ID: 1119967766

View in Genome Browser
Species Human (GRCh38)
Location 14:78936056-78936078
Sequence CTGTAAGCAATGATGAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119967766 Original CRISPR CTGTAAGCAATGATGAATCT TGG (reversed) Intronic
902968771 1:20031639-20031661 CTGTAAGAAAGGAAGAATTTTGG + Intronic
908160355 1:61401985-61402007 CTGCAATGAATGATAAATCTTGG - Intronic
908688917 1:66754726-66754748 CTCTAAGTAATCATGAATTTTGG + Exonic
908827313 1:68146260-68146282 TTGTTAGAAATGAAGAATCTAGG + Intronic
909139939 1:71850747-71850769 ATTTAAGCAATAATGTATCTAGG + Intronic
909362858 1:74784692-74784714 CTATAAGCAAGGATTATTCTGGG + Intergenic
909488956 1:76205427-76205449 CTGTAGGGAATGATGAATCAGGG - Intronic
910843552 1:91584539-91584561 TTGTTAGAAATGCTGAATCTTGG - Intergenic
911067353 1:93802429-93802451 CTGTAAGAAATTATGAATCTTGG - Intronic
914928398 1:151908402-151908424 CCCTAAGCCAGGATGAATCTGGG - Intronic
918337796 1:183538000-183538022 TTGTAAGAAATGCAGAATCTTGG - Intronic
920969186 1:210728158-210728180 CTCTAAGCCATAATGAATGTAGG + Intronic
922157217 1:223049911-223049933 CTGTAAGAACTGCTGAGTCTTGG + Intergenic
1063740443 10:8812605-8812627 TTGTAAGCAATCATGGATATTGG + Intergenic
1063869681 10:10404006-10404028 CTGTAAGCAATTATAAACATAGG + Intergenic
1068029373 10:51688245-51688267 CTGTTAGAAATGCAGAATCTAGG - Intronic
1068524847 10:58116749-58116771 CAGTGAGCTATGATCAATCTGGG - Intergenic
1069204130 10:65660491-65660513 CTGTGAGCAAAGGTGAAACTAGG - Intergenic
1070514266 10:77189123-77189145 CTGTAAGAAATGCAAAATCTAGG - Intronic
1072744328 10:97929215-97929237 CTGTAAGCAGTCATGCCTCTTGG - Intronic
1073593111 10:104775018-104775040 CTGTAAGCTATGAGGAGCCTGGG + Intronic
1074835525 10:117289081-117289103 CTGTGAGAAATGAAGAATCTTGG + Intronic
1077795442 11:5486627-5486649 CTGGAAACAATGATGAATGCAGG - Intronic
1078192321 11:9101495-9101517 CTGTAAGCAAAAAAGAATGTGGG - Intronic
1081474376 11:43411325-43411347 GAGTAAGCAATGAAGAATATTGG - Intronic
1081728889 11:45354596-45354618 CTTTAAGCAACGAAGAATTTGGG + Intergenic
1086079042 11:82883704-82883726 GTGTAAGCAAAGATGAGACTTGG + Intronic
1087386041 11:97470396-97470418 CTGCAAGCTATGGTGGATCTTGG - Intergenic
1088412019 11:109544653-109544675 ATGTAAGCAATAATGAAACTTGG + Intergenic
1089618796 11:119710541-119710563 CAGGAAGAAATGATGAATGTGGG + Intronic
1090410547 11:126506066-126506088 CTGTATGCAAAAATGAATTTAGG + Intronic
1090465758 11:126931681-126931703 CTGTAAGGAAGAATGAATATGGG - Intronic
1090475328 11:127015006-127015028 CTGTTAGTAAGGATGAAGCTGGG - Intergenic
1090994860 11:131856897-131856919 ATCTAAGCAATGATAAAACTGGG + Intronic
1093983250 12:25498503-25498525 GTGTCAGGAATTATGAATCTTGG - Intronic
1094219756 12:27979296-27979318 ATGTAAGCAATCATGAATCCAGG - Intergenic
1097298538 12:57993671-57993693 CTGTAAGCACTGTTAAACCTTGG - Intergenic
