ID: 1119966255

View in Genome Browser
Species Human (GRCh38)
Location 14:78919024-78919046
Sequence CTAGTTTACCAATTATATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 291}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119966255 Original CRISPR CTAGTTTACCAATTATATTT GGG (reversed) Intronic
904902293 1:33866942-33866964 CTATATTACCTATTAGATTTAGG - Intronic
905161015 1:36034277-36034299 CGAGTTTAACATTTATCTTTAGG - Exonic
907632190 1:56093809-56093831 TCACTTTACCAATTCTATTTTGG + Intergenic
909756474 1:79231855-79231877 CTACTTTACCATTTGTAATTAGG - Intergenic
910030490 1:82715854-82715876 ATATTTTACTATTTATATTTAGG - Intergenic
910441698 1:87259635-87259657 ATAGTTTAGCTCTTATATTTAGG + Intergenic
911149891 1:94588490-94588512 CTTGCTTATTAATTATATTTGGG - Intergenic
911285959 1:95992621-95992643 CTGGTTTACCAAGTTTATCTGGG + Intergenic
914378408 1:147093869-147093891 TTATTTTACCTATTCTATTTAGG + Intergenic
914895258 1:151665439-151665461 ATAGTTTGTCAATTATATTCTGG - Intronic
915336154 1:155143338-155143360 CTAGTTCAACAAATATTTTTCGG - Intergenic
915664938 1:157435671-157435693 CTAATTTCCCAATTGGATTTTGG - Intergenic
916050894 1:161036408-161036430 CTTTTTAACCAATTAAATTTTGG + Intronic
916238765 1:162617589-162617611 CTAGATTACCAAGAATATGTAGG + Intergenic
916834944 1:168533924-168533946 CTAGTTTACTCATTTGATTTGGG - Intergenic
916835498 1:168540735-168540757 CTAGTCTATTCATTATATTTAGG - Intergenic
916839101 1:168581415-168581437 CTAGTCTATTCATTATATTTAGG + Exonic
917756457 1:178104273-178104295 CAAGATTGCCATTTATATTTTGG + Intronic
921883978 1:220285928-220285950 CCAGTTTATTAATTATCTTTTGG + Intergenic
922413815 1:225400954-225400976 CAAGTATACGATTTATATTTTGG - Intergenic
923178029 1:231487073-231487095 CTTGTTTACCAATTGCATATGGG - Intergenic
924445019 1:244121174-244121196 CAAACTTACCATTTATATTTGGG - Intergenic
924898358 1:248367754-248367776 TTAATTTTGCAATTATATTTCGG + Intergenic
1063215219 10:3918981-3919003 TTAGTTGACCACATATATTTAGG + Intergenic
1063537852 10:6902536-6902558 ATTGTTTAACAATAATATTTTGG - Intergenic
1065258630 10:23901532-23901554 CTAAGTCACCAATTAAATTTTGG - Intronic
1065330592 10:24593528-24593550 CTATTTTACCAGTTTTATGTAGG - Intronic
1066505925 10:36042942-36042964 ATAGTTTAACACTTACATTTAGG + Intergenic
1066609388 10:37223580-37223602 CTTTTTTACCAAATAAATTTTGG + Intronic
1068558753 10:58488032-58488054 CTATTTTTCTATTTATATTTTGG - Intergenic
1068581061 10:58740323-58740345 ATAATTTAGAAATTATATTTTGG + Intronic
1068645298 10:59459602-59459624 ATAGTTTAGCCCTTATATTTAGG + Intergenic
1069182424 10:65378298-65378320 CAGTTTTACCATTTATATTTAGG - Intergenic
1071273290 10:84028655-84028677 CTTGTTCAGAAATTATATTTCGG + Intergenic
