ID: 1119967031

View in Genome Browser
Species Human (GRCh38)
Location 14:78928191-78928213
Sequence GCTCCCAAATCCTTGTCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 3, 1: 3, 2: 26, 3: 83, 4: 377}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119967027_1119967031 -5 Left 1119967027 14:78928173-78928195 CCCCCAAATAAATGACATGCTCC 0: 1
1: 0
2: 2
3: 18
4: 158
Right 1119967031 14:78928191-78928213 GCTCCCAAATCCTTGTCTCAAGG 0: 3
1: 3
2: 26
3: 83
4: 377
1119967021_1119967031 27 Left 1119967021 14:78928141-78928163 CCCCACTTCCTCAATTTGCTCTC 0: 1
1: 0
2: 2
3: 29
4: 360
Right 1119967031 14:78928191-78928213 GCTCCCAAATCCTTGTCTCAAGG 0: 3
1: 3
2: 26
3: 83
4: 377
1119967022_1119967031 26 Left 1119967022 14:78928142-78928164 CCCACTTCCTCAATTTGCTCTCT 0: 1
1: 1
2: 3
3: 37
4: 441
Right 1119967031 14:78928191-78928213 GCTCCCAAATCCTTGTCTCAAGG 0: 3
1: 3
2: 26
3: 83
4: 377
1119967030_1119967031 -8 Left 1119967030 14:78928176-78928198 CCAAATAAATGACATGCTCCCAA 0: 1
1: 1
2: 3
3: 34
4: 243
Right 1119967031 14:78928191-78928213 GCTCCCAAATCCTTGTCTCAAGG 0: 3
1: 3
2: 26
3: 83
4: 377
1119967026_1119967031 19 Left 1119967026 14:78928149-78928171 CCTCAATTTGCTCTCTGGGATCT 0: 1
1: 0
2: 3
3: 19
4: 224
Right 1119967031 14:78928191-78928213 GCTCCCAAATCCTTGTCTCAAGG 0: 3
1: 3
2: 26
3: 83
4: 377
1119967023_1119967031 25 Left 1119967023 14:78928143-78928165 CCACTTCCTCAATTTGCTCTCTG 0: 1
1: 0
2: 1
3: 33
4: 496
Right 1119967031 14:78928191-78928213 GCTCCCAAATCCTTGTCTCAAGG 0: 3
1: 3
2: 26
3: 83
4: 377
1119967028_1119967031 -6 Left 1119967028 14:78928174-78928196 CCCCAAATAAATGACATGCTCCC 0: 1
1: 0
2: 0
3: 10
4: 160
Right 1119967031 14:78928191-78928213 GCTCCCAAATCCTTGTCTCAAGG 0: 3
1: 3
2: 26
3: 83
4: 377
1119967029_1119967031 -7 Left 1119967029 14:78928175-78928197 CCCAAATAAATGACATGCTCCCA 0: 1
1: 1
2: 3
3: 34
4: 272
Right 1119967031 14:78928191-78928213 GCTCCCAAATCCTTGTCTCAAGG 0: 3
1: 3
2: 26
3: 83
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119967031 Original CRISPR GCTCCCAAATCCTTGTCTCA AGG Intronic
900078494 1:836814-836836 GCACTCCAATCCTTGTCACAGGG + Intergenic
900649447 1:3723797-3723819 TCTCCCAAATCCCTGTGTCTGGG - Intronic
902198042 1:14812729-14812751 GGTCTCAAATCCTGGCCTCAAGG + Intronic
902683726 1:18061953-18061975 GCACTCAAATCCTTGTCTTAGGG + Intergenic
902714297 1:18261817-18261839 GTACTCAAATCCTTGTCTGAGGG - Intronic
902719781 1:18296225-18296247 CCTCCTAAATCCTTGTTTCAAGG + Intronic
902733927 1:18387649-18387671 GCACCCAAATCCCTATCTCAGGG - Intergenic
903112045 1:21143981-21144003 GTTTCCAACTCCTGGTCTCAAGG + Intronic
903267683 1:22167774-22167796 GCCCCCAACTCCTGGGCTCAAGG - Intergenic
903446880 1:23428143-23428165 GCTCCCAAATCCTTGTCTCAGGG + Intergenic
903589144 1:24441038-24441060 GCTCCCACATTCTTGTCTCAGGG + Intronic
903735021 1:25524419-25524441 GCTCTCTCATCCTTGTCTCCGGG - Intergenic
906394182 1:45446376-45446398 GCTTCCAGCTCCTTGGCTCAAGG - Intronic
907273885 1:53306376-53306398 ACTCCCACATCCTTTTCTCCAGG + Intronic
907388594 1:54141750-54141772 GCACTCAAATCCTTATCTCAAGG - Intronic
907682132 1:56574330-56574352 GCCTCCAACTCCTAGTCTCAAGG + Intronic
908806157 1:67935569-67935591 GCTCCCAAATCCTCAGCTCAGGG - Intergenic
908954045 1:69599644-69599666 GCTCCCAATTCCTTGGTTCTGGG + Intronic
910205563 1:84745727-84745749 GCCACCACATCCTTGGCTCATGG - Intergenic
911557300 1:99360543-99360565 GCACCTACATCTTTGTCTCAAGG - Intergenic
915253713 1:154609136-154609158 GCTGCCAAATCCAGGTCTGAAGG + Intronic
915704263 1:157828755-157828777 GCACCTAAGTCCTTGTTTCAAGG + Intergenic
916854694 1:168737531-168737553 GCACCCTAATCCTGCTCTCAGGG + Intergenic
917253318 1:173086957-173086979 ACTCCAAATTCTTTGTCTCAAGG + Intergenic
919859152 1:201727610-201727632 GCACCCAAATCCTTGTCTCAAGG - Intronic
920584738 1:207146612-207146634 GCTCACAAATTCTTGTATCAGGG - Intergenic
920589455 1:207203014-207203036 GCTCACAAATCCTTGTCTCAGGG - Intergenic
920710725 1:208292310-208292332 GCTCACAATTCCTTGCCACATGG - Intergenic
921096937 1:211894870-211894892 GCTCCCAAATCCTTATTTTTTGG - Intergenic
921099420 1:211915572-211915594 CCTCCTACACCCTTGTCTCAAGG + Intergenic
922870696 1:228899771-228899793 GCCCCCAAACTCCTGTCTCAGGG - Intergenic
923301256 1:232642770-232642792 GCTCCCAAACCCTGTCCTCATGG - Intergenic
1063109322 10:3020852-3020874 GAACCCAAATCCTTGCCTCAGGG + Intergenic
1063339006 10:5245222-5245244 ACTCCCATATCCTAGTTTCAAGG + Intergenic
1063613877 10:7585802-7585824 GCTTTCAAATCCTTATCTCTTGG + Intronic
1064209917 10:13352959-13352981 TCTCCCTAATCCTTGTCTCCAGG - Intergenic