1097884440 12:64714833-64714855 CTGAAAGCACTGTTGAATATGGG - Exonic
1098702149 12:73642726-73642748 CTGAAAGCAATCATTAATGTTGG - Intergenic
1101251599 12:102941644-102941666 CTCTAAGAATTTATGAATCTGGG - Intronic
1101715418 12:107307866-107307888 ATGTTAGTAATGGTGAATCTGGG + Intergenic
1102541464 12:113622419-113622441 CTGCAACCAATGATGAGTCATGG + Intergenic
1103406645 12:120680581-120680603 CTGTAGACAATGAGGAATTTGGG - Intergenic
1105573761 13:21629184-21629206 TTGTTAGCAATGCAGAATCTTGG + Intergenic
1110030544 13:70606239-70606261 CAGTAAGCAATGAAGGAGCTAGG - Intergenic
1110377758 13:74813735-74813757 GTGTAAGCAACGTTGAAACTGGG + Intergenic
1110527559 13:76556491-76556513 CTATAAGCATAGATGAAACTTGG - Intergenic
1113532531 13:111039020-111039042 CTGTAAGCACTGCTGCATCTAGG + Intergenic
1113647451 13:112008985-112009007 CTGTCAGCACGGAGGAATCTAGG + Intergenic
1113761505 13:112850784-112850806 CTGTAATCCATAATGATTCTTGG + Intronic
1115263549 14:31477498-31477520 CTGTTAGAAATGCAGAATCTGGG + Intergenic
1118116111 14:62778579-62778601 GTGAAGGCAATGATGAATGTGGG - Intronic
1119967766 14:78936056-78936078 CTGTAAGCAATGATGAATCTTGG - Intronic
1121608140 14:95256354-95256376 TTGTCAGCAACAATGAATCTTGG + Intronic
1123766327 15:23482131-23482153 CAGGAATCAAAGATGAATCTAGG - Intergenic
1125615208 15:41005232-41005254 CTGTAAGCAATGAGGAATACAGG + Intronic
1126284547 15:46996384-46996406 CTGGTAGTAATGAGGAATCTGGG - Intergenic
1130817665 15:87455599-87455621 TAGAAAACAATGATGAATCTGGG - Intergenic
1131369886 15:91871443-91871465 CTGCAAGGAATGAAGACTCTGGG - Intronic
1132000290 15:98172567-98172589 CTGAGAGAAAGGATGAATCTAGG - Intergenic
1132017054 15:98327338-98327360 CTGTAAGGTAAGATAAATCTTGG - Intergenic
1132403513 15:101528476-101528498 CTTTGAGCAATGATGAATATTGG - Intergenic
1135460977 16:22642748-22642770 CTATGAGCAATGAAGAATTTTGG - Intergenic
1135692997 16:24559676-24559698 ATGTAAGAAGTGCTGAATCTTGG + Exonic
1139588947 16:67922513-67922535 ATCTAACCAATGATGATTCTGGG - Intronic
1145831269 17:27918282-27918304 ATGTAATCAAACATGAATCTAGG - Intergenic
1145850343 17:28087827-28087849 CTGTAACCCATGATGAAGTTGGG + Intronic
1145973573 17:28971290-28971312 TTGTAAGAAATGCAGAATCTTGG + Intronic
1145981408 17:29014344-29014366 TAGTAAGCAATGACGAAGCTCGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1148961060 17:51393236-51393258 CTGTATGCTATGATGAATGGTGG - Intergenic
1149356943 17:55848754-55848776 CTGTAGGCCCTGATGATTCTGGG - Intergenic
1149734211 17:58977142-58977164 CTGTAAGAAATAATGAATGAGGG + Intronic
1151556636 17:74850086-74850108 CTGTCACCAATGATGACTCCTGG - Intronic
1153922456 18:9803883-9803905 CTGTAAGAAAATAGGAATCTAGG + Intronic
1154110613 18:11565538-11565560 CTTTAAGCAATGATATATCCAGG + Intergenic
1155132567 18:22953071-22953093 CTGTAAGAAATGAGGCGTCTGGG + Intronic