1072052153 10:91715654-91715676 CTAGTTTATTAATTGTATTGTGG - Intergenic
1074677741 10:115871079-115871101 CTAGGATCCCAATAATATTTCGG + Intronic
1075073840 10:119337139-119337161 TTATTTTACCTTTTATATTTGGG + Intronic
1075451455 10:122554596-122554618 CTGGTTTACCAATTAGTGTTTGG + Intergenic
1077645038 11:3916176-3916198 ATGGTTTAGCACTTATATTTAGG + Intronic
1078694127 11:13612720-13612742 CTATTTTGTCAATTATACTTTGG - Intergenic
1079293106 11:19206673-19206695 CTGGTTTTTCAACTATATTTGGG + Intronic
1079299930 11:19268938-19268960 CTAGTTTACCAAGTAAAATTTGG - Intergenic
1082664203 11:55953454-55953476 CTACTTTACTATTTGTATTTTGG - Intergenic
1084366279 11:68702576-68702598 ATAGTTTACAACTTACATTTAGG - Intergenic
1086242609 11:84714028-84714050 CTAGTTTCCCAGTACTATTTTGG - Intronic
1086611768 11:88765707-88765729 ATAATTTAAGAATTATATTTAGG - Intronic
1089027296 11:115284462-115284484 CTACTTTACCAATTATTTAAAGG + Intronic
1089477179 11:118773991-118774013 ATAGTTTACTATTTATAGTTAGG - Intronic
1090177828 11:124667089-124667111 TTAAGTTACCAATAATATTTAGG - Intronic
1090271007 11:125386241-125386263 CTAGTTGACAAATTAGGTTTGGG - Intronic
1090553717 11:127851224-127851246 CTAGTTCACCCACTATTTTTTGG + Intergenic
1094059966 12:26303085-26303107 CAAGTTTACCCATTTTGTTTTGG + Intergenic
1094344842 12:29456042-29456064 CTAGTATTCCAATTTTATTTTGG + Intronic
1095206001 12:39442098-39442120 CTAGTATTGAAATTATATTTCGG - Intronic
1095460513 12:42439162-42439184 ATAGTTTTGCATTTATATTTAGG + Intronic
1097216826 12:57420659-57420681 CTAGTTTTCCATCTATCTTTAGG + Intronic
1097762639 12:63485589-63485611 CTAGTTTACTACTCACATTTAGG - Intergenic
1098002350 12:65958744-65958766 CTAGATTACCAAGTATTTGTAGG + Intronic
1098267929 12:68741708-68741730 CTTGTCTACCAATTACATTCTGG + Intronic
1099447996 12:82775038-82775060 CTGGTTTACTAATGACATTTTGG - Intronic
1099745460 12:86697204-86697226 CTACTTTAGCGAATATATTTAGG - Intronic
1100820509 12:98425170-98425192 CTAGTTTACCAATAACAATGCGG + Intergenic
1104266085 12:127233730-127233752 CTATTTAACCAATTACATTCTGG - Intergenic
1106278542 13:28240106-28240128 CTAGTTTAGTGAGTATATTTTGG + Intronic
1109625625 13:64969991-64970013 CATGTTCACCAATGATATTTGGG + Intergenic
1110136048 13:72068408-72068430 TTATTTTAAAAATTATATTTGGG + Intergenic
1110661071 13:78059921-78059943 CAAGAATACCAATTATTTTTAGG + Intergenic
1110853925 13:80276805-80276827 CTAGGTTACCGCTTATATTGAGG + Intergenic
1111784814 13:92772950-92772972 CTAGTTTTCTTATTATATTTTGG - Intronic
1112802050 13:103123666-103123688 CTAGTCTCTCAATTACATTTTGG - Intergenic
1113487154 13:110662548-110662570 CTAATTTACCAATTTAATTGAGG + Intronic
1114372359 14:22103893-22103915 TTATTTCTCCAATTATATTTTGG + Intergenic
1114697456 14:24640168-24640190 CTAGTTTTGCAATCATATATTGG - Intergenic