1064229511 10:13517659-13517681 GCTTCCAACTCCTGGGCTCAAGG - Intronic
1064402204 10:15030803-15030825 GCCTCCAACTCCTTGGCTCAGGG - Intergenic
1064823113 10:19362136-19362158 GCTCTTAAATTCTTGACTCACGG - Intronic
1065849266 10:29773420-29773442 GCGCTCAAATCCTTGTATTACGG - Intergenic
1066011258 10:31195539-31195561 GCACTCAAATCCTTGTTTCAAGG + Intergenic
1066179169 10:32942931-32942953 GCTTCCAACTCCTGGACTCATGG - Intronic
1066250002 10:33624147-33624169 GCTCCCCAATCCCTCACTCATGG - Intergenic
1067385099 10:45811703-45811725 GTCGCCAAATACTTGTCTCAGGG - Intergenic
1068623874 10:59218069-59218091 ACCCCCAAATCCTTAGCTCAGGG - Intronic
1068829750 10:61479873-61479895 AAGCCCAAAACCTTGTCTCAGGG + Intergenic
1069905388 10:71729287-71729309 TCACACCAATCCTTGTCTCAGGG - Intronic
1070649617 10:78225499-78225521 TCACCCAAATCCTGGGCTCAGGG + Intergenic
1072984025 10:100123674-100123696 GCTCCCAAATCCAAATCTTAGGG + Intergenic
1073229822 10:101959574-101959596 GCTCCCACATCCTTTCCTCCAGG - Intronic
1073590676 10:104754609-104754631 GCTCTCAACTCCAAGTCTCAGGG - Intronic
1073649684 10:105344927-105344949 TCTTTCTAATCCTTGTCTCAAGG - Intergenic
1073818246 10:107231400-107231422 GCACACAAATCCTCCTCTCAGGG + Intergenic
1074812007 10:117114124-117114146 GCTTCAAAATCCTAGGCTCAGGG - Intronic
1075174017 10:120142919-120142941 GCACTCAAATGCTTGTCTCAGGG - Intergenic
1075656739 10:124166792-124166814 GCACTCAAATCTTTGTCTTAGGG + Intergenic
1076044021 10:127276171-127276193 GCTCCCACATGCTTGCGTCATGG + Intronic
1077138908 11:1014915-1014937 GCACCCAAGTCCCGGTCTCAGGG + Intronic
1078325889 11:10380469-10380491 GCACTCAAATCCTTGTTTCAGGG - Intronic
1078353952 11:10619432-10619454 GCTCCCAAAGCCTTTTATCCTGG + Intronic
1078375572 11:10790689-10790711 GCCCCCTAATCCTTCTGTCATGG - Intergenic
1078542529 11:12223353-12223375 TCCCCCAAATCCTAGTCTCAGGG - Intronic
1079039323 11:17047557-17047579 CCTCTCAAATCCTTGTCACTCGG + Intergenic
1080282924 11:30579540-30579562 GCTGCAAAATCCTTGCCTCTGGG + Intronic
1080931945 11:36820049-36820071 ACACCCAAATCCTTGTCTCTGGG - Intergenic
1081196994 11:40173378-40173400 TCTCCCAAATCCAGGTCACATGG - Intronic
1081961346 11:47139885-47139907 GCTCCCACCTCCCTGTGTCATGG + Intronic
1083364471 11:62133192-62133214 GAACTCAAATCCTTGTGTCAAGG - Intronic
1083846798 11:65339936-65339958 GCTCCCACATCCTTGCCCCAAGG - Intronic
1084759005 11:71256494-71256516 GCATCCAAGTCCTTGTTTCAGGG + Intergenic
1084959574 11:72709506-72709528 GCTCCTCAGTCCTTGTCTCTGGG - Intronic
1085307983 11:75499074-75499096 TCACACGAATCCTTGTCTCAGGG + Intronic
1085440967 11:76561945-76561967 GCACTCAACTCCTTGTCTCAGGG + Intergenic
1085781147 11:79410244-79410266 ACACTCAAATCCTTTTCTCAGGG + Intronic
1086043487 11:82506097-82506119 GTGCTCAAATCCTTGTCTTAGGG - Intergenic
1086443579 11:86851490-86851512 CCTCTCAAATCCTTGTCACTCGG - Intronic
1086798041 11:91133478-91133500 TTACTCAAATCCTTGTCTCAGGG + Intergenic
1087208413 11:95420706-95420728 GCACCAAAGCCCTTGTCTCAGGG - Intergenic
1087236537 11:95724880-95724902 GATCCCAAATCCTTTACTCTAGG + Intergenic
1089176043 11:116549541-116549563 GCCCCTAAGTCCTTTTCTCAAGG - Intergenic
1089603009 11:119626658-119626680 TCTCCCAGATCCCTGTCTCCCGG - Intronic
1090951433 11:131476805-131476827 GCTCTCTAATCTTTATCTCAGGG + Intronic
1092505398 12:9093478-9093500 AATCCCAGATCCATGTCTCAGGG + Exonic
1092555332 12:9554047-9554069 GGTCCCACATCCATGTCTCTGGG - Intergenic
1094011697 12:25816533-25816555 GTACTCAAATCCTTATCTCAGGG + Intergenic
1094516767 12:31136634-31136656 GGTCCCACATCCATGTCTCTGGG + Intergenic
1094549795 12:31440265-31440287 GCTTCCAACTCCTGGCCTCAAGG + Intronic
1095154328 12:38833951-38833973 GCACCCAAATACTTGTCTCAGGG - Intronic
1095247427 12:39939225-39939247 GCACCCAAGTCCTTGTCTTAGGG + Intronic
1096018017 12:48296190-48296212 CCTCCCAAGTCCTTATCCCACGG + Intergenic
1097886567 12:64734789-64734811 GTTCTTAAATCCTTGTGTCAGGG - Intronic
1098192630 12:67966611-67966633 GCACCCTAATCCTTGTCATAAGG - Intergenic
1098251822 12:68577924-68577946 GCTTCCAATTCCTGGCCTCAAGG - Intergenic
1100008321 12:89921425-89921447 GCATATAAATCCTTGTCTCAGGG + Intergenic
1102340799 12:112120216-112120238 CCTCCCAAATCCCTGTATCTGGG + Intergenic
1102407148 12:112683467-112683489 GCACCTTAGTCCTTGTCTCAGGG - Intronic
1102599424 12:114017890-114017912 GCACACAACTCCTTGTCTCAAGG + Intergenic
1102638307 12:114344134-114344156 GCATCCAAATCCTCATCTCAGGG - Intergenic
1102638604 12:114346466-114346488 CCTCCCAAATCCTGCCCTCAGGG - Intergenic
1102795350 12:115684432-115684454 GCTGCTTAACCCTTGTCTCATGG + Intergenic
1103024685 12:117563949-117563971 GCCCTCACATCCTTGTCTCTGGG + Intronic