1155774932 18:29749492-29749514 CTATAAGCAATGAAGAGTCATGG + Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1157649951 18:49318138-49318160 CTGTAAGCAATGGTGGCTCCAGG - Intronic
1158032005 18:52977450-52977472 CTGAGATCAATGAAGAATCTTGG - Intronic
1159283377 18:66316769-66316791 CTGTAATCACTGTTGAAGCTTGG + Intergenic
1159991841 18:74917935-74917957 CAGTAAACAATGGTGAATTTAGG + Intronic
1164866147 19:31605981-31606003 CTATAGGCAATGGTGCATCTTGG + Intergenic
926039162 2:9659072-9659094 ATGTAAGCAATGCTGAAACCAGG - Intergenic
927577530 2:24212029-24212051 CTGTAATCAATGGTTAATCGTGG + Intronic
929526900 2:42712651-42712673 CTTTATGCAATGAAGAATTTTGG - Intronic
929765415 2:44839978-44840000 CTGTAAACAAAGATGTATTTGGG + Intergenic
929977526 2:46649783-46649805 TTGTTAGCAATGCAGAATCTTGG - Intergenic
930630058 2:53743726-53743748 ATGTAAGCAATTATGAAACTAGG - Intronic
932083978 2:68740954-68740976 CTTTAAGCAGTAGTGAATCTGGG + Intronic
932422975 2:71612312-71612334 CTGTAAGAAATGTTGAGTCCCGG + Intronic
933767421 2:85719581-85719603 TTGTAAGCAGTGATGAATGGAGG + Intergenic
935646619 2:105341730-105341752 TTGTAAGAAATGGAGAATCTGGG - Intronic
936652969 2:114450939-114450961 CCGTCAGCAATGATTCATCTTGG - Intronic
940973296 2:159917255-159917277 GTCTAAACAATGAAGAATCTGGG + Intergenic
941426958 2:165359204-165359226 CTGTAAACAATTACGCATCTTGG - Intronic
942303024 2:174580550-174580572 CTGTAGTCTAGGATGAATCTTGG + Intronic
943452580 2:188063320-188063342 CTGTAACCAATGAAGAAAGTGGG - Intergenic
945538105 2:211045668-211045690 CAGTTAGCCATGATGAATTTGGG - Intergenic
947881670 2:233520041-233520063 ATGTCAGGAATGATGAATGTGGG + Intronic
1169858851 20:10131420-10131442 TTGTAAGAAATGCAGAATCTCGG + Intergenic
1170610349 20:17907678-17907700 CAGGCAGCAATGATGGATCTTGG - Intergenic
1172202975 20:33139792-33139814 CTGTAAGCTATGGTCAGTCTGGG + Intergenic
1174748340 20:53086568-53086590 CTGTCAGGAATGATGTATATAGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1178090967 21:29162769-29162791 TTGAAAGCAATGATAACTCTGGG + Intronic
1178373741 21:32049599-32049621 CTGTTAGCAAACATGTATCTAGG - Intergenic
1179918753 21:44495560-44495582 TTGTAGGCAATGATGAAATTGGG - Intergenic
1180106182 21:45619558-45619580 ATTTGAGCAATAATGAATCTCGG - Intergenic
950196087 3:11010286-11010308 CTGTCAGAAATGCAGAATCTTGG - Intronic
953117785 3:40009987-40010009 CTTTAAGGAATGATGAGCCTAGG + Intronic
959804090 3:110530092-110530114 CTGTTAACAATGATAAATCTGGG + Intergenic
960643475 3:119852179-119852201 CTGAAAGCCATGATGACTTTGGG + Intronic
964355939 3:155852040-155852062 CTGTCAGTGATGATGAATTTAGG - Intronic
964365898 3:155950642-155950664 CAGTAAGCCCTGAAGAATCTGGG - Intergenic
965116011 3:164489656-164489678 CAGTAAGTAATGATAAAACTAGG + Intergenic
966754496 3:183355852-183355874 CTGTCAGAAATGCAGAATCTGGG - Intronic
971636585 4:29067951-29067973 ATGTAAGGAATGATGAGTTTAGG + Intergenic