1115665351 14:35539204-35539226 CTAATTGTCCAATTGTATTTTGG + Exonic
1117471689 14:56052471-56052493 CAAGTTTCCCAACAATATTTTGG - Intergenic
1118105742 14:62657471-62657493 CTAGTTTTTCAGATATATTTAGG - Intergenic
1119014365 14:71034957-71034979 CTATTTTACTTATTAGATTTTGG - Intronic
1119966255 14:78919024-78919046 CTAGTTTACCAATTATATTTGGG - Intronic
1125172976 15:36787599-36787621 TTAGTTAACCAAATAGATTTTGG - Intronic
1125918890 15:43512698-43512720 CTTGTTTAGCATTTTTATTTAGG + Intronic
1126133074 15:45362812-45362834 CTATTTAACCAATGGTATTTAGG + Intronic
1126426375 15:48530896-48530918 CTAATTAACCACTAATATTTTGG - Intronic
1127442498 15:59023984-59024006 TCAGTTTACCAATAATATATAGG + Intronic
1128953741 15:71917049-71917071 CTAGCTTTCTAATTACATTTAGG + Intronic
1129136091 15:73553228-73553250 TTAGTTTACCAAACAGATTTTGG + Intronic
1130365666 15:83236087-83236109 TGAGTTTACCTATTATTTTTTGG + Intergenic
1131658835 15:94492250-94492272 ATAGTTTACCAAATATGTGTGGG - Intergenic
1132922766 16:2407484-2407506 ATAGTTTCTCAATTTTATTTTGG - Intergenic
1133499481 16:6352253-6352275 CTAGTTTATAAATGCTATTTAGG + Intronic
1137595935 16:49723861-49723883 CTAGATTTCCAGTTGTATTTGGG + Intronic
1138239287 16:55413638-55413660 TTAGTGTACTAATTACATTTTGG - Intronic
1138627092 16:58261080-58261102 CTAGTTTACCAATTATTTCAAGG - Intronic
1139023802 16:62788033-62788055 ACAATTTACCAATCATATTTGGG - Intergenic
1139892493 16:70262630-70262652 CTAATTGTCCAATTGTATTTTGG + Intronic
1141062474 16:80886407-80886429 GTATGTTACCATTTATATTTTGG - Intergenic
1141534165 16:84667664-84667686 TTAATTTCCAAATTATATTTAGG - Intronic
1147471268 17:40664158-40664180 TTAGTTTACCTATCATATATGGG - Intronic
1149039230 17:52168028-52168050 CTTATTTACTATTTATATTTTGG + Intergenic
1149873830 17:60209664-60209686 CTATTTCAACAAATATATTTTGG + Intronic
1150087610 17:62286924-62286946 CTATTTCAACAAATATATTTTGG + Intergenic
1154226202 18:12506763-12506785 CTATTTTAAAAATTAGATTTTGG + Intronic
1156020261 18:32592120-32592142 GTAGTTTAACAATTAGATTCAGG + Intergenic
1156605954 18:38667595-38667617 GTACTTTATCTATTATATTTGGG + Intergenic
1158381587 18:56936398-56936420 CTAGTTTTCCAGTTAGATGTGGG - Intronic
1159141551 18:64401849-64401871 TTAGTTTACAAATTATACCTTGG + Intergenic
1160252553 18:77215976-77215998 CTATTTTACTTAATATATTTTGG + Intergenic
1165411338 19:35664056-35664078 CTAGATTTCCAAGAATATTTTGG + Intergenic
1165640584 19:37382595-37382617 CAAATTTACCAACTAGATTTAGG + Intronic
927463027 2:23315741-23315763 CTGGCTTAATAATTATATTTCGG + Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
930413751 2:51062592-51062614 CAATTTTAACACTTATATTTAGG - Intergenic
931616878 2:64168149-64168171 CTAGTTTCCTCACTATATTTAGG - Intergenic