1103136489 12:118512368-118512390 GCATTCAAATCCTTATCTCAGGG - Intergenic
1103353742 12:120304149-120304171 GCTCTGAAATCCTTTTCTCAAGG - Intronic
1104154117 12:126114805-126114827 TTTCCCAAAACCTTTTCTCACGG + Intergenic
1104973916 12:132543641-132543663 GCTCTAAAAGCCATGTCTCAAGG + Intronic
1106585124 13:31050578-31050600 GCTCCGATATTCTTCTCTCATGG + Intergenic
1109996289 13:70131634-70131656 GCTCAGATATCCTTTTCTCATGG + Intergenic
1110677909 13:78271747-78271769 GTTTCCAAATCCTTCTCTAATGG - Intergenic
1111650810 13:91088584-91088606 TCACCCAAATCCTCGTCTCAGGG + Intergenic
1112355902 13:98674883-98674905 GCTCCGAACTCCTTGGCTCAAGG + Intergenic
1114060898 14:19015152-19015174 GCTCTCCAATCCATGCCTCAGGG + Intergenic
1114624454 14:24119760-24119782 GCTCCCAAATCCTGTTCTCTGGG + Exonic
1115069573 14:29304454-29304476 CCACCCAAATCCTTTTTTCAGGG - Intergenic
1115912567 14:38272646-38272668 GCTCCCAAATCCTTGTCTCAGGG - Intergenic
1116001667 14:39249357-39249379 GGTCCCAACTCCTAGGCTCAAGG + Intronic
1117446030 14:55804676-55804698 GCACCTAAATCCTGGTCTCAGGG + Intergenic
1118501250 14:66364643-66364665 GCACCCAGATCCTTGTCTCAAGG + Intergenic
1118931026 14:70240609-70240631 CCACCTAAATCCTTGTCTCTGGG + Intergenic
1118953880 14:70461695-70461717 CCACCTAAATCCTTGTCTCTGGG - Intergenic
1119335390 14:73829240-73829262 TCACCCAAGTTCTTGTCTCAGGG - Intergenic
1119967031 14:78928191-78928213 GCTCCCAAATCCTTGTCTCAAGG + Intronic
1121259907 14:92558559-92558581 GCACTCAAATCCTTGTCTCAGGG - Intronic
1121308133 14:92919654-92919676 GCACTCAAATCCTTGTCTCAGGG - Intergenic
1122278533 14:100607973-100607995 GTACCCAAATGCTCGTCTCAGGG + Intergenic
1123895123 15:24820934-24820956 GCTTCCAATGCCTGGTCTCAAGG - Intergenic
1123965051 15:25447605-25447627 GCACTGAAATCATTGTCTCAAGG - Intergenic
1126055511 15:44726338-44726360 GCATCCAAATCTTTGGCTCAGGG - Intergenic
1126222463 15:46230201-46230223 GCACCCAAGTCCTTGTCTCCAGG - Intergenic
1126234948 15:46372953-46372975 GCTCAGGAATCCTTGTCTTAAGG - Intergenic
1126669850 15:51105883-51105905 GCTCTCAAGTCCTTAACTCAGGG + Intergenic
1126892140 15:53218080-53218102 TCACACAAATCCTTGTCTCAGGG - Intergenic
1127238493 15:57083665-57083687 GCCCCCAACTCCTGGGCTCAAGG + Intronic
1127702967 15:61518965-61518987 GTACTCAAATCCTTGTCTTAGGG + Intergenic
1128674694 15:69600064-69600086 GCACCCAGGACCTTGTCTCAGGG + Intergenic
1128680310 15:69646747-69646769 TCCCTCAAATCCTTGTCTCAGGG + Intergenic
1128798827 15:70484062-70484084 GCTCCAAACTCCCTGTCCCATGG + Intergenic
1129185492 15:73903571-73903593 ACACCCAAATCCTTGTCAGAAGG + Intergenic
1129810927 15:78508963-78508985 GCTTCCAACTCCTGGGCTCAAGG - Intronic
1130231330 15:82099520-82099542 GCTCCCAAAGCCGTGTTTTATGG - Intergenic
1130386223 15:83414634-83414656 GCTCCCCATTCCTGGTCTCCTGG - Intergenic
1130534090 15:84770824-84770846 GCTTCCAAATGCCTGTCTGAAGG - Intronic
1131178410 15:90224382-90224404 GCACGTATATCCTTGTCTCAAGG - Intronic
1131521479 15:93119351-93119373 GCTCCCACAGCTTTGTCTCTTGG - Intergenic
1133313119 16:4863979-4864001 GCTCCCTAATCCTTGGATCTGGG - Intronic
1133360639 16:5171053-5171075 GTACCCAAATCCTGATCTCAAGG + Intergenic
1133733728 16:8597734-8597756 GCCCTTAAATCCTTATCTCAGGG + Intergenic
1133819183 16:9221519-9221541 GCACTGAAATCCTTGTTTCAGGG + Intergenic
1133835368 16:9362879-9362901 GTTCCCAGATGCTTGTCTTAGGG + Intergenic
1134283068 16:12835047-12835069 GATCTCAAATCTCTGTCTCAAGG - Intergenic
1135070373 16:19346359-19346381 TTCACCAAATCCTTGTCTCAGGG - Intergenic
1135184101 16:20299902-20299924 GCTCCAGAATCCTTCTTTCATGG + Intergenic
1135238198 16:20778339-20778361 GCTCCCAAATCCTTGAGTAAAGG - Intronic
1136140332 16:28284186-28284208 GCTTTAGAATCCTTGTCTCAGGG + Intergenic
1138354772 16:56368302-56368324 GCATTCAAATCCTTGTCCCAGGG + Intronic
1138754520 16:59467253-59467275 CTTCCTAAATCATTGTCTCAAGG - Intergenic
1139180286 16:64739008-64739030 GCTTCCAACTCCTGGTGTCAAGG - Intergenic
1139373071 16:66480382-66480404 GGTCCCAAATCCAGGTCCCAGGG + Intronic
1139586932 16:67909883-67909905 GCTCCCAAGTCCTTGTCTCAGGG - Intronic
1140567360 16:76059922-76059944 GTGCCCAAATCCTCATCTCAGGG + Intergenic
1140945829 16:79767634-79767656 GGTCCCAATTTCTTGTCTCAAGG + Intergenic
1140955925 16:79865209-79865231 GCACTCGAATCCTTGTCTCTAGG + Intergenic
1141277751 16:82603583-82603605 GCACTCAAATCCTAGTCTCGGGG - Intergenic
1141466975 16:84212733-84212755 GCACTCAAATCCTTGCCCCAGGG + Intergenic
1141482486 16:84315853-84315875 GGGCCCAAGTCCTTGTCTCTGGG - Intronic
1141769937 16:86083659-86083681 ATGCTCAAATCCTTGTCTCAGGG + Intergenic
