAGCATGG - Intergenic
961707936 3:128803644-128803666 GCAAATAACTCAAATGATCTGGG + Intronic
961943363 3:130659812-130659834 ATAAATGACCTAAATGAGGAAGG + Intronic
962166230 3:133051591-133051613 GGAAAAAACCTAAATGATCTTGG - Intronic
963367646 3:144358398-144358420 GCCAACAAGCTAAATGAGCTTGG - Intergenic
963754178 3:149216309-149216331 GGCAATAACCCAAATGAGCTAGG - Intronic
963760961 3:149287053-149287075 GCTATTAACCGAAATGAGAAAGG - Intergenic
963765851 3:149335280-149335302 GCAAGTCAGCTGAATGAGCAGGG + Intergenic
963876081 3:150476250-150476272 GCCAACAACCTAAGTGAGCTTGG + Intergenic
964235593 3:154523244-154523266 GAAAATAATCTAAATGTTCATGG - Intergenic
964611595 3:158621457-158621479 GTAGATAACCTCAAGGAGCATGG + Intergenic
967222492 3:187259205-187259227 GCAAATAAGCAGAATGAACAAGG - Intronic
968202320 3:196765301-196765323 GCAAAAAAATTAGATGAGCATGG - Intronic
968423754 4:507015-507037 ACAGATAATTTAAATGAGCAAGG - Intronic
970830895 4:20338528-20338550 GTAAATAACAGAAATAAGCAAGG + Intronic
970899588 4:21143440-21143462 GCCAGTAACCTGAATGAGCTTGG + Intronic
972054103 4:34778602-34778624 GACAATAACCTAAATGAACGTGG - Intergenic
972516587 4:39815338-39815360 GAAAATAGCAAAAATGAGCAGGG - Intergenic
972842984 4:42953354-42953376 GTAAACATCCTAAAAGAGCAAGG - Intronic
974618318 4:64320276-64320298 GGAAATAATCTAATTTAGCAAGG - Intronic
975264694 4:72348870-72348892 GCCAACAACCTGAATGAGCCTGG + Intronic
975737171 4:77392518-77392540 GTAGATAACCTCAAGGAGCATGG + Intronic
976516469 4:85973359-85973381 GCAAATAACCCAACTGAAAATGG - Intronic
976938203 4:90665929-90665951 GCCAACAACCTGAATGAGCATGG - Intronic
977345015 4:95806857-95806879 GACAATAAAATAAATGAGCAAGG + Intergenic
977592180 4:98839560-98839582 GCCAACAACCTAAAGGAGCTTGG + Intergenic
978365234 4:107974413-107974435 GCAAGTGACCCAAAAGAGCAAGG - Intergenic
978599474 4:110412878-110412900 GCCAACAACCTGAATGAGCCTGG - Intronic
979149671 4:117294743-117294765 GAAAATACCAGAAATGAGCAAGG - Intergenic
979671800 4:123367472-123367494 GCCAATAATCTAAGTGAGCTTGG + Intergenic
980402072 4:132303711-132303733 GCCAATATCCTAAAGAAGCAGGG - Intergenic
981343914 4:143653307-143653329 GCCAAAAATCTAAATGAGCTTGG - Intronic
981402451 4:144329261-144329283 GCCAACAACCTCAATGAGTAAGG + Intergenic
982857226 4:160399121-160399143 GCCAATAACCTGAATGAGATTGG - Intergenic
983524640 4:168748689-168748711 GCTAATAACCTAAAGGAGCTTGG - Intronic
983655997 4:170085348-170085370 TCAAATATCCTAAATTAGAAGGG + Intronic
985144506 4:186880951-186880973 GCAAATATCCTAAGTGGGGAAGG + Intergenic
985194317 4:187411879-187411901 GCCAACAACCTCAATGAGCAAGG - Intergenic
985295035 4:188427812-188427834 GCCAACAATCTAAATGAGCCTGG + Intergenic
985831278 5:2233870-2233892 GCAACAAACCTAAATGTCCACGG + Intergenic
985970555 5:3374945-3374967 TCAAATAAGCCACATGAGCAGGG - Intergenic
986615775 5:9616105-9616127 GAAAAAAACCTAAATGACCAGGG - Intergenic
986788482 5:11138033-11138055 GCAAGTAAGCTGAATAAGCAAGG - Intronic
986970929 5:13335720-13335742 GCCAATAACCTGAATGAACTGGG - Intergenic
987400736 5:17473528-17473550 GCCAATATCCTTAATGAACACGG + Intergenic
987632691 5:20495352-20495374 GTCAATAACCTAAAGGAGAACGG + Intronic
987726030 5:21700779-21700801 GCTGACAACCTGAATGAGCATGG - Intergenic