931714408 2:65017693-65017715 ATAGTTTACCATTTACTTTTGGG + Intronic
931825628 2:65997742-65997764 CTAGATTATCTAATATATTTTGG + Intergenic
932739047 2:74277765-74277787 CTAGATAACCAATTATAGTAAGG + Intronic
933115380 2:78462963-78462985 AGAGTTTACCTAATATATTTTGG - Intergenic
933116133 2:78474678-78474700 CAAATTTAACAATTAGATTTGGG - Intergenic
934306982 2:91834180-91834202 CTATTATTTCAATTATATTTTGG + Intergenic
934326274 2:92018562-92018584 CTATTATTTCAATTATATTTTGG - Intergenic
935464013 2:103373589-103373611 CTAGTTTAACAATAATTTCTGGG + Intergenic
938684701 2:133726959-133726981 CCAGTTTTCCAATTAAATCTTGG - Intergenic
939294933 2:140249516-140249538 CTATTTTACTTATTATATATTGG + Intronic
939874197 2:147557817-147557839 AGACTTTACCAATTATAGTTAGG - Intergenic
939908467 2:147949625-147949647 CTAATATAACAATTATATTAGGG + Intronic
941210609 2:162633627-162633649 TCAGTTTACCATTTCTATTTGGG - Intronic
941557633 2:167002143-167002165 ATAGTTATACAATTATATTTTGG - Intronic
941850379 2:170174137-170174159 CTACTTTCCTAATCATATTTTGG - Intergenic
944623912 2:201549923-201549945 ATAGGCTACCAATGATATTTAGG + Intronic
946466983 2:219920751-219920773 ATAGTTCACCCAGTATATTTTGG - Intergenic
947491549 2:230599753-230599775 CTAGTTGACCATGTATATATGGG - Intergenic
1169887116 20:10411914-10411936 GTATATTACCAAATATATTTCGG + Intronic
1171077548 20:22144121-22144143 TAAGTTTAACAATCATATTTTGG + Intergenic
1171955246 20:31456962-31456984 CCAGTTTCCCAAATAAATTTGGG + Intergenic
1173071382 20:39770878-39770900 ACATTTTACCAATAATATTTTGG + Intergenic
1173366767 20:42392999-42393021 CACTTTTTCCAATTATATTTTGG - Intronic
1176333780 21:5576760-5576782 CTAGTTCACTCATTATACTTGGG + Intergenic
1176393977 21:6244192-6244214 CTAGTTCACTCATTATACTTGGG - Intergenic
1176467442 21:7071982-7072004 CTAGTTCACTCATTATACTTGGG + Intronic
1176491003 21:7453760-7453782 CTAGTTCACTCATTATACTTGGG + Intergenic
1176509639 21:7684623-7684645 CTAGTTCACTCATTATACTTGGG - Intergenic
1177709536 21:24754212-24754234 CTAATTTTCCCATTCTATTTTGG + Intergenic
1178170884 21:30038623-30038645 CTTGTTTCCAAATCATATTTGGG - Intergenic
1178979472 21:37250512-37250534 CTAGTTTATCATTTATATAGTGG - Intronic
1180585787 22:16888331-16888353 CTATTATTTCAATTATATTTTGG - Intergenic
951413128 3:22389376-22389398 TTAGTTTACCTCTTACATTTTGG - Intergenic
951425248 3:22537098-22537120 CTTGTTTACCAATTGCACTTTGG - Intergenic
954015828 3:47689881-47689903 CTAGTTTACAAATTTTACCTGGG - Intronic
955612680 3:60774598-60774620 CTAATTTATAAATTAAATTTTGG - Intronic
956465398 3:69515802-69515824 CTAATTTAGCAATCTTATTTCGG - Intronic
956676836 3:71742422-71742444 ATATTTTACCAAGTACATTTTGG - Intronic
957175585 3:76803622-76803644 CTATTTTATCAATTTTATTCAGG + Intronic