1141918475 16:87118323-87118345 ACATCAAAATCCTTGTCTCAGGG + Intronic
1143299965 17:5901938-5901960 GCAGCCAAATCGTTGTCTCTCGG + Intronic
1143315258 17:6027284-6027306 GCTCCCAGGTCCTAGTCCCATGG - Intronic
1143662421 17:8334156-8334178 GTTCTCAAATCGTTGTCTCAGGG - Intergenic
1143691388 17:8569137-8569159 GCCACCAACTCCTGGTCTCAAGG - Intronic
1144965313 17:19073595-19073617 GTACCGAAATTCTTGTCTCAGGG + Intergenic
1144982654 17:19178588-19178610 GTACCGAAATTCTTGTCTCAGGG - Intergenic
1144985569 17:19199651-19199673 GTACCGAAATTCTTGTCTCAGGG + Intergenic
1147593606 17:41702021-41702043 GCCTCCAACTCCTGGTCTCAAGG + Intergenic
1147673260 17:42189073-42189095 GCACCCAGATTCTTGCCTCAGGG - Exonic
1148628403 17:49088032-49088054 GCACTCAAATCCTTATCTGAGGG + Intergenic
1149047917 17:52269168-52269190 GCATACAAATCCTTATCTCAGGG + Intergenic
1151408393 17:73904104-73904126 GCAACCAAGTCCTTGTCCCAGGG - Intergenic
1154096098 18:11416634-11416656 GAGCTCAAATCCTTGTCTCAAGG - Intergenic
1155223152 18:23703716-23703738 TCTCCCAAATCCCTATCTCTAGG + Intronic
1155509426 18:26562097-26562119 CCTCCCAAATCTCTGACTCAGGG + Intronic
1155530527 18:26761818-26761840 GCTCTCACATCCTTGCCACATGG - Intergenic
1155575700 18:27244060-27244082 GTTACCAAATCATTGTCTTAAGG + Intergenic
1155893409 18:31294031-31294053 GCTTCCAACTCCTGGGCTCAAGG + Intergenic
1155960640 18:31991961-31991983 ACACCCAAATCCCTATCTCAGGG + Intergenic
1156713432 18:39976823-39976845 GCTCTCAACTCCTTGTGTGAGGG + Intergenic
1156850391 18:41719046-41719068 CCTCCCAAATCCTTCACTCTAGG + Intergenic
1157465904 18:47944780-47944802 GCACTCAAATCTTTGTCTCAAGG + Intergenic
1157574459 18:48734178-48734200 TCTCCCCACTCCTTGTCCCAGGG - Intronic
1157889977 18:51406402-51406424 GCACCCAAGACTTTGTCTCAGGG - Intergenic
1159020133 18:63136504-63136526 GCACTCAAATCTTTGTCTTAGGG - Intronic
1161623080 19:5309528-5309550 GCTGCCAACTCCATGTCTCCAGG + Intronic
1161995991 19:7711808-7711830 CCTCCCAACTCCTGGGCTCAAGG + Intergenic
1162884902 19:13689735-13689757 GCACCCAGATCCTTGTCTCAGGG - Intergenic
1164444320 19:28304061-28304083 GTTCTAAAATCTTTGTCTCAGGG + Intergenic
1164488665 19:28686058-28686080 GCTCTCAGATTCTTGCCTCATGG - Intergenic
1165081838 19:33311411-33311433 GCTCACAAAGCCTTGTGTCCTGG - Intergenic
1165306155 19:35004200-35004222 GCTCCGAACTCCTGGGCTCAAGG - Intronic
1165404679 19:35622382-35622404 CCTCCCAGATCCTCATCTCAAGG - Intronic
1165730772 19:38143288-38143310 GCCCCCAGGTCCCTGTCTCAGGG + Intronic
1167235754 19:48313798-48313820 GCTTCGAGCTCCTTGTCTCAAGG - Intronic
1168196629 19:54779391-54779413 GCTCCCAGTTCCTTGGCTCCTGG + Intronic
1168202408 19:54825806-54825828 GCTCCCAGTTCCTTGGCTCCTGG + Intronic
926119182 2:10232294-10232316 GTTCCCAACTCCTACTCTCACGG - Intergenic
926352871 2:12013076-12013098 GCCTCAAACTCCTTGTCTCAAGG + Intergenic
927461950 2:23306895-23306917 TCTCCCAACTCCCTGTCTCTCGG + Intergenic
927776724 2:25909549-25909571 GCCCCCAACTCCTGGGCTCAAGG - Intergenic
928149352 2:28811601-28811623 GCTCTCGAATCCTGGCCTCAAGG - Intronic
929990156 2:46780239-46780261 GCACCCGAATCCTTGTCTCAGGG + Intergenic
931079557 2:58753662-58753684 GCTCCCATAATCTTGTGTCATGG + Intergenic
932229126 2:70068062-70068084 TATCCCAAATCCTTGGCTCCAGG + Intergenic
935174847 2:100640786-100640808 GCTCCCGAGTCATTCTCTCAAGG - Intergenic
935180063 2:100681103-100681125 GGTCTCAAATCCTGGCCTCAAGG - Intergenic
935203759 2:100880578-100880600 TCCCCCAATTCCCTGTCTCAAGG - Intronic
935672323 2:105566432-105566454 GATCCCAGAACCTTGTCTTAAGG + Intergenic
936346166 2:111677048-111677070 GGTCCCACATCCTTGGCTCCAGG - Intergenic
937049118 2:118874272-118874294 GTTCCCATATCCATGGCTCAAGG + Intergenic
938162432 2:128997731-128997753 GCTCTCAAATCCTGGGCTCGGGG - Intergenic
938810020 2:134844366-134844388 GCATCTGAATCCTTGTCTCAGGG - Intronic
938986488 2:136581301-136581323 GCCCCCAAGGCCTAGTCTCAAGG - Intergenic
940027926 2:149228289-149228311 GTACCCAAATCCTTGCCTCAGGG - Intergenic
940065529 2:149623277-149623299 GCACTCAAATCCTTGTCTCAGGG + Intergenic
940548037 2:155115276-155115298 GCTCCCCAATCTCCGTCTCAGGG + Intergenic
942329553 2:174807565-174807587 TCTCACATGTCCTTGTCTCATGG - Intronic
942948979 2:181701281-181701303 TGTCCCAAATCTGTGTCTCAAGG - Intergenic
942970544 2:181953062-181953084 TCTCCCAAATACATGCCTCATGG + Intergenic
943710082 2:191083147-191083169 GCACTGGAATCCTTGTCTCAAGG - Intronic
944747296 2:202671211-202671233 CCAAACAAATCCTTGTCTCAGGG - Intronic
944920180 2:204404557-204404579 GCACTCAAATCCTTGTCTTGGGG - Intergenic
945123993 2:206488455-206488477 GCTCCTCCCTCCTTGTCTCAGGG - Intronic
