ID: 1119967381

View in Genome Browser
Species Human (GRCh38)
Location 14:78931972-78931994
Sequence CTAATTTTGTAGTAGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19999
Summary {0: 3, 1: 30, 2: 212, 3: 2183, 4: 17571}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119967381_1119967387 -6 Left 1119967381 14:78931972-78931994 CCCTGTCTCTACTACAAAATTAG 0: 3
1: 30
2: 212
3: 2183
4: 17571
Right 1119967387 14:78931989-78932011 AATTAGCTGGGCATGGTGGCAGG 0: 8458
1: 30905
2: 62491
3: 77788
4: 55705
1119967381_1119967391 21 Left 1119967381 14:78931972-78931994 CCCTGTCTCTACTACAAAATTAG 0: 3
1: 30
2: 212
3: 2183
4: 17571
Right 1119967391 14:78932016-78932038 CATAATCCCAGCTACTCAGGAGG 0: 374
1: 6243
2: 70445
3: 160845
4: 238731
1119967381_1119967386 -10 Left 1119967381 14:78931972-78931994 CCCTGTCTCTACTACAAAATTAG 0: 3
1: 30
2: 212
3: 2183
4: 17571
Right 1119967386 14:78931985-78932007 ACAAAATTAGCTGGGCATGGTGG 0: 3050
1: 21869
2: 82171
3: 151825
4: 198478
1119967381_1119967393 27 Left 1119967381 14:78931972-78931994 CCCTGTCTCTACTACAAAATTAG 0: 3
1: 30
2: 212
3: 2183
4: 17571
Right 1119967393 14:78932022-78932044 CCCAGCTACTCAGGAGGCTGAGG 0: 92886
1: 198857
2: 236674
3: 157910
4: 88870
1119967381_1119967388 18 Left 1119967381 14:78931972-78931994 CCCTGTCTCTACTACAAAATTAG 0: 3
1: 30
2: 212
3: 2183
4: 17571
Right 1119967388 14:78932013-78932035 ACCCATAATCCCAGCTACTCAGG 0: 175
1: 3400
2: 45212
3: 172212
4: 263267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119967381 Original CRISPR CTAATTTTGTAGTAGAGACA GGG (reversed) Intronic
Too many off-targets to display for this crispr