958104464 3:89054390-89054412 TTAGTTTACCAAATAATTTTTGG + Intergenic
959379414 3:105624294-105624316 TTTATTTACCAATTGTATTTGGG - Intergenic
959668946 3:108953036-108953058 ATAGTTTACCAATTTAGTTTGGG - Intronic
960655739 3:120002302-120002324 ATAGTTTACCTTGTATATTTTGG - Intronic
961989746 3:131175765-131175787 TTAATTTATCAATTTTATTTAGG - Intronic
962237230 3:133716963-133716985 CTAGTTTCCTCATTTTATTTAGG + Intergenic
963366029 3:144335639-144335661 ACATTTTTCCAATTATATTTTGG - Intergenic
963677845 3:148335242-148335264 CTAGGTCACCAATTCTGTTTGGG - Intergenic
964914320 3:161821141-161821163 CAAATTTAGCAATTGTATTTAGG - Intergenic
965176405 3:165339858-165339880 CCAGATTAACAAGTATATTTTGG - Intergenic
965381730 3:167997830-167997852 GTAGTTAAGCAATTACATTTAGG - Intergenic
966830570 3:184004530-184004552 TTCATTTACAAATTATATTTTGG - Intronic
967386217 3:188913602-188913624 CTTTTTTTCCAATTTTATTTTGG - Intergenic
967839190 3:193990941-193990963 CTAGTTACCCAAATATATTTGGG - Intergenic
970130824 4:12868530-12868552 CATGTTTACCAAATATAATTAGG + Intergenic
971138051 4:23891384-23891406 ATGCTTTACAAATTATATTTAGG - Intronic
971282414 4:25251685-25251707 CTAGTTCCCCAATCATATCTCGG - Intronic
974172733 4:58288284-58288306 CTAGTTTACCTATTAAAACTTGG - Intergenic
974519868 4:62970048-62970070 GTTGTTTATGAATTATATTTAGG + Intergenic
974685705 4:65225423-65225445 CTAGTCTATCATTTATACTTAGG - Intergenic
974977567 4:68909386-68909408 CTAATTTATCAATTTTATTTTGG + Intergenic
974987711 4:69050260-69050282 CTAATTTATCAATTTTATTTTGG - Intronic
975080933 4:70280135-70280157 CTAGTTTATCAAGTTTATCTAGG - Intergenic
976008763 4:80461726-80461748 GTGGTTTACCAGTTATATTCAGG + Intronic
976456257 4:85250147-85250169 CTTGTTTATCCATAATATTTTGG - Intergenic
978680340 4:111373501-111373523 CTAGTTTTTCAATGTTATTTAGG - Intergenic
980500937 4:133652892-133652914 GTAATTTACAAAATATATTTTGG + Intergenic
980622478 4:135326153-135326175 CTTGTTTTCCAATTACTTTTAGG + Intergenic
982029813 4:151289249-151289271 ATAGTTTAGCTCTTATATTTAGG - Intronic
982368233 4:154604069-154604091 CCAATTTACCAATTACAATTGGG - Intergenic
982493277 4:156056953-156056975 TTAGTTTTCCAATTCTTTTTGGG + Intergenic
982617973 4:157665873-157665895 TTGGTTTACCTATTACATTTAGG - Intergenic
982795497 4:159638911-159638933 CTATTCTCCCATTTATATTTGGG + Intergenic
983539372 4:168892032-168892054 ATATTTTACCAAATCTATTTAGG - Intronic
984116239 4:175684232-175684254 CTAGTTTGCCATTTGTCTTTTGG + Intronic
984472913 4:180199865-180199887 GTAGTTTTAAAATTATATTTTGG - Intergenic
984749330 4:183256749-183256771 CCTGTTTTCCACTTATATTTGGG + Intronic
985023944 4:185720682-185720704 ACAGTTTGCAAATTATATTTTGG + Intronic
985164384 4:187077148-187077170 CTAATTATCCAAATATATTTGGG - Intergenic