946446511 2:219744654-219744676 TCTCCCTAATCCATATCTCAGGG + Intergenic
947795116 2:232889778-232889800 GCTCCCAAACCCTTTCCTCCTGG + Intronic
948249295 2:236512681-236512703 GCTTGAAAATCCTTATCTCATGG - Intergenic
948259183 2:236590323-236590345 GCTCCCAAATCCTCAGCTTAGGG + Intergenic
948539945 2:238683852-238683874 GTGCTCAAATCCTTGTCTCAGGG - Intergenic
1168855992 20:1009427-1009449 GAACTCAAATCCTTGTCTCAGGG + Intergenic
1169100865 20:2947625-2947647 CCTCCCCCATGCTTGTCTCATGG + Intronic
1169119447 20:3086080-3086102 GCTCCCAATAGCTTGGCTCAGGG + Intergenic
1169287932 20:4325186-4325208 GCTCTAAAATCCTTGTCTTGGGG + Intergenic
1169347564 20:4840640-4840662 GCACCCAAATTCTTGTCTCAAGG - Intergenic
1169451584 20:5716500-5716522 GTACCCAAGTCCTTGTCTAAGGG + Intergenic
1169475866 20:5930616-5930638 GTTTTCAAATACTTGTCTCAGGG + Intergenic
1169531120 20:6486311-6486333 GAACTCAAATTCTTGTCTCAAGG - Intergenic
1169830910 20:9823785-9823807 GCTCTCGAATCCTTGCCTCAAGG + Intronic
1169877303 20:10312101-10312123 GCCCAGAAAACCTTGTCTCATGG + Intergenic
1170032751 20:11959639-11959661 GCTCCCGCACCCTTGTCTCAGGG - Intergenic
1170099921 20:12687639-12687661 ACACACAAATCCTTGGCTCAGGG + Intergenic
1170146567 20:13181395-13181417 GCACCCAAATCCTTGTCCCTGGG + Intergenic
1170510407 20:17070825-17070847 GCCACCAAATTCTTGTCTCTGGG - Intergenic
1170539583 20:17374562-17374584 GCTTTCAAATCCTTGTCTCAGGG - Intronic
1170580703 20:17697602-17697624 CCACTCAAATCCTTGTTTCAGGG - Intronic
1170764476 20:19278408-19278430 TCTCACAAATCCTTCTCTCAGGG + Intronic
1170827792 20:19811137-19811159 GCATCTAAATCCTTGTCTCAGGG - Intergenic
1170947504 20:20904430-20904452 GCACCCATATCCTTGTCTTGAGG - Intergenic
1171049014 20:21838454-21838476 CCTCCCAAACCCTCATCTCAGGG - Intergenic
1171065069 20:22007406-22007428 GCACTCAAATTCTTGTCACAGGG - Intergenic
1171149944 20:22818870-22818892 TCTGCCAAATCTTAGTCTCATGG + Intergenic
1171351599 20:24506993-24507015 TCACCCAAATCCTTATCTCAGGG - Intronic
1171435570 20:25120522-25120544 TGTGCCAAATGCTTGTCTCAGGG - Intergenic
1172017971 20:31890535-31890557 GCTCTCACATCCTTCCCTCAGGG - Intronic
1172691915 20:36796092-36796114 GCACTTAAATCTTTGTCTCAGGG + Intronic
1172785609 20:37466396-37466418 GCTCCTAAATTCTTGTCCCAGGG + Intergenic
1172798397 20:37559202-37559224 GCACCCAAATTTTTGCCTCAGGG + Intergenic
1173005825 20:39138935-39138957 GTTCTCAGATCCTGGTCTCAGGG + Intergenic
1173071517 20:39772983-39773005 GCACTTAAATCCTTGTCTCAAGG - Intergenic
1173189011 20:40862142-40862164 GCACTCAAATCCTTGTCTCAGGG + Intergenic
1173308638 20:41875688-41875710 GCATCCAAGTCCTTATCTCAAGG + Intergenic
1173326200 20:42035936-42035958 ACACCCAAACCCTTGTCTCAAGG - Intergenic
1173479413 20:43387537-43387559 ACACTCAAATTCTTGTCTCAGGG - Intergenic
1173485681 20:43439301-43439323 GCACTTGAATCCTTGTCTCAGGG + Intergenic
1173566075 20:44039543-44039565 GCACCCAAACCTTTGTGTCAGGG - Intronic
1173894397 20:46539339-46539361 GCGCATAAATTCTTGTCTCAGGG + Intergenic
1174505854 20:51017047-51017069 GCACTCAAATCCTTCACTCAGGG + Intronic
1174975178 20:55325020-55325042 GTTCCCAATTCCTTTTCTCTGGG + Intergenic
1175161519 20:57011525-57011547 GCTCTCCCATCCTTGTCTCACGG - Intergenic
1177490286 21:21815677-21815699 GTACTCAAATCCTTTTCTCATGG - Intergenic
1178102633 21:29286446-29286468 GCACATGAATCCTTGTCTCAGGG - Intronic
1178677636 21:34644761-34644783 GCTCCCAAATCTAGGACTCAGGG + Intergenic
1179087313 21:38229021-38229043 GCTCCCCATTCCTTTTCTCTGGG + Intronic
1179461765 21:41540168-41540190 GATCCCAACCCCTTGGCTCAAGG + Intergenic
1179534434 21:42042209-42042231 GCCCCCAAATCTTTGTCATAGGG + Intergenic
1179578352 21:42321613-42321635 ATTCCCATTTCCTTGTCTCAGGG + Intergenic
1179621938 21:42622159-42622181 GCTTCCAAATCCCTCTCTCCGGG + Intergenic
1180479381 22:15737764-15737786 GCTCTCCAATCCATGCCTCAGGG + Intergenic
1182904841 22:33926493-33926515 GCCGCAAAGTCCTTGTCTCAGGG - Intergenic
1182926133 22:34126905-34126927 GCACACAAGTCCTTGACTCAGGG + Intergenic
1184312936 22:43659959-43659981 GCTCCCTACTGCATGTCTCAGGG + Intronic
949585453 3:5432392-5432414 GCACTCAAATTCTTGTCTCAAGG + Intergenic
949615102 3:5745009-5745031 GTACACAAATCCTTGTCTCAGGG + Intergenic
949907027 3:8866294-8866316 GCTCCCATATCCCTGTGTCTGGG + Intronic
950932917 3:16809046-16809068 GCACCCAATTCCTGGTCTCAAGG - Intronic
951113878 3:18837197-18837219 GCATCCAAATCCTTGTCTTGAGG - Intergenic
951704611 3:25530962-25530984 GCATTCAAATCCTTGTCTTAGGG - Intronic
951919820 3:27842126-27842148 ACACCCAAATCCTTATATCAGGG + Intergenic
951997520 3:28747722-28747744 GCTCTCAAGTCCTTGTCTCAGGG - Intergenic