988636123 5:32986748-32986770 GCAAATAAACTGAATCAGCATGG - Intergenic
989775748 5:45205393-45205415 GTCAATAACCTGAATGAGCTTGG - Intergenic
991388435 5:66116069-66116091 GCAAACAACCTGAATGAACTTGG + Intergenic
991591921 5:68260689-68260711 GGAAATAACCTAAATGACTAGGG + Intronic
991699685 5:69305645-69305667 GTAGATAACCTCAAGGAGCACGG - Intronic
992253782 5:74901369-74901391 GCTAACAACCTGAATGAGCTGGG - Intergenic
992945532 5:81805137-81805159 ACAATAACCCTAAATGAGCATGG + Intergenic
993213069 5:84979555-84979577 GTGAATAACCTGAATGGGCATGG + Intergenic
993404129 5:87489720-87489742 GCAAATAACCTAATTAAAAATGG - Intergenic
994546188 5:101169212-101169234 ACCAATAACATAAATGAGAATGG + Intergenic
995615172 5:113954226-113954248 GCAAATAACCTAATTAAAAATGG + Intergenic
996081911 5:119266742-119266764 GCCAATAACCTAAATGAGCAAGG - Intergenic
996103699 5:119473027-119473049 GGAAACAACCTAAATGTCCATGG - Intronic
996516416 5:124374384-124374406 GCCAATTCCCTAAAAGAGCATGG + Intergenic
998306963 5:141087943-141087965 GAAAATATCCTGAATGAGGATGG + Intergenic
1000140905 5:158402610-158402632 ACACATAACCTAAATTAGAAAGG + Intergenic
1000512858 5:162205148-162205170 GAAAACAACCTAAATGTTCATGG + Intergenic
1001443891 5:171768113-171768135 GGAAATATACTAGATGAGCATGG + Intergenic
1003626686 6:7747545-7747567 GCCAACAACCTGAATGAGCAAGG + Intronic
1004355417 6:14926191-14926213 GAAAATAACCTACATTAGAATGG + Intergenic
1005306771 6:24521627-24521649 CCACATAACCTAAATAAGCTTGG + Intronic
1005319228 6:24635723-24635745 GCCAACAACCAAAATGAGCTTGG + Intronic
1007067460 6:39006086-39006108 GCCAACAACCCAAATAAGCAAGG + Intronic
1009246363 6:61243515-61243537 GGGAATAAACTAAATGATCAGGG - Intergenic
1009281085 6:61752706-61752728 GAATATGACCTCAATGAGCATGG - Intronic
1009907382 6:69886570-69886592 GGAAACAACCTAAATGCTCATGG + Intronic
1010174482 6:73011709-73011731 GCAAATAACATACCTGAGAAGGG + Intronic
1011330978 6:86206241-86206263 GTAGATAACCTCAAGGAGCATGG + Intergenic
1011860497 6:91749025-91749047 GCAAACAACCTGAATGAGATTGG + Intergenic
1011906278 6:92372551-92372573 GCAAAGAAACCAAATGAGTAAGG + Intergenic
1012169355 6:95999578-95999600 CTAACTAACCTTAATGAGCAAGG + Intergenic
1012627655 6:101423908-101423930 GGAAACAACCTAAATGTTCATGG + Intronic
1012874146 6:104706070-104706092 ACAAATAAACTAAAAGAACAGGG + Intergenic
1013867645 6:114718224-114718246 GTAAAGAACATAAATGAACAAGG + Intergenic
1013903877 6:115190921-115190943 GCAAACAACCTGAATGAGCTTGG + Intergenic
1014151852 6:118066456-118066478 GCCAACAACCTAAATGAGCTTGG + Intronic
1014683089 6:124458202-124458224 GCAAATAAGCCATATGATCAAGG + Intronic
1014810714 6:125882147-125882169 GAAACTAACCTAAATGGGCTGGG - Intronic
1015081638 6:129233037-129233059 GCCAACAACCTGAATGAACAAGG + Intronic
1016654318 6:146500382-146500404 GTAGATAACCTCAAGGAGCACGG - Intergenic
1017647410 6:156551800-156551822 GCCAACAACCTGAATGAGCCTGG + Intergenic
1017852460 6:158316803-158316825 GCCAACAACCTGAATGAGCTTGG - Intronic
1019007992 6:168819144-168819166 GGAAACAACCAAAATGTGCATGG + Intergenic
1020580871 7:9999576-9999598 GGAAACAACCTAAATGTTCATGG + Intergenic
1020628048 7:10607269-10607291 GCCAGCAACCTAAATGAGCTTGG - Intergenic
1021171951 7:17408368-17408390 GCTAACAACCTGAATGAGCTTGG - Intergenic
1021371366 7:19852222-19852244 GCCAAGAACCTAAATGAGCTTGG - Intergenic