987491078 5:18581061-18581083 CTATTATGCCCATTATATTTAGG + Intergenic
987581766 5:19803792-19803814 CTAGTTTATCAATCATTTCTAGG - Intronic
987835031 5:23149685-23149707 CTAATTTACTATGTATATTTAGG + Intergenic
987917425 5:24232391-24232413 ATAGTTTACTAATTATACTCTGG + Intergenic
988165339 5:27581941-27581963 TTAGTTTTCCATTTTTATTTGGG + Intergenic
989289170 5:39741704-39741726 CTAATTTAAAAATCATATTTTGG + Intergenic
989529019 5:42485090-42485112 CAAGTTTACCCATTATTTTCAGG + Intronic
989621575 5:43389662-43389684 CCAGTTTACTAAGTATATATAGG - Intronic
990256599 5:53977018-53977040 CTAGTTTTCACATTATAATTTGG - Intronic
991114599 5:62939429-62939451 CAAAAGTACCAATTATATTTGGG - Intergenic
993036675 5:82766523-82766545 CTATTTTAGCTTTTATATTTAGG + Intergenic
993411064 5:87573742-87573764 CAAATTTATCAATTATACTTGGG + Intergenic
995374573 5:111459574-111459596 AAAGTTAACCAAATATATTTTGG + Intronic
995375076 5:111464748-111464770 AAAGTTAACCAAATATATTTTGG - Intronic
996268836 5:121577964-121577986 CTTGTTTATTAGTTATATTTAGG + Intergenic
996300397 5:121976064-121976086 CATGTTTGCCTATTATATTTTGG + Intronic
997041303 5:130258246-130258268 CTATGTTTCCAATTAAATTTGGG + Intergenic
998489608 5:142534973-142534995 CTATTTTACCTATAACATTTAGG + Intergenic
998524308 5:142828420-142828442 CTAGTTTACCACCTACATGTTGG - Intronic
999333607 5:150695842-150695864 CTATTTTGGTAATTATATTTTGG - Intronic
1003721902 6:8712703-8712725 TTTGTTTACCAATTCCATTTTGG + Intergenic
1003756322 6:9125152-9125174 TTACTTTACAAATTACATTTAGG - Intergenic
1003779702 6:9410599-9410621 CTAATGTACCATTCATATTTAGG + Intergenic
1004216130 6:13705984-13706006 TTAGATAAGCAATTATATTTAGG + Intronic
1004407798 6:15350861-15350883 CTAGGTTGCCAAAAATATTTGGG - Intronic
1008728663 6:54453063-54453085 CTATTTTGCCAAAAATATTTAGG - Intergenic
1008855031 6:56073729-56073751 CAAGCTTAACAAATATATTTAGG - Intronic
1008969028 6:57345584-57345606 GTAGTTTACCATTTACATTATGG + Intronic
1009341528 6:62560542-62560564 GTAGTCTACAAATCATATTTTGG + Intergenic
1009798303 6:68501203-68501225 CTAATATACCAATAATCTTTAGG - Intergenic
1010277580 6:73987825-73987847 CTAGTTTTCTCAGTATATTTTGG - Intergenic
1010705860 6:79109985-79110007 CTCCTTTTCCAATTATATGTTGG + Intergenic
1010923130 6:81709312-81709334 TTAATTTACCAATTATTTTCTGG + Intronic
1013754360 6:113443604-113443626 CTAGTTTACCTGTTCCATTTAGG - Intergenic
1014529964 6:122547086-122547108 TTTATTTACCATTTATATTTTGG + Intronic
1015712163 6:136154018-136154040 CTAGTATACCACTCCTATTTGGG + Intronic
1017217660 6:151928780-151928802 ATAGTTTACCATTTATTTTGAGG + Intronic
1018310263 6:162501207-162501229 CTAGTTTAGAATTTATCTTTTGG - Intronic
1018364535 6:163104799-163104821 TGTGTTTACCTATTATATTTGGG - Intronic