952018242 3:28985431-28985453 GCACACAAATGCTTTTCTCAAGG - Intergenic
952238469 3:31505462-31505484 GCACCAAAATTCTTGTCTCAGGG - Intergenic
952357103 3:32594582-32594604 GCCCCCAGATCCTTGTTTCAAGG - Intergenic
952843282 3:37666235-37666257 GCACTCAAATCCTTGTCTCATGG - Intronic
952861919 3:37820081-37820103 GCACACAAATCCTTGTTTCAGGG - Exonic
953007779 3:38994111-38994133 GCATCCAAGTCCTTGTTTCAGGG + Intergenic
953139475 3:40214089-40214111 GCACCCCAATTTTTGTCTCAGGG + Intronic
953223856 3:40998732-40998754 GCACCCAAGTCCTCGTCTCAGGG + Intergenic
953558720 3:43967728-43967750 GTTCTCAATTCCTTATCTCAGGG + Intergenic
953578723 3:44134419-44134441 GCACCCAAATCTTTGTCTTGGGG - Intergenic
955702665 3:61697339-61697361 GTTCCCAAATCCTTGCTTCTGGG - Intronic
955836655 3:63063110-63063132 GCACCTTAATCCTTGTCTCAGGG - Intergenic
956147494 3:66205852-66205874 GCACCCAAGTCCTTCTCTCAGGG - Intronic
956567564 3:70656165-70656187 CCACTAAAATCCTTGTCTCAAGG + Intergenic
956698997 3:71942346-71942368 ACATTCAAATCCTTGTCTCAGGG - Intergenic
956705143 3:71993201-71993223 GTACCCAAGTCCTTGTCTCAGGG + Intergenic
956722654 3:72132174-72132196 TCTTCCAAATCCTTTTCCCAAGG - Intergenic
958023760 3:88026802-88026824 GCACTAAAATCCTTGGCTCAGGG - Intergenic
958258403 3:91351544-91351566 GCTCTCAAATCTTAGTCTTAGGG - Intergenic
958439750 3:94141847-94141869 ACTCGCAAGTCCTTGTCACATGG + Intergenic
961011148 3:123436992-123437014 GTACTCAAATCCTTGTCTCAGGG - Intronic
961079576 3:124014607-124014629 GTTCTAAAATCCTTGTTTCAAGG + Intergenic
961115336 3:124324222-124324244 TCTCCCAAATAATTGTCTCAAGG + Intronic
961273695 3:125709924-125709946 CCTCTCAAATCCTTGTCACTCGG + Intergenic
961590354 3:127975027-127975049 GCACTCAAAGCCTTGTTTCAAGG - Intronic
961980617 3:131074162-131074184 GCATTCAAATCCTTGTCTCAGGG + Intronic
962365388 3:134775631-134775653 GCACCCTAATCTCTGTCTCAGGG + Intronic
962549271 3:136472703-136472725 GTTCCCTAAACCTTGTGTCAAGG + Intronic
964106713 3:153047740-153047762 GCTTCAAATTCCTTGGCTCAGGG - Intergenic
964680301 3:159331058-159331080 GCACTCAAACCCTTGTCTCAAGG - Intronic
964690459 3:159444042-159444064 GCTCTCAGATTCTTGTCTCAGGG - Intronic
965596920 3:170419316-170419338 GCTCCCAAATCCTTATCCTCTGG + Intronic
967938167 3:194745985-194746007 GCTCCCAGATGGTTGTCTCATGG + Intergenic
968055595 3:195689553-195689575 CCTTCCAAATTTTTGTCTCAGGG - Intergenic
969588641 4:8108900-8108922 GCACCCACAGCCTGGTCTCAAGG - Intronic
969645987 4:8429099-8429121 GCACCCAAAGCCTCGTCTCAAGG + Intronic
969912655 4:10459956-10459978 GCTCCCAAATCTTATACTCAAGG - Intergenic
970567485 4:17346946-17346968 GCTCTCAAATCCTTATCTCAGGG - Intergenic
971027051 4:22599031-22599053 GCTCTCAACTCCTTGACTTAAGG - Intergenic
971196735 4:24477337-24477359 GCACTCCAATCCTTTTCTCAAGG - Intergenic
972978608 4:44668175-44668197 GCTCTGAACTCCTGGTCTCAAGG + Intronic
973787766 4:54349449-54349471 GCCCCCACATCCTTCTTTCACGG - Intergenic
974062752 4:57050626-57050648 ACTCCAAACTCCTAGTCTCATGG + Intronic
974324799 4:60399371-60399393 GCCCTCAAATCCTTGTCTCAGGG + Intergenic
975054387 4:69910566-69910588 ACTCTCATATCCTTGTTTCAAGG + Intergenic
975747598 4:77490177-77490199 GCATCCAAATTCTTGTCTCATGG - Intergenic
976555904 4:86451525-86451547 TCACACAAATCCTTGCCTCAGGG - Intronic
977806648 4:101307354-101307376 GCTCCCAAATACTTGACATATGG - Intronic
978213071 4:106161963-106161985 TCTCCCAAAGCCTTATTTCAGGG + Intronic
980208029 4:129747650-129747672 AATTCCAAATCCTTGTCCCAGGG - Intergenic
983329018 4:166300387-166300409 GCTGCCAATTCCCTGTCACATGG - Intergenic
985118612 4:186616639-186616661 GCCCCCAAAACAGTGTCTCACGG + Intronic
986163596 5:5252829-5252851 GCTCCCACCACCTTCTCTCAAGG + Intronic
986449272 5:7850142-7850164 TCTCCCACATCCTCGTCCCAGGG + Intronic
986499606 5:8385139-8385161 CCTCCCAAATCCCAGTCTCTGGG - Intergenic
986571236 5:9168247-9168269 CCTCCCAAATCACGGTCTCAGGG - Intronic
986732351 5:10644818-10644840 GCCCCCAAGTCCTTGTCTCGAGG - Intronic
987145225 5:14985116-14985138 GCACTCAAATCCTTGTCTCAAGG - Intergenic
988699129 5:33655579-33655601 GCTCTCAAATCCTTGTCTCGGGG + Intronic
988836112 5:35034111-35034133 GGTCCTAAATCCTTGTTTAAAGG - Intronic
988872374 5:35405242-35405264 GCTCTGGAATCCTTGTCTCTGGG + Intergenic
991539728 5:67714077-67714099 TCAATCAAATCCTTGTCTCAAGG - Intergenic
991911919 5:71571225-71571247 GCTTCCACATCCTGGGCTCAAGG + Intergenic
992017934 5:72594730-72594752 GCACCCAAATCCTTGTTTCAAGG + Intergenic
992174239 5:74133949-74133971 GCACTCAAATCCTTGTCTCAGGG + Intergenic
992480769 5:77150479-77150501 GCACCCAAGTCCTTGTCTCAAGG + Intergenic
993182989 5:84578899-84578921 GTGCTCAACTCCTTGTCTCACGG + Intergenic