972804658 4:42516471-42516493 CTTTAATCAGTGATGAATCTAGG + Intronic
972849017 4:43025624-43025646 CTGCAAGCAATTAAGAATCCAGG - Intronic
973131917 4:46658417-46658439 CAGTATGCAATGATGAAGCATGG + Intergenic
973940838 4:55909002-55909024 TTGTAAGAAATGCAGAATCTTGG - Intergenic
974466401 4:62262080-62262102 CTGTGAGGAATGTTGGATCTGGG - Intergenic
974491439 4:62570243-62570265 CTTTAAGAAATGTTGAATATAGG + Intergenic
975243191 4:72087198-72087220 CTCTAAGCACTGAAAAATCTGGG + Intronic
976102374 4:81579669-81579691 CAGCAAGCCATGAGGAATCTAGG + Intronic
976769374 4:88634558-88634580 CTGCGAGCACTGACGAATCTGGG + Intronic
977179243 4:93853894-93853916 CTTTAAACAAGGATGAATCGAGG + Intergenic
987690304 5:21257536-21257558 ATCTCAGCAATGATCAATCTTGG - Intergenic
987870180 5:23606773-23606795 CTGTCAGCACTGATGTTTCTTGG - Intergenic
987967698 5:24896889-24896911 CTGTAAGCAATAATGTGGCTGGG + Intergenic
990205414 5:53423925-53423947 CTGTCAGCAATGGGCAATCTTGG - Intergenic
990208191 5:53452854-53452876 CTGTAAGAAATGATGAGACCTGG + Intergenic
990519750 5:56567389-56567411 CAGGAAGCAATCATGCATCTGGG + Intronic
990525004 5:56616666-56616688 CTGTTAGCAAAGGTGAATCCAGG + Intergenic
991765521 5:69973693-69973715 CTATAAACAATGATAAAACTGGG - Intergenic
991781801 5:70144468-70144490 CTATAAACAATGATAAAACTGGG + Intergenic
991844757 5:70848765-70848787 CTATAAACAATGATAAAACTGGG - Intergenic
991874244 5:71144782-71144804 CTATAAACAATGATAAAACTGGG + Intergenic
992192519 5:74307528-74307550 CAGTAAGCAATGAGGAGTCCTGG - Intergenic
992647408 5:78824471-78824493 CTGTTAGAAATGCTGAATTTGGG + Intronic
992826966 5:80559348-80559370 CTGGAAGCAATGATGATACCTGG - Exonic
992833309 5:80616443-80616465 ATGTAAACAATCATGAATCTAGG + Intergenic
994299717 5:98133085-98133107 TTGTAAGAAATGTAGAATCTTGG + Intergenic
996568623 5:124908195-124908217 CCCAAAGCAATGAAGAATCTGGG - Intergenic
996854899 5:127994868-127994890 TTATAAGCAATGATAAATATTGG + Intergenic
996990068 5:129618923-129618945 CTGTAACCAATGTTGAATCATGG - Intronic
1000943921 5:167397115-167397137 CTGTAAGAAATCTTGAATATAGG + Intronic
1001557895 5:172648701-172648723 CTGTAAGCATTTAGAAATCTTGG + Intronic
1004612965 6:17263771-17263793 CTGTAAACAATTATTAATATAGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005123848 6:22422514-22422536 GTGTCAGAAATGATCAATCTGGG - Intergenic
1005899008 6:30201399-30201421 CTGGAAGCACTAATGGATCTAGG + Intronic
1006445856 6:34079448-34079470 CTGAATGCAACGATGAAGCTGGG - Intronic
1008163696 6:48108775-48108797 ATATAAACAATGATAAATCTAGG + Intergenic
1011622845 6:89258961-89258983 ATGTTAGCAATGTTGGATCTAGG + Intronic
1011754369 6:90483785-90483807 TTGTTAGAAATGATAAATCTTGG + Intergenic
1013085714 6:106855384-106855406 CTGTCATCAAAGATGAAGCTTGG - Intergenic
1015316335 6:131821132-131821154 TTGTAAGAAATGCAGAATCTTGG + Intronic
1016312548 6:142749707-142749729 CTGTAAGCAATGGAGAACCAAGG - Intergenic