1021658084 7:22891705-22891727 ACAAAAAACCTAGGTGAGCATGG + Intergenic
1022236166 7:28462744-28462766 GCAAATAACCTAATTAAAAATGG - Intronic
1023452470 7:40302579-40302601 GCCAACAATCTAAATGAGCTTGG - Intronic
1024106421 7:46092278-46092300 GCAAATAACCTTGATGAGCATGG - Intergenic
1024602007 7:50990791-50990813 ACAAATATCAGAAATGAGCATGG + Intergenic
1025873492 7:65457548-65457570 GAAAACAACCTAAATGACAATGG - Intergenic
1026894922 7:74004366-74004388 GCAGAAAACCCAAATGTGCATGG + Intergenic
1028460349 7:91085260-91085282 GCCAACAACCTGCATGAGCATGG - Intronic
1028927881 7:96379994-96380016 GCAAAAAACCCAAAAGACCACGG - Intergenic
1030172155 7:106613879-106613901 GCAAATGACCTATATGACAAGGG - Intergenic
1030254434 7:107492502-107492524 GCCAGCAACCTAAATGACCAGGG - Intronic
1030529970 7:110700000-110700022 TCCAATAACCTAAATAAGCTTGG + Intronic
1031038340 7:116812688-116812710 TCAAATAACCAAAAGGATCAGGG + Intronic
1031074110 7:117196168-117196190 GGAAATAACCTAAATGTCCATGG - Intronic
1031517232 7:122716439-122716461 GCTAACAGCCTAAAAGAGCAGGG + Intronic
1032236532 7:130129137-130129159 GCACAGAAAGTAAATGAGCAAGG - Intronic
1032273627 7:130434539-130434561 AAAAACAACCTAAATGACCATGG + Intronic
1032686076 7:134235080-134235102 GCAAATAGCCTATAGGGGCAGGG - Intronic
1034199221 7:149271911-149271933 GGAAATACCCTAAATGTCCAAGG - Intronic
1035966270 8:4195775-4195797 GCACACAACCTGAATGAGCTTGG + Intronic
1037436417 8:18868371-18868393 GCAAATAATCTGAATGTGTACGG - Intronic
1038140413 8:24839174-24839196 GCAAATACCCTAAATTATGATGG + Intergenic
1040881528 8:52210270-52210292 GGCAATAATTTAAATGAGCAAGG + Intronic
1041674658 8:60526212-60526234 GCCAACAACCTGAATGAGCCAGG - Intronic
1042351735 8:67783939-67783961 TCCAATGACCTGAATGAGCAAGG - Intergenic
1042409046 8:68441268-68441290 GCCAACAACCCAAATGAGCTTGG - Intronic
1043110378 8:76172155-76172177 TGAAAAATCCTAAATGAGCAAGG - Intergenic
1043231405 8:77806059-77806081 GCAAATATTCTAAATGACCTTGG + Intergenic
1043332528 8:79135032-79135054 GCCAACAACCTACATGAGCTTGG + Intergenic
1043515856 8:80993960-80993982 TTAATGAACCTAAATGAGCATGG - Intronic
1043615589 8:82120945-82120967 GCCAACAACCTGAAAGAGCAAGG - Intergenic
1043752767 8:83961101-83961123 GTCAAAAACCTAAATGAGCTTGG - Intergenic
1043983930 8:86671788-86671810 GCCAATAACCTGAATGAACTTGG + Intronic
1045798314 8:106072177-106072199 GAAAATAAAAGAAATGAGCAAGG - Intergenic
1046141218 8:110095360-110095382 ACAAATAATGTAAATAAGCAAGG + Intergenic
1046576930 8:116041254-116041276 GTAAATAACTTAAATGAAGATGG - Intergenic
1047003539 8:120596567-120596589 GCCAACAACCTAAATGAGCCAGG - Intronic
1047528264 8:125652366-125652388 GCCAACAACCTGAATGAGCTTGG + Intergenic
1047689341 8:127335447-127335469 GCCAACAAACTAAATGAGCTGGG - Intergenic
1049834479 8:144725636-144725658 ACAAATAACCGAAATGAAAAAGG - Intronic
1050566982 9:6895313-6895335 GCCAACAACCCAAAGGAGCAAGG - Intronic
1051159587 9:14191787-14191809 GAAAATAATCTTTATGAGCATGG - Intronic
1051329394 9:16007912-16007934 GCAAATAACCCAATTGAAAATGG - Intronic
1051411898 9:16798337-16798359 CCAAATTACCTAAATTAGAATGG - Intronic
1052016867 9:23479147-23479169 GCAAACAACCTGAATGAACTTGG - Intergenic
1055079081 9:72249694-72249716 ACAAATACTATAAATGAGCAAGG + Intronic