1020786820 7:12583961-12583983 CTTGGTTATCAATTATATTCTGG + Intronic
1022967917 7:35490954-35490976 CTAGTTTACCCTTCATATATTGG - Intergenic
1023140095 7:37093265-37093287 CTGAAATACCAATTATATTTTGG - Intronic
1024391737 7:48821340-48821362 CTAGTTCACTAATTTTTTTTTGG - Intergenic
1026291804 7:69013737-69013759 GTACTTGTCCAATTATATTTTGG + Intergenic
1028118845 7:87034266-87034288 CAAGCTTACCAATTAGAGTTAGG + Intronic
1028701349 7:93784362-93784384 CCAGCTTTCCAATTATAATTAGG + Intronic
1030248882 7:107419288-107419310 CTATTTGTCTAATTATATTTAGG - Intronic
1030492611 7:110256630-110256652 CTAATATACCAATAATATTTGGG + Intergenic
1030768636 7:113443719-113443741 CTAATTCAACAAATATATTTAGG + Intergenic
1031259299 7:119497047-119497069 CCAGTTTTTCAATTGTATTTTGG - Intergenic
1031526316 7:122825247-122825269 CTATTTTACAAAGTGTATTTTGG - Intronic
1031710361 7:125037369-125037391 CTAGTTTACCACTTATCTGTAGG + Intergenic
1032569248 7:132982707-132982729 CTATTAAATCAATTATATTTCGG + Intronic
1032942082 7:136805685-136805707 TTAATTTATCAATTAGATTTGGG - Intergenic
1033018010 7:137691647-137691669 CAACTTTACAAATTATTTTTTGG - Intronic
1033334775 7:140443204-140443226 TTAATTTATCAACTATATTTTGG + Intergenic
1033350935 7:140561453-140561475 ATAGGTTAGCCATTATATTTAGG - Intronic
1033765288 7:144482881-144482903 CTAGTTTAGCCATTATAATCAGG + Intronic
1034634419 7:152555862-152555884 CTAGTTTAGAAAATATATTGTGG - Intergenic
1035917287 8:3638508-3638530 CTGAATTACCAAATATATTTAGG - Intronic
1038342046 8:26694434-26694456 ATAGTTTTGCATTTATATTTGGG + Intergenic
1038818080 8:30926762-30926784 CTATATTACTATTTATATTTTGG - Intergenic
1038971693 8:32643839-32643861 TTTGTTTACAAATTATATTAAGG + Intronic
1039727940 8:40240992-40241014 CAAGCTCACCAATTATTTTTTGG + Intergenic
1039763088 8:40599471-40599493 CAAGTTTTCCAATTTTATCTGGG - Intronic
1039770530 8:40682177-40682199 TTATTTTACCATTTATATATAGG + Intronic
1041091425 8:54304670-54304692 CTAGTTTCCTAAATATATCTAGG + Intergenic
1041563183 8:59244229-59244251 TTAGTTGACCATATATATTTGGG - Intergenic
1041750694 8:61257902-61257924 CTAGTTTACAAAATATGTATTGG + Intronic
1043282258 8:78482877-78482899 CTTGTCTACAAAGTATATTTTGG + Intergenic
1043615848 8:82124674-82124696 CTAGTTTAGAAAATAGATTTGGG - Intergenic
1043647692 8:82541910-82541932 ATAGGTTACGAATTACATTTTGG + Intergenic
1045902885 8:107306249-107306271 ATAGTTGACTAGTTATATTTAGG + Intronic
1046239077 8:111467058-111467080 CTTATTTCCAAATTATATTTAGG + Intergenic
1046545591 8:115646008-115646030 TAATTTTAACAATTATATTTAGG - Intronic
1047042152 8:121007962-121007984 CAAGTTTAGAAATTATGTTTAGG - Intergenic
1047689440 8:127336245-127336267 CTAGCTTACCAATTCTTTCTGGG - Intergenic