993595815 5:89853673-89853695 GCTGACAAATCCTTCTCTCGGGG + Intergenic
994240776 5:97418266-97418288 GCACACAAATCCTTGCCTCTGGG + Intergenic
994415892 5:99469962-99469984 TCTCCCTAATCTTTTTCTCAAGG - Intergenic
994804082 5:104420955-104420977 GCACCCAAATCATTGTCTCAAGG - Intergenic
998324284 5:141265541-141265563 GCACCTAAGTCCTTGTCTCTAGG - Intergenic
998495162 5:142582112-142582134 GCACCCAAGTCATGGTCTCAGGG + Intergenic
1000190143 5:158902671-158902693 GGTCCAAACTCCTGGTCTCAAGG + Intronic
1000464747 5:161562000-161562022 GCACAGAAATCCTTCTCTCAAGG + Intronic
1001496612 5:172192395-172192417 ACACTCAAATCCTTGCCTCAGGG - Intergenic
1002886074 6:1295466-1295488 GCTCCTAAATCCATTTCTTAGGG + Intergenic
1005516338 6:26558134-26558156 GGTCTCAAATCCCTGGCTCAAGG + Intergenic
1005822154 6:29607057-29607079 GCCCCCAGATCCTTGGCTCCTGG - Intronic
1006780715 6:36630589-36630611 CCTCCAAAATCCTTGTCTTGGGG + Intergenic
1006870540 6:37247270-37247292 GGACTCAAATCCTTGTCTCAGGG - Intronic
1007240416 6:40420805-40420827 GTATTCAAATCCTTGTCTCAGGG - Intronic
1007303070 6:40883103-40883125 GCTCCCGAATTTTTGTTTCAAGG - Intergenic
1007384056 6:41508720-41508742 GCACCCAAGTTCTTGTCTCAGGG + Intergenic
1007609989 6:43143064-43143086 GCTCCCAAATGCTGCTCTCCGGG + Intronic
1008888187 6:56454320-56454342 CCTCCCAAATCCTTTCCTCTGGG + Intergenic
1008996858 6:57669144-57669166 GCTCTCAAATCTTAGTCTTAAGG + Intergenic
1009185372 6:60568478-60568500 GCTCTCAAATCCTAGTCTTAGGG + Intergenic
1009298750 6:61988369-61988391 ACTCACAAATACTTGTTTCATGG + Intronic
1010120025 6:72364632-72364654 GCACTCAAATCTTTGTTTCAGGG - Intronic
1010467865 6:76190322-76190344 ACACTCAAATTCTTGTCTCAGGG - Intergenic
1010588011 6:77678515-77678537 GCTGAAAAATCCTTGTCTCCTGG + Intergenic
1011675110 6:89725238-89725260 CCTCCCACCTCCTTGTCTAAAGG + Exonic
1012880086 6:104776486-104776508 GTTCCCAAATGCTTGTCTCAAGG - Intronic
1013524998 6:110965869-110965891 GCTCCCAAATTCCTGATTCACGG - Intronic
1014245571 6:119064621-119064643 GCTCCAAACTCCTGGACTCAAGG - Intronic
1015360958 6:132338638-132338660 GCACATAAATCCATGTCTCAAGG + Intronic
1015618487 6:135104774-135104796 ACTCTCAAATTCTTATCTCAAGG - Intergenic
1017150169 6:151272260-151272282 GCTTCAAACTCCTTGGCTCAAGG - Intronic
1017275959 6:152568689-152568711 GCCTCCAACTCCTCGTCTCAGGG + Intronic
1018553365 6:165024533-165024555 ACACACAAATCCTTGTCCCAGGG - Intergenic
1018908934 6:168090893-168090915 GCTCCAAAATCCAGGTCTCCTGG + Intergenic
1019668346 7:2264088-2264110 GCTCAGAAATCCGTGTTTCAGGG + Intronic
1020564711 7:9780468-9780490 CCTCACAAATCGTGGTCTCAGGG - Intergenic
1020762444 7:12284983-12285005 GCACTCAAATCCTTGTTTCAGGG + Intergenic
1021655598 7:22870633-22870655 ACCCCCAAATCTTTGTCTCCAGG + Intergenic
1021926376 7:25538187-25538209 GCTACCAAATTCCTGACTCATGG + Intergenic
1022417752 7:30192402-30192424 GCACCCAAACCCTAATCTCAAGG + Intergenic
1023473986 7:40556492-40556514 GCACACAAACTCTTGTCTCATGG + Intronic
1025111566 7:56221207-56221229 GCCCCCAACTCCTAGGCTCAAGG - Intergenic
1026207467 7:68270698-68270720 GCTTCAAACTCCTTGGCTCAAGG - Intergenic
1026356349 7:69560943-69560965 GCTTCAAACTCCTTGGCTCAAGG + Intergenic
1027156968 7:75775393-75775415 GCACCAGAATCCTTGTCTCAGGG - Intronic
1027343788 7:77237125-77237147 GAACGCAAATCCTTGCCTCAGGG - Intronic
1028517828 7:91697866-91697888 GCCCCCAAATCCTTGTTTCAGGG + Intronic
1028586087 7:92453220-92453242 GCTGCCAAGTCCCTGTTTCAAGG + Intronic
1029659105 7:101947169-101947191 TCTCCCAACTCCTGGGCTCAAGG - Intronic
1030141314 7:106306900-106306922 GCTCCCACATCACTTTCTCAGGG - Intergenic
1030728491 7:112955626-112955648 GCTTCCACTTCCTTGTCTCTCGG + Intergenic
1030932483 7:115542200-115542222 GCACCTGAATCCTTGTCTCAGGG - Intergenic
1032248288 7:130231594-130231616 GCTCCCAACTCCTTGTGGAAGGG + Intergenic
1032427228 7:131831918-131831940 GCACCGAAATCCTTGTCTCAGGG - Intergenic
1033009362 7:137603843-137603865 TCTCGCAACTCCCTGTCTCATGG - Intronic
1033219520 7:139519057-139519079 GCACTTAAATCCTTGTGTCAGGG - Intergenic
1033307982 7:140238944-140238966 CCTCCCACATCCTACTCTCAGGG - Intergenic
1033373628 7:140736013-140736035 GCTCTCAAATCCTGCTCTCCAGG + Intronic
1033794585 7:144832706-144832728 TTGCCCAAATCCTTGTTTCAAGG + Intronic
1034419506 7:150981645-150981667 TCTCCCGAATCCTAGTCTCCAGG - Intergenic
1035527147 8:322930-322952 GCACTCCAATCCTTGTCACAGGG - Intergenic
1036300542 8:7566561-7566583 TCTCCCTTATCCTTGTTTCAGGG + Intergenic
1040627921 8:49173392-49173414 GCTCCCAATTCCTTATTTCATGG + Intergenic
1043071787 8:75645215-75645237 GCTATCAAATACTTGACTCATGG - Intergenic