1016941707 6:149487768-149487790 ATGTAAGAAAAGATGAGTCTGGG + Intergenic
1017296854 6:152807425-152807447 CTGTGAGCAATGTTGTATCCTGG - Intergenic
1020550104 7:9593593-9593615 TTGTAATCAAAGATGATTCTGGG + Intergenic
1022277743 7:28872668-28872690 GTGTAAGAAATGTTGAATCAAGG + Intergenic
1023075748 7:36481314-36481336 CTTTAAGAAATGCTGAATATAGG + Intergenic
1028406078 7:90475434-90475456 CTGGAAAAGATGATGAATCTTGG + Intronic
1028783498 7:94765224-94765246 ATATAAACAATGATGAATTTGGG - Intergenic
1031589182 7:123569112-123569134 CTGTAAGTACTGAGGATTCTGGG + Intronic
1032348578 7:131139415-131139437 CTGCAAGCAATGCTGAAGGTTGG - Intronic
1033680449 7:143589312-143589334 ATGTAACCACTGGTGAATCTAGG - Intergenic
1033704445 7:143872500-143872522 ATGTAACCACTGGTGAATCTAGG + Intronic
1034648630 7:152671301-152671323 ATGTTAGCAATGGTGGATCTAGG - Intronic
1034770165 7:153765976-153765998 TTGTAAGAAATGCAGAATCTTGG - Intergenic
1038148023 8:24915559-24915581 CTGTTTGCAAGGATGAGTCTGGG + Intronic
1038589544 8:28824191-28824213 CTGTAGGCAAGGATGACTCGAGG - Intronic
1038645557 8:29358747-29358769 ATGTTCCCAATGATGAATCTAGG - Intergenic
1040685005 8:49861180-49861202 CTGTAGGCAGGGATGAGTCTTGG - Intergenic
1041128041 8:54665682-54665704 CTCTAAGAACTGATGAAACTGGG - Intergenic
1045879748 8:107024849-107024871 CTGCAAGCAATTATGTATTTAGG - Intergenic
1048639749 8:136341788-136341810 CAGTAATCAATGATGTATTTAGG + Intergenic
1048733650 8:137472960-137472982 CTGTAATCAATGACAAATCTAGG - Intergenic
1050727114 9:8663040-8663062 CTGTTAGCAATGATAAAACCTGG + Intronic
1050861632 9:10440650-10440672 TTGAAAGCAATGAGAAATCTAGG + Intronic
1052236936 9:26222066-26222088 CTTTAACCAATGATGTCTCTTGG - Intergenic
1053169046 9:35865274-35865296 CTTTAAGCTTTGATGAATCCAGG - Intergenic
1054808247 9:69412967-69412989 CTGTTAGCCACGATGATTCTAGG - Intergenic
1057773832 9:97989134-97989156 CTTTAAGTTATGATGAGTCTAGG - Intronic
1059896358 9:118870401-118870423 CTGTTAGCAATGGTGAGCCTGGG + Intergenic
1060003517 9:119979863-119979885 CTGTAAACAATACTGAGTCTTGG - Intergenic
1060719499 9:125966147-125966169 CTGTCAACAATGTTAAATCTTGG - Exonic
1185744757 X:2563818-2563840 CTGTACACAATGTTGAATGTAGG + Intergenic
1186322961 X:8450483-8450505 CTATATGCAATGATAAATCCAGG + Intergenic
1187192792 X:17052231-17052253 CTCAAAGCAATTATGAATCATGG - Intronic
1187269618 X:17768029-17768051 ATGTAAGCAATGCTGGATTTAGG + Intergenic
1188762362 X:34048610-34048632 CTGATAGCAATGATGAAGATAGG + Intergenic
1189766826 X:44380722-44380744 CTGTAGGCAATGTTTAATCCCGG + Intergenic
1190577691 X:51857506-51857528 CCTTATGCAATGATGAATGTGGG + Intronic
1192126113 X:68502433-68502455 CTGTAAGAAATGCAAAATCTCGG - Intronic
1194004663 X:88475774-88475796 CTGAAAGCAATGGTGTATCTTGG + Intergenic
1194440556 X:93928418-93928440 CACTATACAATGATGAATCTGGG + Intergenic