1055699203 9:78923823-78923845 GTAAATAAACCAAATGAACAAGG + Intergenic
1055981014 9:82000661-82000683 ACTAACAACCTGAATGAGCAAGG + Intergenic
1056570439 9:87810067-87810089 GCCAACAACCTAAATGAGCCTGG + Intergenic
1057853342 9:98582372-98582394 GCCAATAACCAGAATGAGCCTGG + Intronic
1057926376 9:99154538-99154560 GCCAACAACCTCAATGAGCTTGG - Intergenic
1057953674 9:99390191-99390213 GTAAGTAAAATAAATGAGCATGG - Intergenic
1058543361 9:106035298-106035320 GCCCATAACCTGAATGAGCTTGG - Intergenic
1058665155 9:107306945-107306967 ACAAATAACCAAAATGAATAAGG + Intronic
1058744074 9:107972807-107972829 GAAATTAACTTATATGAGCAAGG - Intergenic
1059162390 9:112047479-112047501 GCCAATAACCTGAATGAGCTTGG - Intronic
1185855877 X:3534638-3534660 GCAAATAAACTAGAGAAGCATGG + Intergenic
1185914100 X:4016092-4016114 GCAAATAAACTAAAAGTGCATGG + Intergenic
1186060301 X:5698374-5698396 TCAAATAACATACATGAGCAGGG + Intergenic
1186534125 X:10329582-10329604 GCCAACAACCTGAATGAGCTGGG - Intergenic
1186717019 X:12263123-12263145 GCAAACAACCTAAGGGAGAAAGG + Intronic
1187084101 X:16023770-16023792 GCCAACAACCTGAATGAGCTTGG + Intergenic
1188170944 X:26925469-26925491 GCAAATAACTTCAATCAGCAGGG + Intergenic
1188254269 X:27940942-27940964 GCTAACAACCTGAATGAGCTTGG - Intergenic
1188462384 X:30443763-30443785 GGAATCAACCTAAATGAGAAAGG + Intergenic
1188488854 X:30714404-30714426 GCCAATAACCTGAATGAACCTGG - Intronic
1188510410 X:30929946-30929968 GGAAACAACCTAAATGCACATGG + Intronic
1188531714 X:31148452-31148474 GGAAACAACCTAAATGTCCATGG - Intronic
1189023328 X:37365323-37365345 GTAGATAACCTCAAGGAGCATGG + Intronic
1189740110 X:44108891-44108913 GCAAATAACCCAATTTAACATGG - Intergenic
1190562343 X:51697683-51697705 GCCCATAACCTGAATGAGCTGGG + Intergenic
1190567855 X:51749164-51749186 GCAAATAACCAAAATCAGCAAGG + Intergenic
1193614937 X:83675594-83675616 ACAAATAACCCAAATAAGAAAGG + Intergenic
1193651773 X:84144268-84144290 CCAAATAACATATATGATCAAGG + Intronic
1193693449 X:84677694-84677716 ACTAATAACCAAAATGAACAGGG - Intergenic
1193855436 X:86595880-86595902 GCAAATAACTTTAATGAGTATGG - Intronic
1194006045 X:88493419-88493441 GCAAATATCCCTAATGAACATGG - Intergenic
1194266577 X:91760935-91760957 GCCAACAACCTGAATGAGCTTGG - Intergenic
1194425212 X:93728845-93728867 GCCAATAACCTGAATAAGCTTGG - Intergenic
1194556190 X:95363302-95363324 GCCAACAACCTGAATGAGCATGG - Intergenic
1195121946 X:101763658-101763680 GATAATATCCTAAATGGGCATGG + Intergenic
1195231707 X:102856336-102856358 GCAAATAAACTAGATAACCAAGG - Intergenic
1196195420 X:112833923-112833945 GAAAACAACCAAAATGAGTAAGG + Intronic
1196251374 X:113464195-113464217 GCAAAATACCTATATGAGAAGGG - Intergenic
1197011418 X:121569422-121569444 GCCAACAATCTAAATGAGCCTGG + Intergenic
1198159672 X:133995145-133995167 GAAAACAACCTAAATGACAATGG + Intergenic
1199287848 X:146073789-146073811 GCCAACAAACTAAATGAGCTTGG + Intergenic
1199432944 X:147781232-147781254 GCCAACAACCTAAATGAGCCTGG - Intergenic
1199785476 X:151101430-151101452 GCCAACAACCTGAATGAGCTTGG + Intergenic
1200583783 Y:4981849-4981871 GCCAACAACCTGAATGAGCTTGG - Intergenic
1201855575 Y:18536738-18536760 ATAAATAACCTAAATAAGTATGG - Intergenic
1201877746 Y:18783647-18783669 ATAAATAACCTAAATAAGTATGG + Intronic