1045435770 8:102162337-102162359 GCACTCAAATCCTTGCCTCAGGG + Intergenic
1045809018 8:106200147-106200169 AACCTCAAATCCTTGTCTCAAGG + Intergenic
1046652878 8:116858380-116858402 GTTCCCAACTTCTTCTCTCATGG + Exonic
1046856775 8:119041101-119041123 GCACACAAATCCTTGTCTAAGGG + Intronic
1048009886 8:130446961-130446983 GCACCCATCTCCTTGTCTCAAGG + Intergenic
1048049393 8:130803081-130803103 GCATTCAAATCCTTGTCTCAAGG + Intronic
1048262155 8:132954361-132954383 ACTCCTGAATCTTTGTCTCATGG - Intronic
1049497439 8:142942908-142942930 GTTCACAAATGCTTGTCTGAGGG + Intergenic
1051333335 9:16045181-16045203 GCACTCAAATCATTGTCTCAGGG - Intronic
1051709830 9:19920433-19920455 GAACTCAAATCCTTGTCTCAGGG - Intergenic
1052673433 9:31587733-31587755 GCTTGCAAATCCTTGTCTTAGGG + Intergenic
1054714374 9:68542444-68542466 GCCCTCAATTCCTTGCCTCATGG - Intergenic
1054962674 9:70986140-70986162 GCTCCAAACTCCTAGCCTCAAGG - Intronic
1055039035 9:71848925-71848947 GCATTCAAACCCTTGTCTCAGGG - Intergenic
1055186384 9:73460529-73460551 GCTCCAAAATACTGGTTTCAAGG - Intergenic
1055191322 9:73528129-73528151 GCCCACAAATCCTTGTCTGGGGG - Intergenic
1056310109 9:85332453-85332475 CATGCAAAATCCTTGTCTCAGGG - Intergenic
1056317829 9:85408461-85408483 AAACCCAATTCCTTGTCTCAGGG + Intergenic
1056494371 9:87141602-87141624 GCACTCAAATCCTTGCCACAGGG - Intergenic
1056652403 9:88477622-88477644 GCTCCCAAGCCCTTGTATCTTGG + Exonic
1056984208 9:91346343-91346365 GCTCCCTAAGCCCTGTTTCAGGG - Intronic
1057754717 9:97823103-97823125 GCATCCATAACCTTGTCTCAGGG - Intergenic
1059070514 9:111131083-111131105 GCACTAAAATCCTTGTCCCAAGG - Intergenic
1059648881 9:116295793-116295815 TCTCCCAAATCATTTTGTCAAGG + Intronic
1060120738 9:120987219-120987241 GCCCCCTAATCAATGTCTCAAGG - Intronic
1060788483 9:126469091-126469113 GCCCCGAAATCCTGGGCTCAAGG - Intronic
1062045015 9:134420962-134420984 GCTCCCACATCCATGCCTGATGG + Intronic
1062316430 9:135969344-135969366 GCTCCCAATGCCTTGGCTCCTGG - Intergenic
1186121170 X:6362585-6362607 GCACCCAAATCCTTGTGTCAAGG + Intergenic
1186536036 X:10349459-10349481 GTTCCCAAACCCTTGTCTTACGG - Intergenic
1186680776 X:11871290-11871312 GCACTCAGATCCTTATCTCAGGG + Intergenic
1186761625 X:12729428-12729450 GCTCACAATTCCTTGCCACAAGG + Intergenic
1186893612 X:13984612-13984634 GCTCTCAAGTACTTATCTCAAGG - Intergenic
1186954934 X:14671340-14671362 GCATCCAAATGCTTGTCACAGGG - Intronic
1187095211 X:16140793-16140815 GCACCTAAATCCTTGCCTCGGGG + Intronic
1187119365 X:16388548-16388570 GCAATCAAATCCTTGTCTCCAGG + Intergenic
1187290464 X:17948429-17948451 GCACTTAAATCCTTGTTTCAGGG + Intergenic
1187424432 X:19164286-19164308 GCACTGGAATCCTTGTCTCAGGG + Intergenic
1187456424 X:19445211-19445233 GCCCCCAAATTCGTATCTCAGGG + Intronic
1187555810 X:20350084-20350106 GCTACCAAGCCCTTGTTTCAGGG - Intergenic
1187616937 X:21006242-21006264 GCATAAAAATCCTTGTCTCAAGG - Intergenic
1187891255 X:23937104-23937126 CCTCCTAAATCTCTGTCTCAGGG - Intronic
1188468075 X:30505300-30505322 GCATTCAAATCATTGTCTCAGGG + Intergenic
1189078663 X:37944884-37944906 GCCTCCAAGTCCTTGCCTCAGGG + Intronic
1189130310 X:38491498-38491520 GCACTCAAATCCTTGTCTCAGGG - Intronic
1189156226 X:38759700-38759722 GCTCTCACATTCTTGCCTCAGGG - Intergenic
1189217778 X:39341961-39341983 GAACCCAAATATTTGTCTCAAGG + Intergenic
1189237268 X:39496840-39496862 ACACTCAAATTCTTGTCTCAGGG - Intergenic
1189263729 X:39697585-39697607 GCATTTAAATCCTTGTCTCAGGG + Intergenic
1189272522 X:39761295-39761317 GGCCCCAAATCCTTGCTTCAGGG - Intergenic
1189377983 X:40480688-40480710 GCTCTCAAATCTTTGTTTTAGGG - Intergenic
1189379145 X:40489339-40489361 GCACTGAAATCCTTGTCTCAAGG + Intergenic
1189384016 X:40521887-40521909 GCACCTACATCCTTGTCTCAGGG + Intergenic
1189548875 X:42072520-42072542 GCCCTCAAATCCTTGTGTCAGGG - Intergenic
1189947117 X:46190751-46190773 GCTTCGAACTCCTTGGCTCAAGG + Intergenic
1189955216 X:46270846-46270868 GCACTCGAATCCTTGTCTCAGGG + Intergenic
1195963659 X:110410613-110410635 TCTCCCAGATGCTTGTCTCCTGG + Intronic
1197162957 X:123344622-123344644 GCCCTCAAATCTTTGTCTCAGGG + Intronic
1197656285 X:129119632-129119654 GCTCCCAAAGGCTAGTTTCAGGG + Intergenic
1197714563 X:129697200-129697222 GAACCCAAGTCCTTGTCTCCAGG - Intergenic
1197719730 X:129737128-129737150 GCTCCCAAGTCAGTGTTTCAAGG + Intergenic
1200169381 X:154061206-154061228 GCTCCCAAATTTATGTCTCCAGG - Intronic
1200246772 X:154530690-154530712 GCCCCCAAATACATGTCTCCTGG + Intergenic
1201476942 Y:14392303-14392325 GCACCCAAATCCTTGTGTAAAGG - Intergenic
1201627847 Y:16034847-16034869 GCTCCCAATTTCCTGACTCAAGG + Intergenic