1048159053 8:131994539-131994561 TTTGTTTAACAATTATAATTAGG + Intronic
1048226142 8:132587658-132587680 CTAATTTACTAAGCATATTTTGG - Intronic
1050759810 9:9053872-9053894 CTAGTTATCCATTTAGATTTTGG - Intronic
1051310725 9:15768119-15768141 CTAGGTTACAGATAATATTTGGG - Intronic
1051709490 9:19916029-19916051 CAGGTTTAGCACTTATATTTTGG + Intergenic
1052396686 9:27947552-27947574 CTTCCTTACCAATTAGATTTTGG - Intergenic
1052696934 9:31889858-31889880 CTAGATTACCACTTATAAATTGG + Intergenic
1053513922 9:38713176-38713198 CTAGTTCAAGAATTAGATTTCGG + Intergenic
1054752259 9:68919659-68919681 CAATTTTTCCATTTATATTTAGG + Exonic
1054821790 9:69529585-69529607 CTAGTTCACTAATTTCATTTTGG + Intronic
1055163146 9:73156469-73156491 TAAGTCTATCAATTATATTTAGG + Intronic
1056738702 9:89234220-89234242 ATAGTGTACTAATTATATTTTGG + Intergenic
1057003805 9:91537836-91537858 CTAACTTACCAATTATATCCAGG + Intergenic
1057155495 9:92834901-92834923 TTAGTTAAATAATTATATTTAGG + Intergenic
1058493379 9:105526846-105526868 CTAATTGTCCAATTGTATTTTGG - Intronic
1059230027 9:112711837-112711859 TTAGTTTATTAGTTATATTTAGG - Intronic
1059874272 9:118616742-118616764 CTGCTTTACCCATTCTATTTAGG + Intergenic
1186312777 X:8338758-8338780 CAAGTTTACCAATGAGATTGAGG + Intergenic
1186328523 X:8507230-8507252 CTAGTTTTCCAGGTAAATTTTGG + Intergenic
1186587144 X:10887254-10887276 ATAGGTCACCAATTATATTGTGG - Intergenic
1188517362 X:31001950-31001972 CTTGTTGACAAATTATATCTTGG + Intergenic
1188767721 X:34116932-34116954 ATAGTTTAGCATTTACATTTAGG - Intergenic
1189076420 X:37920262-37920284 GTATTTTACCAAAAATATTTGGG + Intronic
1189194253 X:39139136-39139158 TTAGTTTAACAGTTCTATTTTGG - Intergenic
1190435026 X:50415743-50415765 CTAGTTCACCATTTCTATTTTGG + Intronic
1193688873 X:84614249-84614271 TCAGATTACCAATTTTATTTTGG - Intergenic
1194391954 X:93329934-93329956 CTAGTTTAGCTGTAATATTTTGG - Intergenic
1194578931 X:95647157-95647179 CTCATTTTCCATTTATATTTGGG - Intergenic
1195277698 X:103298451-103298473 ATAGTCTACCAAATATATTTGGG + Intergenic
1195281893 X:103343878-103343900 ATAATTTAAAAATTATATTTAGG + Intergenic
1195331088 X:103801235-103801257 CTTGTTTACCATTTATAGTAGGG + Intergenic
1195556052 X:106225755-106225777 ATAGTTTTCCTGTTATATTTGGG - Intergenic
1196064589 X:111448939-111448961 ATAGTTTAACACTTACATTTAGG - Intergenic
1198223289 X:134622508-134622530 CTAGTTTACCCATCCGATTTTGG - Intronic
1198716695 X:139565394-139565416 CTTGTTTAGCAATTATAATTAGG - Intergenic
1199060131 X:143345652-143345674 GTATTTGACCAAATATATTTTGG + Intergenic
1199296490 X:146164809-146164831 ATAATTTACCAATTATCTTGGGG - Intergenic
1199392267 X:147294402-147294424 CTACTTTAGCTATTATATTTTGG + Intergenic
1201433780 Y:13933699-13933721 CTAGTTTTCCAGGTAAATTTTGG - Intergenic